Commit e74fe8cf authored by mk11g11's avatar mk11g11
Browse files

corrections

parent 9e297c11
......@@ -9,7 +9,7 @@ nocite: |
Insecticides are compounds utilised in agriculture, medicine, industry and private households to protect crops, life-stock and human health from pest infestation [@anadon2009; @dryden2009; @oberemok2015]. Their identity evaluated over the years to improve the effectiveness and reduce the undesirable effects on human health and the environment [@casida1998].
Until late 1800s organic, natural compounds contained within the plant or animal matter were utilised [@casida1998]. The first record of agricultural application of nicotine-containing Tobacco [@david1953; @steppuhn2004] dates back to 1690 [@mcindoo1943]. Tobacco plant, has been used in France, England and the US to protect orchards and trees against a wide range of pests including aphids, caterpillars and plant lice [@@mcindoo1943]. *Chrysanthemum* plants containing pyrethrum were used against worms and insects in America and Europe [@elliot1995]. These treatments were however suitable only for small scale agricultural treatment, due to the limited availability.
Until late 1800s organic, natural compounds contained within the plant or animal matter were utilised [@casida1998]. The first record of agricultural application of nicotine-containing Tobacco [@david1953; @steppuhn2004] dates back to 1690 [@mcindoo1943]. Tobacco plant, has been used in France, England and the US to protect orchards and trees against a wide range of pests including aphids, caterpillars and plant lice [@mcindoo1943]. *Chrysanthemum* plants containing pyrethrum were used against worms and insects in America and Europe [@elliot1995]. These treatments were however suitable only for small scale agricultural treatment, due to the limited availability.
Arsenic compounds were the earliest inorganic insecticides. Although their history dates back to 5th century [@kerkut1985], they did not gain popularity until the 19th century. Aceto-arsenite Paris Green was used in controlling Colorado potato beetles and mosquitoes [@cullen2008; @peryea1998], whereas lead arsenate was an effective insecticide for apple and cherry orchards [@peryea1998]. Although effective against pests, these substances are toxic to humans [@nelson1973; @gibb2010; @argos2010] thus their use marginal [@echa2017].
......@@ -35,36 +35,30 @@ library(kableExtra)
threeparttable = T)
```
## Neonicotinoids
## Structural diversity of the neonicotinoid insecticides
### Synthesis
In 1970s, the scientists of Shell Development Company Biological Research Centre in California identified $\alpha$- DBPN (2-(dibromonitromethyl)-3-(methylpyridine)), first synthesised by Prof. Henry Feuer [@feuer1986]. This lead compound showed low insecticidal activity against aphid and house fly [@tomizawa2003; @tomizawa2005]. Structural alterations of DBPN resulted in production of nithiazine (Figure \@ref(fig:neonics-structure-label)). Nithiazine showed improved insecticidal activity and was particularly effective as a new housefly repellent [@kollmeyer1999]. Further replacement of the thiazine ring by chloropyridinylmethyl (CPM) group, addition of the imidazolidine or its acyclic counterpart, and retention of the nitromethylene group resulted in generation of more potent compounds, one of which, nitenpyram, exhibited particularly high efficacy. Regrettably, both nithiazine and nitenpyram are not useful in fields, as they are unstable in light. The latter however is successfully used in veterinary medicine as an external parasite treatment for cats and dogs.
In 1970s, the scientists of Shell Development Company Biological Research Centre in California identified alpha- DBPN (2-(dibromonitromethyl)-3-(methylpyridine)), first synthesised by Prof. Henry Feuer [@feuer1986]. This lead compound showed low insecticidal activity against aphid and house fly [@tomizawa2003; @tomizawa2005]. Structural alterations of DBPN resulted in production of nithiazine (Figure \@ref(fig:neonics-structure-label)). Nithiazine showed improved insecticidal activity and was particularly effective as a new housefly repellent [@kollmeyer1999]. Further replacement of the thiazine ring by chloropyridinylmethyl (CPM) group, addition of the imidazolidine or its acyclic counterpart, and retention of the nitromethylene group resulted in generation of more potent compounds, one of which, nitenpyram, exhibited particularly high efficacy. Regrettably, both nithiazine and nitenpyram are not useful in fields, as they are unstable in light. The latter however is successfully used in veterinary medicine as an external parasite treatment for cats and dogs.
To solve the issue of photo-instability, nitromethylene group (CCHNO2) was replaced by nitroguanidine (CNNO2) and cyanoamidine (CNCN) (Figure \@ref(neonics-structure-label) and @kagabu1995). These chemical moieties have absorbance spectra at much shorter wavelengths hence do not degrade upon exposure to sunlight. Further alterations, such as replacement of imidazolidine by thiazolidine or oxadiazinane, and/or chloropyridinylmethyl by chlorothiazole or tetrahydrofuran (THF) did not hinder insecticidal activity [@yamamoto1999]. As a result of these modifications, all 6 currently used neonicotinoids were synthesised. They are grouped according to their pharmacophore into N-nitroguanidines, nitromethylenes and N-cyanoamidines (Figure \@ref(fig:neonics-structure-label)). Generally compounds with acyclic- guanidine or amidine and with nitromethylene are more efficacious against moth- and butterfly- pests than those with cyclic counterparts or nitroimine respectively [@ihara2006], nevertheless all are commonly used in agriculture. Imidacloprid, currently the most widely used neonicotinoid, was synthesised in 1970 in Bayer Agrochemical Japan and introduced to the EU market in 1991. Its trade names include Confidor, Admire and Advantage. Together with thiacloprid (Calypso), imidacloprid is marketed by Bayer CropScience. Thiamethoxam (Actara) is produced by Syngenta, Clothianidin (Poncho, Dantosu, Dantop) and Nitenpyram (Capstar) by Sumitomo Chemical, acetamiprid (Mospilan) by Certis, whereas dinotefuran (Starkle) by Mitsui Chemicals company. Last neonicotinoid (dinotefuran) was launched in the EU in 2008.
To solve the issue of photo-instability, nitromethylene group (CCHNO2) was replaced by nitroguanidine (CNNO2) and cyanoamidine (CNCN) (Figure \@ref(fig:neonics-structure-label) and @kagabu1995). These chemical moieties have absorbance spectra at much shorter wavelengths hence do not degrade upon exposure to sunlight. Further alterations, such as replacement of imidazolidine by thiazolidine or oxadiazinane, and/or chloropyridinylmethyl by chlorothiazole or tetrahydrofuran (THF) did not hinder insecticidal activity [@yamamoto1999]. As a result of these modifications, all 6 currently used neonicotinoids were synthesised. They are grouped according to their pharmacophore into N-nitroguanidines, nitromethylenes and N-cyanoamidines (Figure \@ref(fig:neonics-structure-label)). Generally compounds with acyclic- guanidine or amidine and with nitromethylene are more efficacious against moth- and butterfly- pests than those with cyclic counterparts or nitroimine respectively [@ihara2006], nevertheless all are commonly used in agriculture. Imidacloprid, currently the most widely used neonicotinoid, was synthesised in 1970 in Bayer Agrochemical Japan and introduced to the EU market in 1991. Its trade names include Confidor, Admire and Advantage. Together with thiacloprid (Calypso), imidacloprid is marketed by Bayer CropScience. Thiamethoxam (Actara) is produced by Syngenta, Clothianidin (Poncho, Dantosu, Dantop) and Nitenpyram (Capstar) by Sumitomo Chemical, acetamiprid (Mospilan) by Certis, whereas dinotefuran (Starkle) by Mitsui Chemicals company. Last neonicotinoid (dinotefuran) was launched in the EU in 2008.
Research into novel neonicotinoids continues [@shao2013]. In the last decade, several novel insecticides have been characterised and approved for use in the EU. Sulfoxafrol [@zhu2011; @eu2019a] and flupyradifurone [@nauen2015; @eu2019b] have been classified as representatives of new chemical classes, namely sulfoximines and butenolides. However, due to their mode of action and similar biochemical properties, some argue that they are in fact neonicotinoids, whereas their mis-classification has been deliberate to avoid association with neonicotinoids [@pan2019].
(ref:neonics-structure) **Development and chemical structures of synthetic insecticides neonicotinoids.** Systematic modification of the lead and prototype compounds led to the discovery of seven neonicotinoids currently used in agriculture and animal health. They are structurally related to nicotine (shown in top right corner) and classified according to the pharmacophore moiety into N-nitroguanidines, N-cyanoamidines and nitromethylenes.
(ref:neonics-structure) **Development and chemical structures of the synthetic insecticides, the neonicotinoids.** Systematic modification of the lead and prototype compounds led to the discovery of seven neonicotinoids currently used in agriculture and animal health. They are structurally related to nicotine (shown in top right corner) and classified according to the pharmacophore moiety into N-nitroguanidines, N-cyanoamidines and nitromethylenes.
```{r neonics-structure-label, fig.cap="(ref:neonics-structure)", fig.scap='Development and chemical structures of synthetic insecticides neonicotinoids.',fig.align='center', out.height = '90%', echo = FALSE}
knitr::include_graphics("fig/general_intro/png/neonics_structure.png")
```
### Economical status ###{#economicalstatus}
## Economical status of neonicotinoids ###{#economicalstatus}
The use of neonicotinoids in agriculture has been increasing steadily since their launch in the early 1990s. By 2008, they became major chemicals in the agriculture, replacing organophosphates and carbamates [@jeschke2011]. Continual increase in popularity of neonicotinoids is reflected in the total usage data. In Great Britain, the yearly use of neonicotinoids increased by over 10-fold from 10 tonnes/year in 1996 to over 105 tonnes/year in 2016 [@fera2019]. Similar trends are observed in the U.S. [@usgs2019], Sweden and Japan [@simon-delso2015]. Continual increase in usage coincides with the rise in their economical impact. In 2008, the estimated global market value of neonicotinoids was 1.5 bn dollars [@jeschke2011]. This increased to 3.1 bn dollars in 2012 [@bass2015].
The widespread usage and monetary value of neonicotinoids is a reflection of their many advantages.
<!-- Important in the pest managment, used in over 120 coutries on 140 crop types [@jeschke2011]. -->
### Properties ##{#physchem}
One of the major benefits of neonicotinoids are their physical and chemical profiles (Table \@ref(tab:properties)).
#### Diverse methods of applications
## Psysicochemical properties of neonicotinoids grant versitile methods of application ##{#physchem}
Due to relatively high water solubility, neonicotinoids act as systemic insecticides [@westwood1998]. This means that once applied on crops, they dissolve in the available water and can be taken up by the developing roots or leaves. Upon plant entry, they are then distributed to all parts of the plant [@westwood1998; @stamm2016], providing protection against herbivorous pests [@stamm2016]. This property of neonicotinoids means they can be used as a seed coating, reducing the required frequency of application. Indeed, seed dressing is the most commonly used method, accounting for 60 % of all neonicotinoids applications worldwide [@jeschke2011] and particularly popular to protect potatoes, oilseed rape, cereal, sunflower and sugar beet. In addition, neonicotinoids half-life in soil is from several weeks to years [@cox1997; @sarkar2001; @gupta2007), hence seed-dressing creates a continual source for re-uptake by plants. Neonicotinoids are also suitable for ground treatment and are used as soil drenching for the protection of citrus trees and vines, granules for amenity grassland and ornament flowers and as a trunk-injection to protect trees against herbivores. They are not volatile, therefore can be also applied as spray. This method is used in garden for flowers and vegetables and in agriculture on soft fruits and greenhouse crops. Low lipophilicity, indicated by octanol/water partition coefficient value (log Pow), suggest they do not bio-accumulate in the adipose tissues of animals [@turaga2016]. However, moderate water solubility combined with low lipophilicity means they may have a potential to accumulate in water.
One of the major benefits of neonicotinoids are their physical and chemical profiles (Table \@ref(tab:properties)). Due to relatively high water solubility, neonicotinoids act as systemic insecticides [@westwood1998]. This means that once applied on crops, they dissolve in the available water and can be taken up by the developing roots or leaves. Upon plant entry, they are then distributed to all parts of the plant [@westwood1998; @stamm2016], providing protection against herbivorous pests [@stamm2016]. This property of neonicotinoids means they can be used as a seed coating, reducing the required frequency of application. Indeed, seed dressing is the most commonly used method, accounting for 60 % of all neonicotinoids applications worldwide [@jeschke2011] and particularly popular to protect potatoes, oilseed rape, cereal, sunflower and sugar beet. In addition, neonicotinoids half-life in soil is from several weeks to years [@cox1997; @sarkar2001; @gupta2007), hence seed-dressing creates a continual source for re-uptake by plants. Neonicotinoids are also suitable for ground treatment and are used as soil drenching for the protection of citrus trees and vines, granules for amenity grassland and ornament flowers and as a trunk-injection to protect trees against herbivores. They are not volatile, therefore can be also applied as spray. This method is used in garden for flowers and vegetables and in agriculture on soft fruits and greenhouse crops. Low lipophilicity, indicated by octanol/water partition coefficient value (log Pow), suggest they do not bio-accumulate in the adipose tissues of animals [@turaga2016]. However, moderate water solubility combined with low lipophilicity means they may have a potential to accumulate in water.
<!-- Although structurally related nicotine has similar properties, it is not appropriate for the agricultural use due to low toxicity to insects [@nauen1996]. -->
......@@ -89,7 +83,7 @@ library(kableExtra)
threeparttable = T)
```
#### Highly potent against insect pests ####{#potentpests}
## Neonicotinoids are highly potent against insect pests ####{#potentpests}
<!-- look at this paper to see the symptoms of imi exposure on insects -->
<!-- @sone1994 -->
......@@ -145,7 +139,7 @@ library(dplyr)
# to calculate the ng/mg cocroach divided by 175, bee by 100
```
#### Selectively toxic to insect pests. ###{#seltox}
#### Selectively toxic to insect pests ###{#seltox}
One of the key determinants of success of agrochemical compounds is their ability to selectively target insects over non-target species. Neonicotinoids are generally effective at ~ 2 $\mu$M concentrations against piercing-sucking pest infestations, whereas their LD50s is in the region of 0.2 - 0.3 ng/mg of body weight [@mota-sanchez2006; @zewen2003; @tomizawa2000; @alexander2007]. The LC(D)50 values for non-target species is at least 2 times higher (Table \@ref(tab:toxallanimal)). Honeybees (*Apis mellifera*) are among the most susceptible non-targets, with the average LC50 and LD50 values for imidacloprid of 7.04 $\mu$M and 4.5 ng per mg of body weight, respectively [@cresswell2011]. Some studies report high potency of neonicotinoids on earth worms, with the LC50 as low as 2.74 $\mu$M on redworm *Eisenia fetida* (*E. fetida*) [@luo1999]. Fish and birds are hundred fold less susceptible [@decant2010], whereas mammals are the least susceptible with LD50 doses higher than 130 mg/kg of body weight [@decant2010; @legocki2008]. This differential susceptibility between target and non-target species, in expected to enable an environmental release of neonicotinoids at concentrations which will exterminate pests without killing the non-targets. Indeed, field realistic concentrations of neonicotinoids are higher than those causing lethality of the most susceptible species (i.e. worms and honey bee).
......@@ -168,7 +162,7 @@ The concentration of neonicotinoids in soils with several years of history of tr
#### Insect pollinators ####{#sublethalbees}
Pollinating services are provided by many species of bees, flies, beetles and bats [@thapa2006]. Eightly percent of the total pollinating activity is carried out by bees [@thapa2006]. There are over 20 000 species of bees, 267 of each life in the UK [@breeze2012a]. Among them are honeybees (*Apis mellifera*, *A. mellifera*), bumblebees and over 220 species of solitary bees. Honeybees and bumblebees served as platform to determine toxic effect of neonicotinoids on biological pollinators. Although field realistic neonicotinoids are not expected to kill bees, a substantial body of evidence from lab- and field- based experiments suggest that they can impair on the cognitive function and reproduction of these biological pollinators.
Pollinating services are provided by many species of bees, flies, beetles and bats [@thapa2006]. Eighty percent of the total pollinating activity is carried out by bees [@thapa2006]. There are over 20 000 species of bees, 267 of each life in the UK [@breeze2012a]. Among them are honeybees (*Apis mellifera*, *A. mellifera*), bumblebees and over 220 species of solitary bees. Honeybees and bumblebees served as platform to determine toxic effect of neonicotinoids on biological pollinators. Although field realistic neonicotinoids are not expected to kill bees, a substantial body of evidence from lab- and field- based experiments suggest that they can impair on the cognitive function and reproduction of these biological pollinators.
##### Reduced olfactory learning and memory
......@@ -193,7 +187,7 @@ To investigate the effects of neonicotinoids on soil dwellers, worms were expose
##### Earth worms
Clothianidin and thiacloprid at concentrations $\ge$ than 1.2 $\mu$M and the EC50 of 5.1 $\mu$M and 3.4 $\mu$M, respectively reduced the reproductive potential of redworm *E. fetida*, as measured by the cocoon production [@gomez-eyles2009]. Neonicotinoids showed a negative impact on the reproduction of other species, including *Lumbricus rubellus* (*L. rubellus*) [@baylay2012], *Dendrobaena octaedra* (*D. octaedra*) [@kreutzweiser2008] and *Eisenia andrei* [@alves2013]. Reduction of body weight of *E. fetida* and *D. octaedra* were observed after 14-day treatment with imidacloprid at 27.08 and 54.75 $\mu$M [@kreutzweiser2008]. Imidacloprid at 488.85 nM to 7.82 $\mu$M increased avoidance of *E. andrei* [@alves2013], whereas at 782 nM it reduced the *A. caliginosa* burrowing depth and length [@dittbrenner2011]. Burrowing of *L. terrestris* was also impacted, but at higher imidacloprid concentrations [@dittbrenner2011].
##### Soil nematodes #####{soilnematodesneonicstoxicity}
##### Soil nematodes #####{#soilnematodesneonicstoxicity}
Neonicotinoids also induce a sublethal effect on the the free-living nematode *C. elegans*. Thiacloprid and imidacloprid have an effect on the reproduction of *C. elegans* with EC50 of 1.14 nM and 2.09 mM, respectively [@gomez-eyles2009]. Thiacloprid at 37 nM has an effect on chemosensing, whereas at 18 $\mu$M it impairs motility of this free living nematode [@hopewell2017]. Impaired motility of *C. elegans* in response to $\ge$ 120 $\mu$M imidacloprid was also recorded [@mugova2018]. Taken together, neonicotinoids have sublethal effects on earth worms and soil nematodes at concentrations as low as nM.
Most of the doses effective against worms are higher than the average doses of neonicotinoids in the field. However, the presence of clothianidin, imidacloprid and thiamethoxam has been detected at lower than average levels, such as 80.10 nM for imidacloprid, 23.01 nM for imidacloprid and 68.56 nM for thiamethoxam [@jones2014]. This suggests that the environmentally relevant concentrations of neonicotinoids may negatively impact on the the well-being of soil dwellers.
......@@ -220,11 +214,11 @@ The environmental ecotoxicity of neonicotinoids highlights the importance of sel
### nAChR structure ###{#structure}
nAChRs are members of the pentameric ligand-gated ion channels which are found in a diversity of species from bacteria to human. They are the representatives of the Cys-loop superfamily of channels which also include $\gamma$ -aminobutyric acid type A (GABA) receptors, 5-hydroxytryptamine type-3 receptors (5-HT3), and glycine receptors. Structural studies of the nAChRs from the muscle of the electric fish **Torpedo** (Figure \@ref(fig:structure-nachr-label)a) shed light on the the stoichiometry, the shape and the size of Cys-loop receptors.
nAChRs are members of the pentameric ligand-gated ion channels which are found in a diversity of species from bacteria to human. They are the representatives of the Cys-loop superfamily of channels which also include $\gamma$ -aminobutyric acid type A (GABA) receptors, 5-hydroxytryptamine type-3 receptors (5-HT3), and glycine receptors. Structural studies of the nAChRs from the muscle of the electric fish *Torpedo* (Figure \@ref(fig:structure-nachr-label)a) shed light on the the stoichiometry, the shape and the size of Cys-loop receptors.
The identity of the NMJ nAChR was first investigated using indirect, biochemical approaches. Membrane bound NMJ receptors were isolated by in-situ cross-linking with a radiolabelled antagonist and a subsequent purification. SDS-resolved fragments pattern suggesting the pentameric nature of these receptors [@hucho1986; @schiebler1980] of the total size 270 000 kDa composed of 4 different subunits namely $\alpha$, $\beta$, $\delta$ and $\gamma$ arranged into a pentamer. The SDS-PAGE pattern and the analysis of nAChR complexes purified with the use of non-denaturing buffer led to a suggestion that the stechiometry is: $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise) [@reynolds1978]. Heterologous expression in Xenopus oocytes confirmed that 4 subunits are needed to achieve expression. In the absence of any other one of the subunits, the responses to acetylcholine were either absent or greatly reduced, therefore 4 subunits are required for the normal function of this protein [@mishina1984].
The stiochiometry and structural details of muscle type nAChRs were confirmed by more direct structural approaches: cryo- and electron-microscopy. The receptor protein is in the shape of an elongated, 125 Å funnel [@unwin1993; @toyoshima1990]. It consists of large, extending to the synaptic space [@toyoshima1990] N-terminal ligand binding domain [@sigel1992], the membrane spanning pore-domain [@eisele1993], intracellular MA helix [@toyoshima1990; @unwin1993], and C-terminus positioned extracellularly. Constituting nAChR subunits are arranged pseudosymmetrically, around the central ion conduction pore [@brisson1985]. The subunit composition of the neuromuscular nAChR follows the strict order of $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise). Each subunit of the nAChR contains 4 transmembrane helices [@noda1982; @noda1983] named M1, M2, M3 and M4, as moving from N- to C- terminus. M1, M3 and M4 are exposed to the plasma membrane [@blanton1994], shielding M2, pore-forming helices [@imoto1986; @hucho1986] from the hydrophobic environment of the bilayer. As the outer helices progress from the outer to the inner leaflet of the membrane, they tilt inwards [@miyazawa2003], narrowing down the width of the channel. M2 on the other hand, bends roughly in the middle of the bilayer [@unwin1995], where it forms the most restricted part of the ion conductivity pathway. There are hydrophobic interactions between the outer helices, which stabilise the outer wall of the receptor and hence limit the conformational changes adopted by the inner helix. In contrast there are no extensive bonds between the inner and outer helices [@miyazawa2003]. As lining pore structures, the inner helix and flanking sequences contain molecular determinants for ion selectivity, permeability, the rate of conductance and gating. These were investigated by pharmacological, biochemical and electrophysiological approaches. [@imoto1988; @imoto1991; @konno1991] investigated the function of several rings of anionic and neutral amino acids with side chains facing towards each other in the centre of the pore. The so called intermediate ring (constituting of αE241 and equivalent) and the adjacent to $\alpha$ E241 in helical configuration central ring, (formed by $\alpha$ L244 and equivalent) form a narrow constriction of the ion pore, hence have the strongest effect on the conductance rate [@imoto1991; @imoto1988]. In addition, the negatively charged side chains of intermediate ring are crucial for ion selectivity [@konno1991]. The gating of the channel is governed by conserved leucine residues, slightly towards the extracellular side from the centre of the bilayer with side chains projecting inwards [@unwin1995], hence occluding the passage for ions.
The stiochiometry and structural details of muscle type nAChRs were confirmed by more direct structural approaches: cryo- and electron-microscopy. The receptor protein is in the shape of an elongated, 125 Å funnel [@unwin1993; @toyoshima1990]. It consists of large, extending to the synaptic space [@toyoshima1990] N-terminal ligand binding domain [@sigel1992], the membrane spanning pore-domain [@eisele1993], intracellular MA helix [@toyoshima1990; @unwin1993], and C-terminus positioned extracellularly. Constituting nAChR subunits are arranged pseudosymmetrically, around the central ion conduction pore [@brisson1985]. The subunit composition of the neuromuscular nAChR follows the strict order of $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise). Each subunit of the nAChR contains 4 transmembrane helices [@noda1982; @noda1983] named M1, M2, M3 and M4, as moving from N- to C- terminus. M1, M3 and M4 are exposed to the plasma membrane [@blanton1994], shielding M2, pore-forming helices [@imoto1986; @hucho1986] from the hydrophobic environment of the bilayer. As the outer helices progress from the outer to the inner leaflet of the membrane, they tilt inwards [@miyazawa2003], narrowing down the width of the channel. M2 on the other hand, bends roughly in the middle of the bilayer [@unwin1995], where it forms the most restricted part of the ion conductivity pathway. There are hydrophobic interactions between the outer helices, which stabilise the outer wall of the receptor and hence limit the conformational changes adopted by the inner helix. In contrast there are no extensive bonds between the inner and outer helices [@miyazawa2003]. As lining pore structures, the inner helix and flanking sequences contain molecular determinants for ion selectivity, permeability, the rate of conductance and gating. These were investigated by pharmacological, biochemical and electrophysiological approaches. [@imoto1988; @imoto1991; @konno1991] investigated the function of several rings of anionic and neutral amino acids with side chains facing towards each other in the centre of the pore. The so called intermediate ring (constituting of $\alpha$E241 and equivalent) and the adjacent to $\alpha$ E241 in helical configuration central ring, (formed by $\alpha$ L244 and equivalent) form a narrow constriction of the ion pore, hence have the strongest effect on the conductance rate [@imoto1991; @imoto1988]. In addition, the negatively charged side chains of intermediate ring are crucial for ion selectivity [@konno1991]. The gating of the channel is governed by conserved leucine residues, slightly towards the extracellular side from the centre of the bilayer with side chains projecting inwards [@unwin1995], hence occluding the passage for ions.
<!-- ALSO TALK ABOUT THE NEGATIVELY CHARGED VESTIBULE HERE -->
(ref:structure-nachr) **Structural features of the nicotinic acetylcholine receptor.** Torpedo nAChR is a transmembrane protein, made up of 5 subunits (colour-coded), arranged around the ion conductivity pore. Each subunit consists of extracellular ligand-binding, transmembrane and intracellular domain (a) (PBD code:2BG9). Extracellular domain of a single subunit consists of 10 $\beta$-strands and N-terminal $\alpha$-helix. It contains a disulphide bridge between Cys192 and Cys193 (highlighted in yellow) (b). Fully formed receptors have five ligand binding pockets formed by the contributions from the neighboring subunits (A-B, B-C, C-D, D-E and E-A), named the principle and the adjacent components, respectively. Top view of the molluscan AChBP (PDB:1I9B) with amino acids forming the agonist binding site in ball and stick representation (c). Images generated with the UCSF Chimera software.
......@@ -233,13 +227,13 @@ The stiochiometry and structural details of muscle type nAChRs were confirmed by
knitr::include_graphics("fig/general_intro/png/crystal_structure_nachr.png")
```
### Model of the binding site
### Model of the nAChR binding site ###{#modelodnachbinding}
Determination of the crystal structure of the molluscan acetylcholine binding protein [@brejc2001, Figure \@ref(fig:binding-pocket-label)b and c)] provided a platform to study the ligand binding domain of nAChRs. Acetylcholine binding protein (AChBP) is a soluble protein, secreted by snail glial cells into the cholinergic synapses to bind released ACh and modulate neurotransmission [@sixma2003]. It shares 24 % sequence identity with mammalian $\alpha7$ homopentameric receptor. It is has similar structure to the extracellular domain of the nAChRs mammalian $\alpha1$ [@dellisanti2007] and $alpha7$ [@li2011]. It is a homopentamer with N-terminal helix and 10 $\beta$sheets. It also shares similar pharmacological properties to this receptor. AChBP binds to classical nAChR agonist and antagonists: nicotine, acetylcholine and $\alpha$-bungarotoxin [@smit2001]. Therefore AChBP is considered a good model for the nAChR ligand-binding domain structural studies. The structures of AChBP inactive [@brejc2001], bound to agonist and antagonist [@celie2004; @hansen2005], chimera $\alpha1$ [@dellisanti2007] and $\alpha7$ are known [@li2011]. The common structural features of the ligand binding site emerge from all available data. Here data from the great pond snail *Lymnaea stagnalis* (Ls) will be discussed.
Determination of the crystal structure of the molluscan acetylcholine binding protein [@brejc2001, Figure \@ref(fig:binding-pocket-label)b and c)] provided a platform to study the ligand binding domain of nAChRs. Acetylcholine binding protein (AChBP) is a soluble protein, secreted by snail glial cells into the cholinergic synapses to bind released ACh and modulate neurotransmission [@sixma2003]. It shares 24 % sequence identity with mammalian $\alpha7$ homopentameric receptor. It is has similar structure to the extracellular domain of the nAChRs mammalian $\alpha1$ [@dellisanti2007] and $\alpha7$ [@li2011]. It is a homopentamer with N-terminal helix and 10 $\beta$sheets. It also shares similar pharmacological properties to this receptor. AChBP binds to classical nAChR agonist and antagonists: nicotine, acetylcholine and $\alpha$-bungarotoxin [@smit2001]. Therefore AChBP is considered a good model for the nAChR ligand-binding domain structural studies. The structures of AChBP inactive [@brejc2001], bound to agonist and antagonist [@celie2004; @hansen2005], chimera $\alpha1$ [@dellisanti2007] and $\alpha7$ are known [@li2011]. The common structural features of the ligand binding site emerge from all available data. Here data from the great pond snail *Lymnaea stagnalis* (Ls) will be discussed.
<!-- (it unlike Ac, all aromatic residues in Ls are conserved). -->
### Agonist binding site ###{#bindingsite}
### Agonist binding site of nAChRs ###{#bindingsite}
The nicotinic acetylcholine receptor binding pocket is formed on the interface of the adjacent subunits [@brejc2001; @middleton1991; @blount1989, Figure \@ref(fig:binding-pocket-label)]. In case of the neuromuscular heteropentameric receptors, it constitutes of $\alpha$ and non-$\alpha$ subunit contributions, whereas in homopentameric or $\alpha$ heteropentameric receptors it is made up of neighboring subunits. The principal, $\alpha$-subunit site subsides amino acid side chains originating from discontinuous loops A (loop $\beta4$-$\beta5$), B (loop $\beta7$-$\beta8$) and C (loop $\beta9$-$\beta10$), whereas the complementary (non-$\alpha$) subunit contributes amino acid side chains originated from loop D (loop $\beta2$-$\beta3$), E (loop $\beta5$-$\beta6$) and F (loop $\beta8$-$\beta9$). Specific residues involved in the formation of the ligand binding pocket were depicted by the molluscan AChBP (Figure \@ref(fig:binding-pocket-label)). Amino acids of the principal component are: Tyr93, Trp147, Tyr188 and Tyr195, whereas non-$\alpha$ component contributes Trp53, Gln55, Arg104, Val106, Leu112 and Met114, Tyr164.
......@@ -249,7 +243,7 @@ The nicotinic acetylcholine receptor binding pocket is formed on the interface o
knitr::include_graphics("fig/general_intro/png/binding_pocket_3.png")
```
### Agonist pharmacophore ####{#pharmacophore}
### Pharmacophore of nAChR agonists ####{#pharmacophore}
Crystal structure of the AChBP bound to acetylcholine, carbamylcholine, nicotine [@celie2004] and its analogue epibatidine [@hansen2005] provided some general features of the nAChR binding pocket. More recently, structures of mammalian receptors: $\alpha9$ [@zouridakis2014] bound to methyllycaconitine, the artificially expressed $\alpha2$ extracellular domain bound to epibatidine [@kouvatsos2016] and $\alpha4\beta2$ receptor bound to nicotine [@morales-perez2016] have been obtained. These structures provide details of how structurally varied agonists bind to nAChRs.
......@@ -266,54 +260,53 @@ Cation-$\pi$ interactions and a hydrogen bond are the staple features of the lig
knitr::include_graphics("fig/general_intro/png/nicotinic_interactions.png")
```
### Neonicotinoid-pharmacophore
### Pharmacophore of neonicotinoids ###{#pharmacophoreofneonics}
Structure of AChBP proved to be valuable in determining structural elements which may account for neonicotinoids’ selectivity. @ihara2008; @talley2008; @ihara2014 derived crystal structures of the great pond snail (Lymnaea stagnalis, Ls) and California sea slug (Aplysia californica, Ac) AChBP complexed with bound neonicotinoids (imidacloprid, clothianidin, thiacloprid), and non-selective nAChR ligands- nicotinoids (nicotine, epibatidine and desmotroimidacloprid). Comparison of these structures revealed differences in binding modes between nicotinoids and neonicotinoids (see Appendix \@ref(fig:pharacophore-seq-label) for sequence alignment), which allowed for predictions of the binding interactions between neonicotinoids and insect receptors (Figure \@ref(fig:imi-binding-label)).
Structures of wild-type and mutant AChBP with increased affinity to neonicotinoids revealed no differences in the interactions between imidacloprid, clothianidin and thiacloprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2008; @talley2008; @matsuda2009; @ihara2015]. Thus, to describe the differences between neonicotinoids and nicotinoids, crystal structures of Ls AChBP complexed with nicotine and imidacloprid are compared (Figure \@ref(fig:imi-binding-label)). The positioning of the pyridine ring of imidacloprid and nicotine is virtually identical. The nitrogen forms identical interactions: hydrogen bond with the amide group of Met114 and carbonyl group of Leu102 of loop E, via water molecule [@@celie2004; @ihara2008; @talley2008]. In addition, chlorine atom of imidacloprid makes van der Waals interactions with oxygen of Ile106 and oxygen of Met116 of AChBP [@talley2008].
Structures of wild-type and mutant AChBP with increased affinity to neonicotinoids revealed no differences in the interactions between imidacloprid, clothianidin and thiacloprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2008; @talley2008; @matsuda2009; @ihara2015]. Thus, to describe the differences between neonicotinoids and nicotinoids, crystal structures of Ls AChBP complexed with nicotine and imidacloprid are compared (Figure \@ref(fig:imi-binding-label)). The positioning of the pyridine ring of imidacloprid and nicotine is virtually identical. The nitrogen forms identical interactions: hydrogen bond with the amide group of Met114 and carbonyl group of Leu102 of loop E, via water molecule [@celie2004; @ihara2008; @talley2008]. In addition, chlorine atom of imidacloprid makes van der Waals interactions with oxygen of Ile106 and oxygen of Met116 of AChBP [@talley2008].
Regarding 5-membered ring interactions, in nicotine-bound structures, the cationic nitrogen forms 3 interactions when bound to AChBP: the cation-$\pi$ with the ring of Trp143 (TrpB), as well as hydrogen bond with the backbone carbonyl of TrpB [@celie2004], as well as the cation-$\pi$ interaction with Tyr192 in loop A [@matsuda2009]. In imidacloprid bound structures, the ring stacks with aromatic residue Tyr185 of loop C (this interaction is also seen in epibatidine-bound structures) [@ihara2008]. These stacking interactions result in the formation of CH-$\pi$ interactions between the methyline bridge (CH2-CH2) of imidacloprid and TrpB. All residues described so far are conserved in other agonist-bound nAChR structures, therefore do not account for neonicotinoids-selectivity.
The differences come to light when one begins to dissect the interactions between imidacloprid ring substituents and the AChBP. Partially positive nitro group (NO2) of imidacloprid bridges to glutamine of loop D (Gln55) via hydrogen bond. This interaction was also seen in thiacloprid bound AChBP and in the Gln55Arg mutant of AChBP bound to clothiandin [@ihara2014]. It is interesting that in some nAChR subunits, such as *M. pyrsicae* $\beta1$, honeybee $\beta1-2$ and $\alpha7$, glutamine corresponds to basic residue (lysine/arginine). Basic residues electrostatically attract nitro group, possibly forming a hydrogen bond, which in turn would strengthen the stacking and aromatic CH/$\pi$ hydrogen bond interactions between the ring and the protein. In contrast, other subunits such as human $\alpha7$ or *C. elegans* ACR-16 and EAT-2 contain either acidic or polar amino acids in the exact position, repulsing or forming no electrostatic interactions with imidacloprid, which could at least in part explain low sensitivity of nematodes and mammals to neonicotinoids (Section \@ref(soilnematodesneonicstoxicity)).
The differences come to light when one begins to dissect the interactions between imidacloprid ring substituents and the AChBP. Partially positive nitro group (NO2) of imidacloprid bridges to glutamine of loop D (Gln55) via hydrogen bond. This interaction was also seen in thiacloprid bound AChBP and in the Gln55Arg mutant of AChBP bound to clothianidin [@ihara2014]. It is interesting that in some nAChR subunits, such as *M. pyrsicae* $\beta1$, honeybee $\beta1-2$ and $\alpha7$, glutamine corresponds to basic residue (lysine/arginine). Basic residues electrostatically attract nitro group, possibly forming a hydrogen bond, which in turn would strengthen the stacking and aromatic CH/$\pi$ hydrogen bond interactions between the ring and the protein. In contrast, other subunits such as human $\alpha7$ or *C. elegans* ACR-16 and EAT-2 contain either acidic or polar amino acids in the exact position, repulsing or forming no electrostatic interactions with imidacloprid, which could at least in part explain low sensitivity of nematodes and mammals to neonicotinoids (Section \@ref(soilnematodesneonicstoxicity)).
(ref:imi-binding) **Residues forming interactions with nicotine and neonicotinoids in the binding site of AChBP**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with nicotine and imidacloprid.
(ref:imi-binding) **Pharmacophore of nicotine and imidacloprid**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with nicotine and imidacloprid.
```{r imi-binding-label, fig.cap="(ref:imi-binding)", fig.scap= "Residues forming interactions with nicotine and neonicotinoids in the binding site of AChBP", fig.align='center', out.height="70%", echo=FALSE}
knitr::include_graphics("fig/general_intro/png/nicotine_imidacloprid_structure.png")
```
Analysis of the structure of Gln55Arg AChBP mutant complexed with neonicotinoids revealed another residues with a potential to confer high binding affinity of these compounds. Basic residue of loop G, namely Lys34, forms electrostatic interaction with the NO2 group of clothianidin and CN group of thiacloprid, but does not interact with imidacloprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2014].
Analysis of the structure of Gln55Arg AChBP mutant complexed with neonicotinoids revealed another residues with a potential to confer high binding affinity of these compounds. Basic residue of loop G, namely Lys34, forms electrostatic interaction with the NO2 group of clothianidin and CN group of thiacloprid, but does not interact with imidalcoprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2014].
(ref:all-neonics-binding) **Residues forming interactions with neonicotinoids in the binding site of AChBP**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with imidacloprid, thiacloprid, thiacloprid and nitenpyram. For nitenpyram, the interactions are predicted based on other structures.
(ref:all-neonics-binding) **Pharmacophore of neonicotinoids**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with imidacloprid, thiacloprid, thiacloprid and nitenpyram. For nitenpyram, the interactions are predicted based on other structures.
```{r all-neonics-binding-label, fig.cap="(ref:all-neonics-binding)", fig.scap="Residues forming interactions with neonicotinoids in the binding site of AChBP", fig.align='center', echo = FALSE, }
knitr::include_graphics("fig/general_intro/png/binding_all_neonics.png")
```
#### Selectivity of neonicotinoids
#### Neoniotinoid-selectivity
Based on the structural data, it has been proposed that the basic residue in loop D and G interacting with the nitro or cyano group of neonicotinoids is important in confirming neonicotinoid selectivity in insect nAChR subunits. This is supported by the genetic studies. Loop D arginine to threonine mutation naturally occurring in $\beta1$ subunit of peach aphid *Myzus persicae*, and cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017; @bass2011] gives rise to neonicotinoid resistance. Additionally, @shimomura2002 showed that mutation of glutamine in loop D of human $\alpha7$ to basic residue, markedly increases sensitivity of the $\alpha7$ homopentamer to nitro-containing neonicotinoids, whereas mutation of loop D threonine to acidic residues in chicken $\alpha4\beta2$ and hybrid chicken/Drosophila $\alpha2\beta2$ receptor had an opposite effect [@shimomura2006]. Interestingly, described mutations did not influence the efficacy to nicotinoids, suggesting this interaction is specific to neonicotinoids. In addition, double mutant of avian $\alpha7$ nAChR in which equivalent of Gln55 and were mutated to basic residues showes increased binding affinity of thiacloprid and clothianidin, but not nicotine or acetylcholine [@ihara2014], providing further evidence that these residues are important in confering high binding affinity of neonicotinoids.
Based on the structural data, it has been proposed that the basic residue in loop D and G interacting with the nitro or cyano group of neonicotinoids is important in confirming neonicotinoid selectivity in insect nAChR subunits. This is supported by the genetic studies. Loop D arginine to threonine mutation naturally occurring in $\beta1$ subunit of peach aphid *Myzus persicae*, and cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017; @bass2011] gives rise to neonicotinoid resistance. Additionally, @shimomura2002 showed that mutation of glutamine in loop D of human $\alpha7$ to basic residue, markedly increases sensitivity of the $\alpha7$ homopentamer to nitro-containing neonicotinoids, whereas mutation of loop D threonine to acidic residues in chicken $\alpha4\beta2$ and hybrid chicken/Drosophila $\alpha2\beta2$ receptor had an opposite effect [@shimomura2006]. Interestingly, described mutations did not influence the efficacy to nicotinoids, suggesting this interaction is specific to neonicotinoids. In addition, double mutant of avian $\alpha7$ nAChR in which equivalent of Gln55 and Lys34 were mutated to basic residues showed increased binding affinity of thiacloprid and clothianidin, but not nicotine or acetylcholine [@ihara2014], providing further evidence that these residues are important in conferring high binding affinity of neonicotinoids.
Genetic studies identified other amino acids with a potential importance in confering neonicotinoid-selectivity. Imidacloprid-resistant strain of *Nilaparvata lugens* has been found to have Y151S mutation in loop B of $\alpha1$ and $\alpha3$ nAChR subunits [@liu2005]. This residue corresponds to LsAChBP H145 of the loop B.
Genetic studies identified other amino acids with a potential importance in conferring neonicotinoid-selectivity. Imidacloprid-resistant strain of *Nilaparvata lugens* has been found to have Y151S mutation in loop B of $\alpha1$ and $\alpha3$ nAChR subunits [@liu2005]. This residue corresponds to LsAChBP H145 of the loop B.
Loop B, D and G originate from the complementary site, but the principal site may also play a role. Studies on Drosophila/chicken $\alpha2\beta2$ hybrid and chicken $\alpha2\beta4$ receptors showed that the presence of nonpolar proline in YXCC motif of loop C enhances affinity, whereas mutation of proline to glutamate markedly reduces affinity of neonicotinoids to these receptors [@shimomura2005]. The importance of C-loop regions was also demonstrated by @meng2015 who showed that chimera receptors are deferentially sensitive to imidacloprid at least partly due to the difference in loop C region, equivalent to Ls184-191.
### Cholinergic system in insects
#### Enzymes at the cholinergic synapse
Cholinergic neurotransmission is the process of signal propagation between neurons (or neurons and muscle at the neuromuscular junction (NMJ). Cholinergic synapse is characterised by the presence of several proteins which mediate the breakdown, the synthesis and the processing of the neurotransmitter ACh (Figure \@ref(fig:cholineric-synapse-label)).
#### Protein markers of the cholinergic synapse
<!-- Upon arrival of an electrical signal at the presynpatic terminal, acetylcholine is released into the synaptic cleft. It then binds to nicotinic acetylcholine receptors (nAChRs) expressed at the post-synpatic membrane. Binding of acetylcholine results in depolarisation and excitation of the post-synaptic neurons, or muscle contraction at the neuromusclular junction (NMJ) [@hille1978]. Acetylcholine can also act on other class of receptors, the metabotropic cholinergic G-protein coupled receptor, which are involved in the modulatation of neurotransmission release. The acetylcholine-evoked signal is terminated mainly by synaptic enzyme cholinesterase which hydrolyses acetylcholine to choline and acetate [@fukuto1990], but also by choline uptake to the presynaptic cell by Na^+^-choline transporter. -->
nAChRs mediate fast synaptic transmission at the cholinergic synapse. Cholinergic neurotransmission is the process of signal propagation between neurons as well as neurons and muscle cells mediated by a neurotransmitter acetylcholine (ACh) [@williamson2009]. Cholinergic synapse is characterised by the presence of several proteins which mediate the breakdown, the synthesis and processing of the neurotransmitter (Figure \@ref(fig:cholineric-synapse-label)).
##### Choline acetyltransferase
Choline acetyltransferase (ChAT) is an enzyme synthesising ACh [@greenspan1980b], by a transfer of acetyl-choA onto choline. There are at least two isoforms in Drosophila, which are produced by alternative splicing from the ChAT gene [@slemmon1982]. One is membrane bound, whereas the other is soluble, both of which are 75 kDa [@pahud1998]. The soluble isoform performs the mojority of enzymatic activity. A 65 kDa soluble isoform of ChAT was also isolated from the Locust *Schistocerca gregaria* [@lutz1988]
Choline acetyltransferase (ChAT) is an enzyme synthesizing ACh [@greenspan1980b], by a transfer of acetyl-choA onto choline. There are at least two isoforms in Drosophila, which are produced by alternative splicing from the ChAT gene [@slemmon1982]. One is membrane bound, whereas the other is soluble [@pahud1998]. The soluble isoform performs the majority of enzymatic activity [@pahud1998]. A soluble isoform of ChAT was also isolated from the Locust *Schistocerca gregaria* [@lutz1988].
##### Vesicular acetylcholine transferase
Vesicular acetylcholine transferase (VAChT) mediates ATP-dependent transport [@varoqui1996], which packs ACh into the synaptic vesicles for release [@song1997]. In Drosophila, a single VAChT gene was identified. It is embeddded within the ChAT gene [@kitamoto1998].
Vesicular acetylcholine transferase (VAChT) mediates ATP-dependent transport [@varoqui1996], which packs ACh into the synaptic vesicles for release [@song1997]. In Drosophila, a single VAChT gene was identified, which is embedded within the ChAT gene [@kitamoto1998].
##### Acetylcholinesterase
......@@ -329,7 +322,7 @@ Acetylcholinesterase (ACE) is a soluble enzyme that catalyses breakdown of ACh [
<!-- Kinetic properties of nAChRs were studies with the patch clamp technique. Patch clamp is a technique which enables for the resolution of agonist-evoked responses at a single receptor level [@colquhoun1981; @colquhoun1985]. In response to acetylcholine the channel switches between active and inactive form, with the active form interrupted by the short-lived channel closing bursts. Temporal characterisation revealed the average duration of each event. The receptor remains opened for 1.4 ms; this is interrupted by channel closing bursts of 20 $\mu$s which occur at a frequency of 1.9 closures/opening burst. The mean period between the successive channel openings is 342 ms. Further experiments provided the showed that channel opening is not an all or nothing event. Instead, a channel exhibits multiple conductance states, one on which it is fully opened, named a full conductance state (i.e. the active form), and one in which the channel is partially opened, named the sub-conductance state [@colquhoun1985]. The fine structure of full conductance states (or opening bursts) and sub-conductance states varies depending on the agonist used and a receptor protein [@colquhoun1985; @nagata1996; @nagata1998]. -->
(ref:cholineric-synapse) **Enzymes and transporters at the cholinergic synapse.** Upon release into the synaptic cleft, acetylcholine is broken down to choline and acetate by acetylcholinesterase (AChE). Choline is taken up to the pre-synapse by a choline transporter (ChT). The acetyl group in transferred onto choline to product acetylcholine; a reaction catalysed by choline transferase (ChAT). Generated acetylcholine is pumped back into the synaptic vesicle by the vesicular acetylcholine transporter (AChT) for re-cycling.
(ref:cholineric-synapse) **Enzymes and transporters at the cholinergic synapse.** Upon release into the synaptic cleft, acetylcholine is broken down to choline and acetate by acetylcholinesterase (AChE). Choline is taken up to the pre-synapse by a choline transporter (ChT). The acetyl group in transferred onto choline to produce acetylcholine. This reaction is catalysed by choline transferase (ChAT). Generated acetylcholine is pumped into the synaptic vesicle by the vesicular acetylcholine transporter (VAChT).
```{r cholineric-synapse-label, fig.cap="(ref:cholineric-synapse)", echo=FALSE, fig.scap= 'Chemical transmission at the cholinergic synapse.', fig.align='center', out.height = '60%', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/synapse_with_enzymes.png")
......@@ -348,72 +341,48 @@ knitr::include_graphics("fig/general_intro/png/synapse_with_enzymes.png")
<!-- Exposure of insects to lethal dose of nicotine results in symptoms characteristic for the nervous system intoxication [@chadwick1947] and include increased locomotory activity, followed by convulsions, twitching and eventual death [@mcindoo1943]. -->
#### Localisation of the cholinergic neurons in insects ####{#localisationininsects}
#### Localisation of cholinergic neurons in insects
Enzymes present at the cholinergic synapse have been used as markers for detection of cholinerguic neurons in insects. (1) Immunocytochemistry with monoclonal antibodies specific to ChAt and ACE, (2) in-situ hybridization using using sequences complementary to the ChAT mRNA (3) colorimetric technique for detection of AChE activity [@karnovsky1964] (4) and reporter gene fused to the ChaT gene regulatory elements outlined the presence of cholinergic pathways in Drosophila [@buchner1986; @gorczyca1987; @barber1989; @yasuyama1999], honeybee [@kreissl1989] and locust *Locusta migratoria* [@lutz1987; @geffard1985]. Based on these data, cholinergic neurons are in almost all regions of the brain, in the peripheral nervous system, viz. visual system and the antenna. They are also present in the thoracic, abdominal and terminal abdominal ganglia involved in the regulation of movement of wings, abdomen and legs, as well as the regulation of the anal and reproductive muscles [@smarandache-wellmann2016].
Enzymes and transporters present at the cholinergic synapse have been used as markers for detection of cholinergic neurons in insects. (1) Immunocytochemistry with monoclonal antibodies specific to ChAt and ACE, (2) in-situ hybridization using using sequences complementary to the ChAT mRNA (3) colorimetric technique for detection of AChE activity [@karnovsky1964] (4) and reporter gene fused to the ChaT gene regulatory elements, outlined the presence of cholinergic pathways in Drosophila [@buchner1986; @gorczyca1987; @barber1989; @yasuyama1999], honeybee [@kreissl1989] and locust *Locusta migratoria* [@lutz1987; @geffard1985]. Based on these data, cholinergic neurons are in almost all regions of the brain and in the peripheral nervous system, namely the visual system and the antenna. They are also present in the thoracic, abdominal and the terminal abdominal ganglia involved in the regulation of movement of wings, abdomen and legs, as well as the regulation of the anal and reproductive muscles in insects [@smarandache-wellmann2016].
<!-- . In particular, the muchroom bodies associated with learning, formation of memory and the sensory processing [@heisenberg1998], dorsal lobe where mechanosensory and gustatory neurons project into from the anteanna -->
<!-- In peripheral nervous tissue, cholinergic neurons are the -->
Cholinergic neurons have been also mapped by using radiolabelled ligand, specific for nAChRs. $\alpha$-bungarotoxin ($\alpha$-bgtx), is a 74-amino acid long, 8 kDa proteins isolated from the venom of a snake *Bungarus multicinctus*. It binds with high affinity to nAChR [@lee1967] and blocks synaptic responses evoked by acetylcholine and other agonists [@chang1963] by blocking the access of an agoinist to the nAChR binging site [@mishina1984]. $\alpha$-bgtx staining mapped to brain regions identified by other methods. In the honeybee, it was found in the optic lobes, antennal lobes, ocellar system and muchroom bodies [@scheidler1990]. This correlated with the $\alpha$-bgtx staining distribution in the central nervous system of Drosophila [@schmidt-nielsen1977], moth *Manduca sexta* [@hildebrand1979] and cocroach [@orr1990]. Incubation of $\alpha$-bgtx with the ganglia of the american cocroach [@sattelle1983] and cricket *Acheta domesticus* [@meyer1985] identified further regions with high affinity to this protein. Staining was evident in the abdominal ganglion in the region rich in interneurons which make synaptic connections with the sensory afferent neurons [@daley1988] in the abdominal ganglia of the cocroach and in the thoracic ganglia [@sattelle1981]. Presence of nAChRs at the insect ganglia was confirmed using electrophysiological approaches [@sattelle1981; @bai1992]
Cholinergic neurons have been also mapped using radiolabelled ligand, specific for nAChRs. $\alpha$-bungarotoxin ($\alpha$-bgtx), is a 74-amino acid long, 8 kDa proteins isolated from the venom of a snake *Bungarus multicinctus*. It binds with high affinity to nAChR [@lee1967] and blocks synaptic responses evoked by acetylcholine and other nAChR agonists [@chang1963]. Incubation of the honeybee brain with $\alpha$-bgtx led to a staining in the optic lobes, antenna lobes, ocellar system and mushroom bodies [@scheidler1990]. This correlated with the staining in the central nervous system of Drosophila [@schmidt-nielsen1977], moth *Manduca sexta* [@hildebrand1979] and cocroach [@orr1990]. Incubation of $\alpha$-bgtx with the ganglia of the american cocroach [@sattelle1983] and cricket *Acheta domesticus* [@meyer1985] identified further regions where $\alpha$-bgtx binds with high affinity: the abdominal ganglion in the region rich in interneurons which make synaptic connections with the sensory afferent neurons [@daley1988], the abdominal ganglia and the thoracic ganglia [@sattelle1981]. Presence of nAChRs at the insect ganglia was confirmed using electrophysiological approaches [@sattelle1981; @bai1992].
### Role of nAChRs in insects
Based on the distribution of cholinergic-synapse markers and the quantitative analysis of acetylcholine in the brain [@florey1963], it was concluded that acetylcholine is a major neurotransmitter in the nervous system of insects. In contrast to vertebrates and *C. elegans*, acetylcholine in insects does not mediate signal transduction at the NMJ, insteed it is mainly involved in the sensory pathways and central information processing. The action of acetylcholine is mediated by nAChRs.
Based on the distribution of cholinergic-synapse markers in the insect nervous system and the quantitative analysis of acetylcholine in the insect brain [@florey1963], it was concluded that acetylcholine is a major neurotransmitter in the nervous system of insects. In contrast to vertebrates [@brown1936; @bacq1937; @chang1963] and *C. elegans* [@richmond1999], acetylcholine in insects does not mediate muscle contraction at the NMJ, instead it is mainly involved in the sensory pathways and central information processing.
### Role of nAChRs in insects
<!-- Lerning: [@kerkut1970] acetylcholinesterase inhibitor facilitated the ability of cocroach to learn to raise its leg out of the solution in response to electrical stimuli. Drugs: neostigmine and physostigmine which inhibit acetylcholinesterase [@carlyle1963]. -->
The biological role of nAChRs in insects was investigated in response to nAChR agonists. Lethal doses of neonicotinoid imidacloprid induces complex symptoms in American cocroach and in honeybee [@sone1994; @elbart1997; @suchail2001]. The following order of events was noted: hyperexcitation as evident by excessive pacing, collapse and diminishing uncoordinated leg and abdomen movement followed by paralysis and eventual death. Lethal dose of insecticide nicotine [@david1953], a naturally occurring alkaloid found in the *Solanaceae* family of plants, including tobacco [@steppuhn2004] induce similar effects on bees [@mcindoo1943]. Distinct behavioural alterations can be induced by nAChR agonists at sub-lethal doses.
Imidacloprid at < 4 nM inhibits feeding of *Myzus persicae*, which leads to their starvation [@nauen1995; @elbart1997]. In non-target species, such as honeybees and bumblebees neonicotinoids impair on learning and memory, as well as reproduction (Section \@ref(sublethalbees)).
### Electrohysiological properties of insect nAChRs
Role of nAChRs in insect cholinergic neurotransmission electrophysiological recordings : electrophysiological recordings from the insect ganglia where sensory neuron makes synpatic connections to an interneuor. Robust preparation, easy to dissect and relatively large.
extracellular recordings from the cricket terminal abdominal ganglion recording of the interneuron activity nicotine - cholienrgic and evidence of nAChr expression from the biochem studies. In response to Iontophoretic nicotine, increase in the the rate of neuronal firing, blocked by bgtx [@meyer1985] evidence that nachr agonist lead to excitation.
In cocroach, cell bodies of the dorsal unpaired median (DUM) neurons in the thoracic ganglion depolarised in the presence of nicotine and was blocked by selective antagonist mecamylamine [@bai1992].
In the abdominal ganglia of the cocroach [@sattelle1981].
Inward, depolarising current in isolated
Intracellular recordings have shown that these compounds depolarise and excite the post synaptic neuron of the terminal abdominal ganglia [@kerkut1969]. However, high concentrations 1 mM - 10 mM were needed, potentially due to the high concentration of acetylcholinesterase which rapidly breaks down ACh.
In cultured cells from honeybee antenal lobe whole patch clamp technique: nicotine depolarising inward current inhibited by bgtx [@barbara2005] cultured cells of mushroom bodies of the honey bee [@goldberg1999; @palmer2013] also inhibited by bgtx. Also cultured CNS neurons of Drosophila [@brown2006].
DESENSITISATION
Biological role of nAChRs in insects was investigated in behavioural assays in response to nAChR agonists. Lethal doses of neonicotinoid imidacloprid induced complex symptoms in American cocroach and in honeybee [@sone1994; @elbart1997; @suchail2001]. The following order of events was noted: hyperexcitation as evident by excessive pacing, collapse and diminishing uncoordinated leg and abdomen movement followed by paralysis and eventual death. Lethal dose of insecticide nicotine [@david1953], a naturally occurring alkaloid found in the *Solanaceae* family of plants, including tobacco [@steppuhn2004], induced similar effects on bees [@mcindoo1943]. Distinct behavioural alterations can be induced by sub-lethal doses. Imidacloprid at < 4 nM inhibits feeding of *Myzus persicae*, which leads to their starvation [@nauen1995; @elbart1997]. In honeybees and bumblebees neonicotinoids impair on learning and memory, as well as reproduction (Section \@ref(sublethalbees)).
Exposure to high concentrations of agonist had a secondary effects : in the presence of agonist, the depolarising current slowly decreases until it is abolished due to desensitisation [@goldberg1999]. The time constant for desensitisation varied beteween compounds 390 and 420 ms for nicotine [@goldberg1999] up to 23 s in the cocroach neurons [@salgado2004]
### Electrohysiological properties of insect nAChRs ###{#eletrophysinsectnachr}
Desensitisation is a period after agonist removal, whereby subsequent depolarisation cannot be elicited by agonist [@goldberg1999]. Recovery is reverseble from desenstisiation is dependes on the compounds -, neuronal preparation and concentration. In cultured cells of the honey bee lasts up to 3 minutes after application of Ach/nicotine [@goldberg1999]. in the isolated thoracic neurons up to 30 s [@salgado2004]. Althout recovery is typically reversable, this does not always happen Full recovery may not occur or may be slower if the receptor are exposed to the large doses of agonist for a prolonged time [@katz1957].
The kinetic properties of insect nAChRs were investigated using neuronal preparations, where high density of nAChRs was found (Section \@ref(localisationininsects)). Acetylcholine and nicotine increased the rate of neuronal firing [@callec1973; @sattelle1976; @meyer1985; @kerkut1969; @sattelle1981; @bai1992]] by depolarising post-synaptic neurons [@callec1973; @sattelle1976; @goldberg1999; @barbara2005; @brown2006; @palmer2013]. These effects were inhibited by nAChR antagonist $\alpha$-bgtx, suggesting effects of nicotine and acetylcholine were induced directly acting on nAChRs and that nAChRs are excitatory. Indeed, analysis of the agonist-evoked nAChR currents in the cultured honey bee neurons showed flux of mainly sodium and potassium but also calcium [@goldberg1999].
isolated thoracic ganglia of the americal cocroach - desensitising in under a second in the presence of ACh and nicotine
<!-- cocroach terminal abdominal ganglion extracellular post synaptic potentials in response to acetylcholine. In the presence of acetylcholinenesterase inhibitor acetylcholine at much lower doses 1 uM - 1 mM elicited Rapid and concentration dependent depolarisation excitation of the post-synapse and the gradual decline of the EPSP leading to their block []. -->
CONDUCTANCE
cultured muschroom bodies of the honey bee. Cationic conductance, mainly sodium and potassium but also calcium [@goldberg1999].
<!-- were recorded intracellularlu t -->
cocroach terminal abdominal ganglion extracellular post synaptic potentials in response to acetylcholine. In the presence of acetylcholinenesterase inhibitor acetylcholine at much lower doses 1 uM - 1 mM elicited Rapid and concentration dependent depolarisation excitation of the post-synapse and the gradual decline of the EPSP leading to their block [@callec1973; @sattelle1976].
<!-- recording of the interneuron activity nicotine - cholienrgic and evidence of nAChr expression from the biochem studies. In response to blocked by bgtx [@meyer1985] -->
SINGLE CHANNEL RECORDING
<!-- and was blocked by selective antagonist mecamylamine . -->
Complex channel kinetics resembling those found in veretbrates [@colquhoun1985; @nagata1996; @nagata1998].
#### Single channel kinetics
Single channel recordings showed that insect nAChRs exhibit complex kinetics, resembling those found in vertebrates [@colquhoun1985; @nagata1996; @nagata1998]. Using cholinergic neurons of the larva Drosophila CNS [@albert1993; @brown2006], and cultured neurons of *Musca domestica* [@albert1993] it was shown that in response to nAChR agonists acetylcholine, nicotine, imidacloprid and clothianidin, the channel switches between active and inactive form, with the active form interrupted by the short-lived channel closing bursts. Temporal characterisation of these events reveled that the frequency of channel opening and the duration of opening differs depending on the agonist applied and the neuronal preparation. However, typically receptor remains opened for ~ 1.5 ms; this is interrupted by channel closing bursts of ~ 20 $\mu$s which occur at a frequency of 1-2 closures/opening burst [@albert1993].
from cholinergic neurons of the larva Drosphila CNS [@albert1993; @brown2006], Musca domestica cultured CNS neurons [@albert1993]
Channel opening is not an all or nothing event. Instead, a channel typically exhibits two conductance states, one on which it is fully opened, named a full conductance state (i.e. the active form), and one in which the channel is partially opened, named the sub-conductance state. Although the conductance rates from various insect preparations are similar, the ratio between the two as well as their fine structure varies depending on the concentration, the agonist used and and the neuronal preparation [@albert1993; @brown2006].
#### Desensitisation of insect nAChRs
Single channel recordings
In response to acetylcholine the channel switches between active and inactive form, with the active form interrupted by the short-lived channel closing bursts. Temporal characterisation of these events revelaved that the frequency of channel opening and the duration of opening differs depending on the agonist applied and the neuronal preparation. However, typically receptor remains opened for ~ 1.5 ms; this is interrupted by channel closing bursts of ~ 20 $\mu$s which occur at a frequency of 1-2 closures/opening burst [@albert1993].
Channel opening is not an all or nothing event. Instead, a channel typically exhibits two conductance states, one on which it is fully opened, named a full conductance state (i.e. the active form), and one in which the channel is partially opened, named the sub-conductance state. Although the conductance rate between channels from various preparations is similar, the ratio between the two as well as their fine structure varies depending on the concentration, the agonist used and and neuronal preparation.
Exposure of insect neuronal preparations to high concentrations of agonists has a secondary effect. Following rapid depolarisation, the current slowly decreased until it it abolished completely due to nAChR desensitisation [@goldberg1999]. Desensitisation is a period after agonist removal, whereby subsequent depolarisation cannot be elicited by agonist [@goldberg1999]. The time taken for desensitisation varies between hundreds of ms [@goldberg1999] to tens of seconds [@salgado2004] in insects. In vertebrates, there are receptors which desensitise in $\mu$ seconds [@bouzat2008]. Although the process of receptor desensitisation is typically reversible [@goldberg1999; @salgado2004], full recovery may not occur or may be slower if the receptors are exposed to the large doses of agonist for a prolonged time [@katz1957].
<!-- Immunocytochemistry using monoclonal antibodies specifie -->
<!-- In the brain, cholinergic neurons can be found in almost all parts of the brain and the optical lobe. In particular, mushroom bodies, -->
<!-- thoracic ganglia : afferent sensory neurons -->
<!-- thoracic ganglia : afferent sensory nurons -->
<!-- In the peripheral primary sensory nerouns of the compound eye and the anntena. -->
......@@ -494,40 +463,23 @@ Channel opening is not an all or nothing event. Instead, a channel typically exh
<!-- Evidence from the application of nAChR: -->
<!-- nicotine: -->
### Kinetic properties of nAChRs
Nicotinic acetylcholine receptors have three basic conformation states: the closed, the open and the disensitised state [@katz1957; @monod1965]. The question is: how does agonist binding lead to these conformational changes? Diffuculties in crystallising muscle nAChR restricted studies of receptor structure in multiple states. Whereas AChBP lack transmembrane domains therefore is not suitable for such studies.
Evidence comes from a crystal structure of structuraly related, bacterial pentameric ligand gated ion channels. These channels are not members of the cys-loop family because they lack N-termial disulphide bond. They also do not contain a large cytoplasmic loop between M3-M4 TM helices. They do however share common topology of 5 subunits, each comprising of 4 TM helices. The comparison of the crystal structure of *Erwinia* LGIC (ELGIC) and *Gloebacter* LGIC (GLGIC). They are both cation selective. GLIC is gated by protons, whereas ELIC by amines [@]
ELIC with no agonist bound - hence closed confirmation [@]
Aromatic residues in C loop form a cap above the bound agonist and by doing so they decrease the on/off rates of receptor binding [@hilf2008] this was compared to the crystal structure of the agonist-bound GLIC [@hilf2009].
Ligand binding leads to movement of the C-loop amino acids which fold over the agonist binding site, burrying it inside the protein and reducing the dissociation on/off rates of the bound agonist.
Also loop A moves towards the loop B. In complementary subunit loop F moves in, towards the agonist. This propagates further structural changes. The beta sheets rearrange. Inner beta sheet remains in the exact position, but the inner one rotates towards the centre of the pentamer.
These structural changes propagate to the level of the channel, leading to its opening.
### Structural basis of major conformation states of nAChRs
2 possible ways in which channel opens:
Nicotinic acetylcholine receptors have three basic conformation states: the closed, the open and the disensitised state [@katz1957; @monod1965]. Structural features of the closed state channel are described in Section \@ref(structure) and \@ref(modelodnachbinding)). Briefly, nAChR is a pentameric assembly of receptor subunits. Each subunits contains 4 transmembrane helices [@noda1982; @noda1983] (M1-M4), an N-terminal helix and 10 $\beta$sheets [@brejc2001; @dellisanti2007; @li2011] and a large C-terminal domain [@unwin1995; @dellisanti2007; @li2011]. The N-terminal domain contains an agonist binding site formed by the loop contributions from the adjecent subunits [@brejc2001]. One of the key features of the closed-channel is the presence of leucine residues originating from the pore-lining M2 helix, which project inwards [@unwin1995]. These residues form a gate which occludes the passage of ions of closed nAChR. High resolution structures of AChBP [@bourne2005; @hansen2005] and human $\alpha7$-AChBP chimera [@li2011] highlighted the structural differences between the open (agonist-bound) and the closed states. In the agonist-bound structures, the aromatic residues in C loop form a cap above the agonist, suggesting that ligand binding leads to movement of the C-loop which folds over the agonist binding site, burying the ligand inside the protein and reducing the dissociation on/off rates. In addition, loop A moves towards the loop B, whereas loop F moves towards the agonist. These local changes propagate the rearrangement of the outer $\beta$ sheet which rotates towards the centre of the pentamer and lead to structural changes at the level of the channel, leading to its opening.
Hirozontal movement of pore lining helices.
Based on the Cryo EM of the mammalian muscle nAChR in closed and open state, a hypothesis of the dynamics has been derived [@unwin1995], binding of agonist leads to rotation of 5 M2 helices. Proposed that as they move, the distance between them increases, and so the ion conductivity pathway becomes wide for the ion passage. Additionaly, this results in movement of hydrophobic residues which proclude the channel entry in the closed state of the receptor. More recently, it has been proposed that the M2 helices do not move in the unified way. Some rotate, whereas others tilt or bend [@unwin2012].
Crystal structures of bacterial pentameric ligand gated ion channels shed light on the possible mechanism of channel opening. Although these channels are not members of the Cys-loop family due to the absence of N-terminal disulphide bond and a large cytoplasmic loop between M3-M4 TM helices, they share common topology with nAChRs. Comparison of closed *Erwinia chrysanthemi* ligand gated ion channels (ELIC) [@hilf2008] to opened *Gloeobacter violaceus* ligand gated ion channels (GLIC) [@hilf2009], showed that in the open state pore-lining helices are tilted inwards, which leads to opening of the gate. An alternative hypothesis of channel opening was derived based on the cryo EM of the mammalian muscle nAChR in closed and open state [@unwin1995]. These structures suggest that binding of the agonist leads to rotation of 5 M2 helices. As they move, the distance between them increases, and so the ion conductivity pathway becomes wider, the gate opens, thus ions flow. More recently a higher resolution structure of muscle type nAChR has been derived [@unwin2012], suggesting that in the open state, TM helices not only rotate, but also bend towards the centre of the pore. Twisting and tilting of inner helices were also observed in the crystal structures of other representative of Cys-loop receptors, namely glycine receptors [@du2015] and glutamine-gated chloride (GluCl) channel [@althoff2014])
@hilf2009 - ELIC in closed state and compared to the open state - bending of felices.
More reccently, structures of representatives of Cys-loop receptors, glutamate gated chloride channel [@althoff2014] and glycine receptors [@du2015].
DESENSITISATION state is a state in which agonist affinity in higher in comparison to the resting or activated state. but ion conductance probability if lower in comparison to the resting state [@monod1965]. State in which agonist binds but there is no ion conductance [@monod1965]. Crystal structure of the human $\alpha4$/$\beta2$ receptor in desensitised state [@morales-perez2016] comparison to the structures of glycine receptors [@du2015] and GluCl channel [@althoff2014], gabaA [@miller2014] in the open state revealed difference at the interface of ECD-TM and extracellular domain loop C rotation regions of the protein and the extracellular domain which leads to occlusion of the ion channel and stabilising of the receptor in desensitising state, thereby contributing to the high affinity of the agonist to the desensitised receptor.
In 2016, crystal structure of the human $\alpha4$/$\beta2$ receptor in desensitized state [@morales-perez2016] was derived. This was compared to the structures of open glycine [@du2015], closed GluCl [@althoff2014] and desensitized GABA [@miller2014]. Differences at the interface of the extracellular (ECD) and transmembrane (TM) regions were noted, which arise as a result of the rotation motion at the level of the receptor. The structural rearrangements lead to the occlusion of the ion channel, reducing conduction [@monod1965] and tightening of the ligand binding site leading to an increase in ligand affinity to the desensitised receptor [@monod1965].
### Neonicotinoids target nAChRs ### {#neonicstarget}
#### Mutations in nAChRs give rise to neonicotinoid-resistance ####{#resgenevidence}
Resistance to neonicotinoids arises from mutations in nAChR subunits. Field isolates of peach aphid *Myzus persicae* [@bass2011], the cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017] and the Colorado potato beetle *Leptinotarsa decemlineata* [@szendrei2012], as well as lab-isolates of brown planthopper, *Nilaparvata lugens* [@liu2005], fruit fly *Drosophila melanogaster* [@perry2008] with decreased sensitivity to neonicotinoids have been identified. Behavioral analysis shows that their sensitivity is up to 1500-fold lower in comparison to the reference strains, as shown by the shift in LD50. Analysis of the coding genome of the resistant strains identified mutations in nAChR subunit coding sequence [@bass2011; @perry2008; @hirata2015].
Severalk lines of evidence suggest that nAChR are the principal site of action of neonicotinoids. Genetic analysis of the neonicotinoids-resistant strains of insects showed that resistance arises as a consequence of mutations in nAChR subunits. Field isolates of peach aphid *Myzus persicae* [@bass2011], the cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017] and the Colorado potato beetle *Leptinotarsa decemlineata* [@szendrei2012], as well as lab-isolates of brown planthopper, *Nilaparvata lugens* [@liu2005], fruit fly *Drosophila melanogaster* [@perry2008] with decreased sensitivity to neonicotinoids have been identified. Behavioral analysis shows that their sensitivity is up to 1500-fold lower in comparison to the reference strains, as shown by the shift in the LD50. Analysis of the DNA of the resistant strains identified mutations in nAChR subunit coding sequence [@bass2011; @perry2008; @hirata2015].
#### Neonicotinoids evoke nAChR-like current in insect neuronal preparations ####{#electrophysevidence}
The effects of neonicotinoids on the neuronal transmission was investigated on insect neuronal preparations which express high levels of nAChRs.
@sone1994 investigated the effects of imidacloprid on the neuronal activity at the thoracic ganglia of male adult American cockroaches, *Periplaneta americana* using extracurricular recordings. This method allows for a record of changes in spontaneous neuronal activity in response to mechanical or pharmacological interventions. At a very low concentration of 1 nM, imidacloprid induced a sustained for over 2 minutes increase in the rate of neuronal firing. At concentrations ranging from 10 nM to 100 $\mu$M, the following sequence of events was noted: an increase of the rate of spontaneous action potentials of neurons followed by a gradual decline, leading to a complete block of neuronal activity [@sone1994]. Imidacloprid had the same effect on various insect preparations including thoracic ganglion of the Leptinotarsa decemlineata [@tan2008] and on the abdominal ganglion of *Periplaneta americana* [@buckingham1997]. The same observations were made for other neonicotinoids [@thany2009; @schroeder1984]. This provided evidence that neonicotinoids stimulate the nervous system of insects.
Neonicotinoids induce nAChR-like current in insect neuronal preparations, whicn reasssembles that induced by nAChR agonist nicotine (Section \@ref(eletrophysinsectnachr)). @sone1994 investigated the effects of imidacloprid on the neuronal activity at the thoracic ganglia of male adult American cockroaches, *Periplaneta americana* using extracurricular recordings. This method allows for a record of changes in spontaneous neuronal activity in response to mechanical or pharmacological interventions. At a very low concentration of 1 nM, imidacloprid induced a sustained for over 2 minutes increase in the rate of neuronal firing. At concentrations ranging from 10 nM to 100 $\mu$M, the following sequence of events was noted: an increase of the rate of spontaneous action potentials of neurons followed by a gradual decline, leading to a complete block of neuronal activity [@sone1994]. Imidacloprid had the same effect on various insect preparations including thoracic ganglion of the Leptinotarsa decemlineata [@tan2008] and on the abdominal ganglion of *Periplaneta americana* [@buckingham1997]. The same observations were made for other neonicotinoids [@thany2009; @schroeder1984].
<!-- This phenomenon is due to the distinct conformation of nAChRs, at in which they are not capable of ion conduction [@nemecz2016]. -->
......@@ -539,20 +491,17 @@ Pharmacological characterisation of neonicotinoids-induced currents provided fur
### Mode of action of neonicotinoids ###{#moaneonicsinsects}
Neonicotinoids can have diverse mode of action. The currents produced by neonicotinoids and ACh on cultured or isolated insect neuronal preparation were compared. Neonicotinoids evoking current lower than that evoked by ACh were classed as partial agonists, those eliciting similar response were classed as true agonists, whereas those more efficacious than ACh, super-agonists. Thiacloprid and imidacloprid are partial agonists, nitenpyram, clothianidin, acetamiprid and dinotefuran are true agonists, whereas thiamethoxam has no effect on the isolated American cockroach thoracic ganglion neurons [@tan2007]. This differs from the mode of action of neonicotinoids on cultured terminal abdominal ganglion neurons of this insect. Currents produced by all neonicotinoids tested was lower than that evoked by ACh [@ihara2006], suggesting they are all partial agonists on these cells. The mode of action of neonicotinoids on the fruit fly [@brown2006] and honey bee neurons [@palmer2013] differs still, implying the presence of distinct nAChRs in different insect species and neuronal preparations.
Although neonicotinoids typically acts as agonists, they can have diverse mode of action. The currents produced by neonicotinoids and ACh on cultured or isolated insect neuronal preparation were compared. Neonicotinoids evoking current lower than that evoked by ACh were classed as partial agonists, those eliciting similar response were classed as true agonists, whereas those more efficacious than ACh, super-agonists. Thiacloprid and imidacloprid are partial agonists, nitenpyram, clothianidin, acetamiprid and dinotefuran are true agonists, whereas thiamethoxam has no effect on the isolated American cockroach thoracic ganglion neurons [@tan2007]. This differs from the mode of action of neonicotinoids on cultured terminal abdominal ganglion neurons of this insect. Currents produced by all neonicotinoids tested was lower than that evoked by ACh [@ihara2006], suggesting they are all partial agonists on these cells. The mode of action of neonicotinoids on the fruit fly [@brown2006] and honey bee neurons [@palmer2013] differs still, implying the presence of distinct nAChRs in different insect species and neuronal preparations.
#### Neonicotinoids bind with high affinity to insect nAChRs ####{#ligbinding}
<!-- @tomizawa1996 developed neonicotinoid agarose affinity column to isolate proteins with high binding affinity to neonicotinoids. Using Drosophila and Musca head membrane preparations, he identified three nAChR subunits as potential neonicotinoid-targets. -->
The binding affinity of imidacloprid to nAChRs expressed in insect membrane homogenates was assessed in the saturation ligand binding studies.
<!-- In the saturation binding experiment, various concentration of the labelled ligand is added to the preparation and the concentration of the ligand at the equilibrium is determined. This is then used to derive the binding constant (as a measure of dissociation constant, Kd). Here, it was used to define the binding strength of neonicoinoids to insect nAChRs (Table \@ref(tab:bindignrecombinant)). -->
Imidacloprid and thiamethoxam bind with high affinity to proteins in the whole membrane preparations of the domestic fly and aphids with the Kd in the low nM range [@liu1993; @wellmann2004; @liu2005]. Interestingly, two binding affinities have been derived from the imidacloprid study in the brown planthopper and pea aphid [@wellmann2004; @taillebois2014] suggesting there are two binding sites in these animals.
<!-- In the saturation binding experiment, various concentration of the labelled ligand is added to the preparation and the concentration of the ligand at the equilibrium is determined. This is then used to derive the binding constant (as a measure of dissociation constant, Kd). Here, it was used to define the binding strength of neonicoinoids to insect nAChRs (Table \@ref(tab:bindignrecombinant)). -->
The binding affinity of neonicotinoids-related compounds was compared to the insecticidal activity; the correlative relationship between the two was found [@kagabu2002; @liu2005], providing further evidence that neonicotinoids act by targeting nAChRs.
Neonicotinoids bind to insect nAChRs with high affinity, as shown in the saturation ligand binding studies. In the whole membrane preparations of the domestic fly and aphid, the Kd of imidacloprid and thiamethoxam were in the low nM range [@liu1993; @wellmann2004; @liu2005]. Interestingly, two binding affinities have been derived from the imidacloprid study in the brown planthopper and pea aphid [@wellmann2004; @taillebois2014] suggesting the presence of at least two imidacloprid binding sites in these animals.
```{r potencyintact, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
......@@ -575,17 +524,19 @@ library(kableExtra)
threeparttable = T)
```
In addition to the saturation studies, the competitive ligand binding studies were carried out.
<!-- In the the competitive ligand binding studies, biological preparation is incubated with radiolabelled ligand. The ability of various concentrations of unlabeled ligand is measured to define its equilibrium inhibition constant (Ki). This method informs both on the affinity and on the interactions between ligands. -->
Various concentrations of neonicotinoid prototype isothiaocynate were incubated with the homogenate of fruit fly *Drosophila melanogaster* and a homogenate of the abdominal nerve cords of *Periplaneta americana* before the exposure to radiolabelled nAChR antagonist $\alpha$-bgtx [@gepner1978]. Isothiaocynate inhibited binding of $\alpha$-bgtx in the concentration dependent manner [@gepner1978], suggesting the two compounds share the binding site. Similarly, imidacloprid has been shown to displace $\alpha$-bgtx from brain membrane preparations from honey bee *Apis mellifera* [@tomizawa1992; @tomizawa1993], *Drosophila melanogaster* [@zhang2004], house fly *Musca domestica* and isolated cockroach nerve cords [@bai1991].
In addition to the saturation studies, the competitive ligand binding studies were carried out. Various concentrations of neonicotinoid prototype isothiaocynate were incubated with the homogenate of fruit fly *Drosophila melanogaster* and a homogenate of the abdominal nerve cords of *Periplaneta americana* before the exposure to radiolabelled nAChR antagonist $\alpha$-bgtx [@gepner1978]. Isothiaocynate inhibited binding of $\alpha$-bgtx in the concentration dependent manner [@gepner1978], suggesting the two compounds share the binding site. Similarly, imidacloprid has been shown to displace $\alpha$-bgtx from brain membrane preparations from honey bee *Apis mellifera* [@tomizawa1992; @tomizawa1993], *Drosophila melanogaster* [@zhang2004], house fly *Musca domestica* and isolated cockroach nerve cords [@bai1991].
The binding affinity of neonicotinoid-related compounds was compared to the insecticidal activity; the correlative relationship between the two was found [@kagabu2002; @liu2005], providing further evidence that neonicotinoids act by targeting nAChRs.
#### High affinity of neonicotinoids to heterologously expressed insect-chimera receptors ####{#chimerareceptors}
Due to the difficulties in the expression of native insect receptors (Section \@ref(expressionfail)), the binding affinity of neonicotinoids was determined in hybrid receptors, consisting of insect $\alpha$-subunit and vertebrate $\beta$ subunit. $\beta2$ from rat and chicken has been shown to enable recombinant expression of several insect $\alpha$ subunits in cell lines.
Due to the difficulties in the heterologous expression of native insect receptors (Section \@ref(expressionfail)), the binding affinity of neonicotinoids to isolated, native receptors is largely unknown. However, binging studies on hybrid receptors consisting of insect $\alpha$-subunit and vertebrate $\beta$ subunit, were carried out.
<!-- determined. $\beta2$ from rat and chicken has been shown to enable recombinant expression of several insect $\alpha$ subunits in cell lines. -->
Mammalian $\alpha4$/$\beta2$ receptor expresses well in Xenopus oocytes [@cooper1991] and cell lines [@lansdell2000] has low affinity to imidacloprid (Kd >1000 $\mu$M) [@lansdell2000]. Chimera of rat $\beta2$ and $\alpha$ subunits from the fruit fly *Drosophila melanogaster* [@lansdell2000], aphid *Myzus Persicae* [@huang1999], planthopper *Nilaparvata lugens* [@liu2009], cat flea *Ctenocephalides felis* [@bass2006] and sheep blowfly *Lucilia cuprina* [@dederer2011] have been generated. It needs to be noted that the potency of neonicotinoids on these receptors is unknown due to the lack of reported data, suggesting these receptors are not functional. However, their pharmacological profiles have been determined using saturation ligand binding studies [@hulme2010] (Table \@ref(tab:bindignrecombinant)).
Mammalian $\alpha4$/$\beta2$ receptor expresses well in Xenopus oocytes [@cooper1991] and cell lines [@lansdell2000] and it has low affinity to imidacloprid (Kd >1000 $\mu$M) [@lansdell2000]. Chimera of rat $\beta2$ and $\alpha$ subunits from the fruit fly *Drosophila melanogaster* [@lansdell2000], aphid *Myzus Persicae* [@huang1999], planthopper *Nilaparvata lugens* [@liu2009], cat flea *Ctenocephalides felis* [@bass2006] and sheep blowfly *Lucilia cuprina* [@dederer2011] have been generated. It needs to be noted that the potency of neonicotinoids on these receptors is not reported, suggesting these receptors are not functional. However, their pharmacological profiles have been determined using saturation ligand binding studies [@hulme2010] (Table \@ref(tab:bindignrecombinant)).
The affinity of neonicotinoids to insect-chimera rectors varies, depending on the identity of the $\alpha$ subunit. Imidacloprid did not bind to Mp$\alpha1$/rat$\beta2$ receptor, whereas its Ki at Mp$\alpha2$ and Mp$\alpha3$-containing receptor was 3 and 2.8 nM, respectively [@huang1999]. Four to five fold-difference between the most and least susceptible *Drosophila melanogaster* and *Ctenocephalides felis* receptor assemblies were also identified [@lansdell2000; @bass2006]
......@@ -615,11 +566,11 @@ footnotey <- ("Rn = Rattus norvegicus (rat), Dm = *Drosophila melanogaster (frui
#### High potency of neonicotinoids on heterologously expressed insect-mammalian hybrid receptors
The potency of neonicotinoids on insect-mammal hybrid nAChRs have been determined using electrophysiological techniques. Due to the difficulties in heterologous expression of native insect receptors (Section \@ref), $\alpha$ nAChR subunit from the fruit fly, the cat flea and the planthopper were co-expressed with rat or mouse $\beta2$. The responses of the formed channel were recorded in the presence of various neonicotinoids: cyanoamidines clothianidin and imidacloprid, nitroguanidines thiacloprid and acetamiprid and nitromethylene nitenpyram.
The potency of neonicotinoids on insect-mammal hybrid nAChRs have been also determined using cyanoamidines clothianidin and imidacloprid, nitroguanidines thiacloprid and acetamiprid and nitromethylene nitenpyram.
Depolarising current was recorded from cells expressing insect-hybrid nAchRs in responses to all tested neonicotinoids. This response was dose-dependent. The potency of neonicotinoids varied, as indicated by the EC50 value, between 0.04 and 45.8 $\mu$M, however it is generally in the region of 1 $\mu$M.
Dose-dependent depolarising current was recorded from cells expressing insect-hybrid nAchRs in responses to all tested neonicotinoids. The potency of neonicotinoids varied, as indicated by the EC50 value, between 0.04 and 45.8 $\mu$M, however it is generally in the region of 1 $\mu$M.
The rank order of potency of cyanoamidines, nitroguanidine and nitromethylene differs, depending on the receptor identity. For example, in imidacloprid and clothianidin are the most potent on the fruit fly $\alpha1$ containing receptors [@dederer2011], whereas planthopper $\alpha3\alpha8$ hybrid, thiacloprid is the most efficacious [@yixi2009]. Nitenpyram has consistently the highest EC50.
The rank order of potency of cyanoamidines, nitroguanidine and nitromethylene differs, depending on the receptor identity. For example, in imidacloprid and clothianidin are the most potent on the fruit fly $\alpha1$ containing receptors [@dederer2011], whereas planthopper $\alpha3\alpha8$ hybrid, thiacloprid is the most potent [@yixi2009]. Nitenpyram has consistently the highest EC50.
```{r potencyrecombinant, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
......@@ -687,7 +638,7 @@ library(kableExtra)
cholnts %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Species", "Localisation", "Function", "Major\nreceptor", "Ref")),
col.names = linebreak(c("Species", "Localisation\nof nAChRs", "Function\nof nAChRs", "Major\nreceptor types", "Ref")),
caption = 'Cholinergic neurotransmission',
) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
......@@ -696,25 +647,25 @@ library(kableExtra)
```
### nAChR subunits in insects ###{#expressionfail}
The eletrophysiological and ligand binding studies on neuronal preparations and hybrid receptors provides evidence that nAChR are molecular targets of neonicotinoids.
nAChR are assemblies of 5 different or identical receptor subunits (Section \@ref(structure)). Each subunit is encoded by a separate gene and is classified as either $\alpha$ or non-$\alpha$, depending on the primary amino acid sequence, whereby $\alpha$ subunits contain a disulphide bond formed between the adjacent cysteines in the ligand binding domain (Figure \@ref(fig:structure-nachr-label)). Genome sequencing projects enabled identification of nAChR subunit families in several insect species. Fruit fly and model organism *Drosophila melanogaster* has 10 subunits, 7 of which are $\alpha$ ($\alpha1-7$) and 3 are $\beta$ ($\beta1-3$) [@adams2000a; @sattelle2005]. There are 11 subunits in the beneficial insect honeybee *A. mellifera* ($\alpha1-9$, $\beta1-2$) [@jones2006a; @consortium2006], 12 subunits in the pest red flour beetle *Tribolium castaneum* ($\alpha1-11$,, $\beta1$) [@consortium2008] and 7 in the Pea Aphid, *Acyrthosiphon pisum* ($\alpha1-6$, $\beta1-2$) [@yi-peng2013; @Consortium2010]. With the aid of molecular cloning techniques, equivalent subunits have been identified in many other insects, including cat flea *Ctenocephalides felis* [@bass2006] and green peach aphid *Myzus persicae* [@huang2000]. Amino acid sequence alignment of equivalent subunits revealed that they are highly conserved, with sequence identity typically greater than 60 % [@jones2010].
Insect nAChR gene families are among the least diverse when compared to other animal phyla. Mammals express 17 subunits: $\alpha1-10$, $\beta1-4$, $\delta$, $\gamma$ and $\epsilon$ [@millar2009] and there are 29 subunits in the representative of the phylum *Nematoda, C. elegans* [@jones2007a].
### Diffuculties in heterologous expression of insect nAChRs
### Difficulties in heterologous expression of insect nAChRs
<!-- There are different receptor types in insects. -->
<!-- https://radar.brookes.ac.uk/radar/file/c59cbdb5-d171-49e0-b0e4-101c261c72ed/1/fulltext.pdf -->
To identify which subunits assemble to form functional receptors, recombinant expression techniques were used. Recombinant expression is a technique receptor stoichiometry and function can be studied in a heterologous system. cDNA is injected into the Xenopus oocytes, or used to transfect insect or mammalian cell line. Using internal cellular machinery, it is transcribed, translated and processed to the surface of the cell. Should a protein form, cell-surface expression can be detected using biochemical approaches (such as ligand binding studies), whereas function studied by means of electrical recordings. These approaches were utilised to identify the major receptor assemblies in mammals, nematode and fish (Table \@ref(tab:chlinergic-nts)).
To identify which subunits assemble to form functional receptors, recombinant expression techniques were used. Recombinant expression is a technique by which receptor stoichiometry and function can be studied in a heterologous system. cDNA is injected into the Xenopus oocytes, or used to transfect insect or mammalian cell lines. Using internal cellular machinery, it is transcribed, translated and processed to the surface of the cell. Should a protein form, cell-surface expression can be detected using biochemical approaches (such as ligand binding studies), whereas function studied by means of electrical recordings. These approaches were utilised to identify the major receptor assemblies in mammals, nematode and fish (Table \@ref(tab:chlinergic-nts)).
<!-- To determine which insect nAChR subunits come together to form a functional receptor, various nAChR subunits were injected into the expression systems (*Xenopus oocytes* or cell lines) to determine whether cell surface expression and receptor function can be obtained. -->
To determine which insect subunits form functional nAChRs, @lansdell2012 transfected cultured insect cells with over 70 *Drosophila melanogaster* nAChR subunit cDNAs either singularly or in combinations. No cell surface was achieved, as shown by the radiolabelled ligand binding studies. Difficulties in expression of *Drosophila melanogaster* were also encountered in Xenopus oocytes [@lansdell2012] and mammalian cell lines [@lansdell1997]. The attempts to express receptors from other species were also largely unsuccessful. No ligand binding and/or agonist evoked currents were detected from cells transfected with genes encoding for the nAChR subunits of brown planthopper *Nilaparvata lugens* [@liu2005; @liu2009; @yixi2009], cat flea *Ctenocephalides felis* [@bass2006], aphid *Myzus persicae* [@huang2000] and brown dog tick *Rhipicephalus sanguineus* [@lees2014]. Homomeric Locust *Schistocerca gregaria* $\alpha1$ [@marshall1990], *Myzus Persicae* $\alpha1$ and *Myzus Persicae* $\alpha2$ [@sgard1998] produced receptors with nAChR-like pharmacological and electrophysiological characteristics, however the channel-generated currents were of low amplitude, and the expression was inconsistent.
To determine which insect subunits form functional nAChRs, @lansdell2012 transfected cultured insect cells with over 70 *Drosophila melanogaster* nAChR subunit cDNAs either singularly or in combinations. No cell surface was achieved, as shown by the radiolabelled ligand binding studies. Difficulties in expression of *Drosophila melanogaster* were also encountered in Xenopus oocytes [@lansdell2012] and mammalian cell lines [@lansdell1997]. The attempts to express receptors from other species were also largely unsuccessful. No ligand binding and/or agonist evoked currents were detected from cells transfected with genes encoding for the nAChR subunits of brown planthopper *Nilaparvata lugens* [@liu2005; @liu2009; @yixi2009], cat flea *Ctenocephalides felis* [@bass2006], aphid *Myzus persicae* [@huang2000] and brown dog tick *Rhipicephalus sanguineus* [@lees2014]. Homomeric Locust *Schistocerca gregaria* $\alpha1$ [@marshall1990], *Myzus Persicae* $\alpha1$ and *Myzus Persicae* $\alpha2$ [@sgard1998] produced receptors with nAChR-like pharmacological and electrophysiological characteristics, however the channel-generated currents were of low amplitude, and the expression was inconsistent.
##### Importance of chaperon proteins in heterologous expression of nAChRs ###{#ric3insect}
Difficulties in recombinant receptor expression highlight the complexity of receptor formation. Assembly and oligomerisation are critical steps in the receptor maturation [@brodsky1999]. Co-expression of mammalian and *C. elegans* nAChRs with chaperon proteins highlight the critical role of ER and Golgi resident chaperons in receptor maturation. @boulin2008 demonstrated that three chaperon proteins are necessary for the expression of *C. elegans* muscle-type receptors in Xenopus oocytes: *C. elegans* UNC-50, UNC-74 and RIC-3 (more details on these proteins can be found in Sections \@ref(ric-3celegans), \@(unc-50) and \@ref(unc74)); ligand binding and agonist-evoked currents were abolished upon exclusion of any of the three proteins. RIC-3 also improves the cell surface expression of the second type of the BWM *C. elegans* receptor [@ballivet1996] and in the of neuron-type receptor in Xenopus oocytes [@halevi2002]. It also plays a role in the maturation of human receptor in Xenopus oocytes and cell lines (Section \@ref(ric-3nacho). More recently, RIC-3 has been shown to influence folding and maturation of insect nAChRs. Co-expression of Dm$\alpha2$-containing and Dm$\alpha5$/$\alpha7$ receptors with RIC-3 improved [@lansdell2008], and in some instances enabled expression in otherwise non-permissible systems [@lansdell2012]. Up to 3.5-fold increase in specific binding of radiolabelled antagonist was noted in insect cells co-transfected with RIC-3, suggesting the presence of greater number of folded receptors on the cell surface [@lansdell2008]. Expressed receptors have been also shown to be functional. In Xenopus oocytes, ionic currents were detected in response to acetylcholine in cells co-expressing RIC-3 [@lansdell2012].
Difficulties in recombinant receptor expression highlight the complexity of receptor formation. Assembly and oligomerisation are critical steps in the receptor maturation [@brodsky1999]. Co-expression of mammalian and *C. elegans* nAChRs with chaperon proteins highlight the critical role of ER and Golgi resident proteins in receptor maturation. @boulin2008 demonstrated that three chaperon proteins are necessary for the expression of *C. elegans* muscle-type receptors in Xenopus oocytes: UNC-50, UNC-74 and RIC-3 (described in more details in Sections \@ref(ric-3celegans); \@ref(unc50) and \@ref(unc74)); ligand binding and agonist-evoked currents were abolished upon exclusion of any of the three proteins. RIC-3 also improves the cell surface expression of the second type of the BWM *C. elegans* receptor [@ballivet1996] and the neuron-type *C. elegans* receptor in Xenopus oocytes [@halevi2002]. It also plays a role in the maturation of human receptor in Xenopus oocytes and cell lines (Section \@ref(ric-3nacho)). More recently, RIC-3 has been shown to influence folding and maturation of insect nAChRs. Co-expression of Dm$\alpha2$-containing and Dm$\alpha5$/$\alpha7$ receptors with RIC-3 improved [@lansdell2008], and in some instances enabled expression in otherwise non-permissible systems [@lansdell2012]. Up to 3.5-fold increase in specific binding of radiolabelled antagonist was noted in insect cells co-transfected with RIC-3, suggesting the presence of greater number of folded receptors on the cell surface [@lansdell2008]. Expressed receptors have been also shown to be functional. In Xenopus oocytes, ionic currents were detected in response to acetylcholine [@lansdell2012].
<!-- <!-- RIC-3 enabled identification of potential insect nAChRs. Co expression of Drosophila $\alpha5$ and $\alpha7$ either singlularly or in combonation, gave rise to cell-surface expression, as shown by radiolabelled ligand binding [@lansdell] and heteromeric $\alpha5$/$\alpha7$. The identity of other insect receptors is unknown. -->
......@@ -760,9 +711,10 @@ Difficulties in recombinant receptor expression highlight the complexity of rece
<!-- Recombinant insect nAChR are notoriously difficult to express. Several interventions have been tested including expression of hybrid receptor in which insect subunits have been co-expressed with mammalian ones. It need to be noted that this method has several limitations. First, hybrid receptors are not biologically relevant, thus conclusions from these studies should be drawn with caution. Second, some some of the expressed receptors may be folded, but not functional. Lastly, this method enabled expression of only a handful of receptors, thus most remained uncharacterised. This hinders their pharmacological characterisation and identification of subunits important in conferring the agricultural role of neonicotinoids. Heterologous expression of nAChR from insects and other species would allow for the characterisation of the interactions of these proteins with neonicotinoids to better define their mode of action and selective toxicity. Development of the platform in which the heterologous expression of insect nAChRs could be achieved, would open the door to screening of novel insecticides, to combat emerging and spreading neonicotinoid-resistance (Section \@ref(resgenevidence)) and @charaabi2018). In addition, by expressing nAChRs from pest and other species identification of compounds with no adverse effects on beneficial insects and other biologically important species may be achieved. Model organism *C. elegans* is a system in which the mode of action and the selective toxicity can be studied. -->
## *C. elegans* a model platform for expression of nAChRs
## *C. elegans* as a model system for expression of nAChRs
As indicated, the expression of insect receptors is limited due to diffuculties in heterologous expression in Xenopus oocytes or cell lines. This suggests that these systems do not offer appropriate cellular environment for receptor maturation. Model organism *C. elegans* is an alternative model in which heterologous receptor expression can be achieved [@crisford2011; @salom2012; @sloan2015].
As indicated, the expression of insect receptors is limited due to diffuculties in expression in and cellular environment required . have been studied in model organism
*C. elegans* is a transparent non-parasitic nematode, inhabiting temperate soil environments. This worm was first described as a new species in 1900 [@maupas1900] and named *Caenorhabditis elegans* Greek *caeno* meaning recent, *rhabditis* meaning rod-like and Latin *elegans* meaning elegant. The natural isolate of this species was extracted from the compost heap in Bristol by Sydney Brenner in 1960's and named N2. Since, *C. elegans* has become a valued lab tool and a model organism due to ethical, economical and biological reasons. In contrast to vertebral organisms, *C. elegans* is not protected under most animal research legislation. The cost of use is low, due to the cost of purchase (~$6/strain), maintenance, fast life cycle and high fertility of these animals. *C. elegans* has also is also the first multicellular organism to have the whole genome sequenced [@consortium1998] and the neuronal network has been mapped [@white1986]. It has an advantage over other model organisms in that its nervous system is relatively simple and it is amenable to genetic manipulations.
### General biology of *C. elegans* ##{#genbiology}
......@@ -775,7 +727,7 @@ As indicated, the expression of insect receptors is limited due to diffuculties
knitr::include_graphics("fig/intro_2/life-cycle.jpg")
```
### Nervous system
### Nervous system of *C. elegans*
A great advantage of *C. elegans* is that the entire nervous system has been mapped [@white1986], using electron microscopy of serial worm cross sections. A hermaphrodite has a total of 302 neurons present in the ventral nerve cord, the pharynx, the circumpharangeal ring and the tail. These neurons are assigned to 118 classes based on morphology and positioning. There are 39 sensory neurons, 27 motor neurons and 52 interneurons. Pharyngeal nervous system consists of 20 neurons belonging to 14 types.
......@@ -805,11 +757,11 @@ EPG (electropharyngeogram) is an extracellular electrical recording from the pha
### Acetylcholine regulates feeding, locomotion and reproduction in *C. elegans* ## {#cholinergicneurotransmissioninworms}
Many of the *C. elegans* behaviours are regulated by acetylcholine, which is the major neurotransmitter in the nervous system of *C. elegans*. This is evident for the behavioural analysis of mutant strains in which acetylcholine neurotransmission is affected, as well as from the pharmacological effects of cholinergic agents on the behaviour of worms.
Many of the *C. elegans* behaviours are regulated by acetylcholine, which is the major neurotransmitter in the nervous system of *C. elegans*. This is evident from the behavioural analysis of mutant strains in which acetylcholine neurotransmission is affected, as well as from the pharmacological effects of cholinergic agents on the behaviour of worms.
The synthesis and packing of acetylcholine into synaptic vesicles are essential steps in cholinergic neurotransmission. These functions are mediated by several proteins. Choline acetyltransferase (ChAT) encoded by the cha-1 gene catalyses the formation of acetylcholine [@rand1985]. Vesicular acetylcholine transferase (VAChT) encoded by unc-17 loads acetylcholine into synaptic vesicles [@alfonso1993]. Null mutations of these genes are lethal due to the inhibition of worm's locomotion and feeding and its eventual death due to starvation [@rand1989; @alfonso1993]. Polymorphic ChAT and VAChT mutants in which the expression is reduced, but not abolished, revealed somewhat opposite phenotype. The pharyngeal pumping both in the presence and absence of food was reduced [@dalliere2015] the movement highly uncoordinated and jerky [@rand1984], whereas egg-laying increased [@bany2003].
*C. elegans* cholinergic synapse expresses enzymes and transporters necessary for the cholinergic neurotransmission. Choline acetyltransferase (ChAT) encoded by the cha-1 gene catalyses the formation of acetylcholine [@rand1985]. Vesicular acetylcholine transferase (VAChT) encoded by unc-17 loads acetylcholine into synaptic vesicles [@alfonso1993]. Null mutations of these genes are lethal due to the inhibition of worm's locomotion and feeding and its eventual death due to starvation [@rand1989; @alfonso1993]. Polymorphic ChAT and VAChT mutants in which the expression is reduced, but not abolished, revealed somewhat opposite phenotype. The pharyngeal pumping both in the presence and absence of food was reduced [@dalliere2015] the movement highly uncoordinated and jerky [@rand1984], whereas egg-laying increased [@bany2003].
Aldicarb is a synthetic carbamate mainly used as a nematicide (compound used to kill plant parasitic nematodes) [@lue1984] in the pest management system. Its mode of action is via inhibition of the acetylcholine esterase (AChE, the enzyme that breakdown acetylcholine released to the synaptic cleft) [@johnson1983]. When applied on worms, aldicarb causes hypercontraction of the body wall muscle ,leading to paralysis [@nguyen1995; @mulcahy2013], hypercontraction of the pharyngeal muscle and inhibition of feeding [@nguyen1995] as well as the inhibition of egg-laying [@nguyen1995]. These observations in conjunction with the phenotypical analysis of *cha-1* and *unc-17* mutants, suggest acetylcholine stimulates feeding, coordinates locomotion and inhibits egg-laying in *C. elegans*.
Aldicarb is a synthetic carbamate mainly used as a nematicide [@lue1984], commonly used in the pest management system. Its mode of action is via inhibition of the acetylcholine esterase (AChE, the enzyme that breakdown acetylcholine released to the synaptic cleft) [@johnson1983]. When applied on worms, aldicarb causes hypercontraction of the body wall muscle ,leading to paralysis [@nguyen1995; @mulcahy2013], hypercontraction of the pharyngeal muscle and inhibition of feeding [@nguyen1995] as well as the inhibition of egg-laying [@nguyen1995]. These observations in conjunction with the phenotypical analysis of *cha-1* and *unc-17* mutants, suggest acetylcholine stimulates feeding, coordinates locomotion and inhibits egg-laying in *C. elegans*.
<!-- #### Levamisole -->
......@@ -830,17 +782,13 @@ Aldicarb is a synthetic carbamate mainly used as a nematicide (compound used to
<!-- ``` -->
### *C. elegans* nAChRs
The action of acetylcholine is mediated by nAChR. *C. elegans* contains 29 genes encoding for nAChR subunits [@jones2007a]. The receptor subunits are assigned to five groups based on the sequence homology: DEG-3, ACR-16, ACR-8, UNC-38, and UNC-26 Figure (\@ref(fig:seqidentityecd-label)).
Sequence identity between the insect and *C. elegans* subunits is low. Mean identity is 35 %. Least homologous are members of the DEG-3 family with the mean value of 28 %. the other three groups between 37 and 41 %.
### *C. elegans* nAChRs ###{#celegansnacheintro}
Low similarity between the residues of the ligand binding domain suggest these subunits diverged during the evolution thus have distinct pharmacophore.
*C. elegans* contains 29 genes encoding for nAChR subunits [@jones2007a]. The receptor subunits are assigned to five groups based on the sequence homology: DEG-3, ACR-16, ACR-8, UNC-38, and UNC-26. The ECD domain sequence identity between members of these five groups and insect receptors is low (Figure (\@ref(fig:seqidentityecd-label)), suggesing distinct pharmacophore in the nAChRs of *C. elegans* and insects.
The nAChRs are expresses at the neuromuscular junction [@richmond1999] and in the nervous system [@lewis1987].
<!-- The amino acid sequences from the ligand binding domains of insect and *C. elegans* were aligned and the sequence identities between the insect and *C. elegans* subunits is low with the average identity of 35 %. Least homologous subunits are members of the DEG-3 family with the mean value of 28 %, the sequence identity between insects and other three groups of *C. elegans* receptors varies between 37 and 41 %. Low similarity between the residues of the ligand binding domain suggest these subunits diverged during the evolution thus have distinct pharmacophore. -->
To date, four receptors assemblies have been identified. (1) A single neuronal receptor composed of DES-2 and DEG-3 subunits [@treinin1998]. (2) There are two receptor at the body wall muscle differentiated based on their pharmacology into L-(levamisole)type and N-(nicotine)-type [@richmond1999]. The subunit composition of these receptors is respectively: UNC-29, UNC-38, UNC-63, LEV-1, LEV-8 associated with auxiliary subunits RIC-3, UNC-50, and UNC-74 [@boulin2008] and ACR-16 homopentamer [@touroutine2005] (more details is Section \@ref(muscletypenachr)). EAT-2 is a predicted $\beta$ nAChR subunit expressed in the pharyngeal muscle, believed to assemble with auxilary subunit EAT-18, based on common localisation and behavioural phenotypes of *eat-2* and *eat-18 C. elegans* mutants [@mckay2004]. Based on the expression in Xenopus oocytes, ACR-2 and UNC-38 may co-assembly [@squire1995]. However the levamisole-induced currents were of low amplitude, which may suggest a necessity for auxiliary subunits.
In *C. elegans* nAChRs are expresses at the neuromuscular junction [@richmond1999] and in the nervous system [@lewis1987]. To date, four receptors assemblies have been identified. (1) A single neuronal receptor composed of DES-2 and DEG-3 subunits [@treinin1998]. (2) There are two receptor at the body wall muscle differentiated based on their pharmacology into L-(levamisole) type and N-(nicotine) type [@richmond1999]. The subunit composition of these receptors is respectively: UNC-29, UNC-38, UNC-63, LEV-1, LEV-8 associated with auxiliary subunits RIC-3, UNC-50, and UNC-74 [@boulin2008] and ACR-16 homopentamer [@touroutine2005] (more details is Section \@ref(muscletypenachr)). EAT-2 is a predicted $\beta$ nAChR subunit expressed in the pharyngeal muscle, believed to assemble with auxilary subunit EAT-18, based on common localisation and behavioural phenotypes of *eat-2* and *eat-18 C. elegans* mutants [@mckay2004]. Based on the expression in Xenopus oocytes, ACR-2 and UNC-38 may co-assembly [@squire1995].
<!-- # ```{r celegans-nachrs, echo=FALSE, message = FALSE, warning=FALSE} -->
<!-- # library(kableExtra) -->
......@@ -858,7 +806,7 @@ To date, four receptors assemblies have been identified. (1) A single neuronal r
<!-- # threeparttable = T) -->
<!-- # ``` -->
(ref:seqidentityecd) **Amino acid sequence identity between the insect and *C. elegans* nAChR subunits.** Sequences of the honeybee and *C. elegans* extracellular, ligand binding domains were aligned using the MUltiple Sequence Comparison by Log- Expectation (MUSCLE). Sequence identities were derived with the HMMER alignment and color-coded using red-yellow-green scale. *C. elegans* subunits of the UNC-38 group are the most homologous to the insect subunits.
(ref:seqidentityecd) **Amino acid sequence identity between the insect and *C. elegans* nAChR subunits.** Sequences of the honeybee and *C. elegans* extracellular, ligand binding domains were aligned using the Multiple Sequence Comparison by Log- Expectation (MUSCLE). Sequence identities were derived with the HMMER alignment and color-coded using red-yellow-green scale. *C. elegans* subunits of the UNC-38 group are the most homologous to the insect subunits.
```{r seqidentityecd-label, fig.cap = "(ref:seqidentityecd)", fig.scap="Amino acid sequence identity between the insect and *C. elegans* nAChR subunits", out.height = '120%', fig.align= 'center', echo=FALSE}
knitr::include_graphics("fig/general_intro/pdf/identity_clipped_renamed_aligned_celegans_apismelifera.png")
......@@ -873,15 +821,15 @@ knitr::include_graphics("fig/general_intro/pdf/identity_clipped_renamed_aligned_
*C. elegans* expresses nAChRs are the neuromuscular junction and in nervous cells, thus it possesses cellular machinery necessary for the processing of these proteins. Several *C. elegens* chaperons involved in nAChRs maturation and function have been identified. RIC-3 is a ubiquitously expressed in *C. elegans* (Section \@ref(ric-3celegans)). It has a role in folding and assembly of nematode, insect (Section \@ref(ric3insect)) and vertebrate nAChRs (Section \@ref(ric3insect)). *C. elegans* RIC-3 has been shown to improve heterologous expression of insect hybrid [@lansdell2012] and mammalian nAChR [@lansdell2005] in cell lines and Xenopus oocytes. UNC-74, UNC-50 are ER and Golgi residing proteins, respectively, involved in maturation of *C. elegans* nAChRs. Whereas EAT-18 is a transmembrane protein, expressed on the cell surface, required for the function of nAChRs in the pharyngeal muscle. Details of their function can be found in Sections \@ref(unc50), \@ref(unc74) and \@ref(eat18)). It is therefore predicted that *C. elegans* has a favorable cellular environment for the expression of nAChRs.
The expression of transgene can be driven in specific cells or tissues by utilising native promoters. Conjugated monoclonal antibodies were used to show selective expression of myo-3 (heavy chain of myosin B) at the body-wall muscle and vulva muscle [@ardizzi1987] and myo-2 (myosin heavy chain C) in the pharyngeal muscle [@okkema1993] of the intact worm. Thus, by using myo-3 or myo-2 promoters upstream of the heterologous gene, expression at the body wall or pharyngeal muscle, respectively, can be achieved [@sloan2015; @crisford2011]. There are also promoters, such as H2O, inducing expression in the nervous system [@yabe2005].
The expression of transgene can be driven in specific cells or tissues by utilising native promoters. Conjugated monoclonal antibodies were used to show selective expression of myo-3 (heavy chain of myosin B) at the body-wall muscle and vulva muscle [@ardizzi1987] and myo-2 (myosin heavy chain C) in the pharyngeal muscle [@okkema1993] of the intact worm. Thus, by using myo-3 or myo-2 promoters upstream of the heterologous gene, expression at the body wall or pharyngeal muscle, respectively, can be achieved [@sloan2015; @crisford2011].
Heterologous expression of receptor proteins can have several consequences on the worm:
(1) When re-introduced into the mutant strain, it can restore drug or cellular function [@crisford2011].
(1) When re-introduced into the mutant strain, it can restore drug or cellular function [@crisford2011; @salom2012].
<!-- For example, expression of *C. elegans* and human ortholog of the potassium-activated calcium channel Slo-1 at the body wall muscle of *C. elegans slo-1* mutant restored sensitivity to selective agonist emodepsite in locomotory assays -->
(2) Heterologous expression in wild-type worm can lead to new or altered pharmacological sensitivity [@crisford2011].
(2) Heterologous expression in wild-type worm can lead to new or altered pharmacological sensitivity [@crisford2011; @salom2012].
<!-- emonstrated that the ectopical expression of Slo-1 in the pharyngeal muscle cell confers sensitivity to emodepsite. -->
......
......@@ -19,13 +19,13 @@ library(kableExtra)
## General bacterial methods
### Transformation of *E. coli* with DNA vectors
Briefly, 25 to 50 $\mu$L of chemically competent Mach1 or DH5$\alpha$ *E.coli* cells were combined and gently mixed with ~10 pg of plasmid DNA. The mix was left on ice for 30 minutes. Cells were placed in 42$^\circ$C water bath and after 45 seconds placed back on ice. Next, 250-500 $\mu$L of growth medium (Luria-Bertani (LB) broth) was added and cells placed in the 37 $^\circ$C shaking incubator for 45 minutes to 1 hour. The entire volume of cells was spread onto 10 cm LB-agar plate containing an appropriate antibiotic for selection. Antibiotics used for each vector selection are listed in Table \@ref(tab:antibiotics-used). Cells were spread on plates were left in the 37$^{\circ}$C incubator overnight to allow for growth of transformed cells into colonies.
Briefly, 25 to 50 $\mu$L of chemically competent Mach1 or DH5$\alpha$ *Escherichia coli (E.coli)* cells were combined and gently mixed with ~10 pg of plasmid DNA. The mix was left on ice for 30 minutes. Cells were placed in 42$^\circ$C water bath and after 45 seconds placed back on ice. Next, 250-500 $\mu$L of growth medium (Luria-Bertani (LB) broth) was added and cells placed in the 37 $^\circ$C shaking incubator for 45 minutes to 1 hour. The entire volume of cells was spread onto 10 cm LB-agar plate containing an appropriate antibiotic for selection. Antibiotics used for each vector selection are listed in Table \@ref(tab:antibiotics-used). Cells were spread on plates were left in the 37$^{\circ}$C incubator overnight to allow for growth of transformed cells into colonies.
```{r antibiotics-used, echo=FALSE}
library(kableExtra)
text_tbl <- data.frame(
Plasmid = c("pET26", "pBMH", "pET27b(+)", "pcDNA3.1", "PCR-8-TOPO", "pDEST"),
Antibiotic = c("Kanamycin", "Ampiciliin", "Kanamycin", "Ampiciliin", "Spectinomycin", "Ampiciliin"))
Antibiotic = c("Kanamycin", "Ampicillin", "Kanamycin", "Ampicillin", "Spectinomycin", "Ampicillin"))
knitr::kable(text_tbl, format = "latex", caption = 'Selection pressure for DNA plasmids used in this study.', booktabs = TRUE) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
......@@ -36,7 +36,7 @@ knitr::kable(text_tbl, format = "latex", caption = 'Selection pressure for DNA p
\newpage
### Isolation of DNA plasmid from *E. coli* ### {#miniprep}
Transformed *E.coli* colony was picked, placed in 5 mL of LB supplemented with appropriate antibiotic and incubated overnight at 37$^{\circ}$C whilst shaking. DNA was extracted using the MiniPrep Kit (Thermo Scientific or Qiagen) following the manufacturers instructions. Centrifugation was carried out in table top centrifuge at 12 000 g. Isolated DNA was quantified in a Nanodrop UV-Vis spectophotometer.
Transformed *E.coli* colony was picked, placed in 5 mL of LB supplemented with appropriate antibiotic and incubated overnight at 37 $^{\circ}$C whilst shaking. DNA was extracted using the MiniPrep Kit (Thermo Scientific or Qiagen) following the manufacturers instructions. Centrifugation was carried out in table top centrifuge at 12 000 g. Isolated DNA was quantified in a Nanodrop UV-Vis spectophotometer.
### Analytic digestion of DNA plasmids
DNA plasmids were digested with restriction enzyme(s) (Promega). The reaction mix (Table \@ref(tab:RE-reaction) was incubated at 37 $^{\circ}$C for 2-8 hours and the DNA fragments were resolved on the agarose gel (Section \@ref(electrophoresis)).
......@@ -49,7 +49,7 @@ RE_reaction <- data.frame(
names(RE_reaction) <- NULL
knitr::kable(RE_reaction, "latex", escape = FALSE, booktabs = TRUE, caption = "Restriction enzyme reaction.") %>%
knitr::kable(RE_reaction, "latex", escape = FALSE, booktabs = TRUE, caption = "Components assembled to cary out restriction enzyme reaction.") %>%
kable_styling(latex_options = "hold_position")
# %>% kable_styling(position = "center") # use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page). Note that the styling function does not work here because it is from the extra package
......@@ -60,13 +60,13 @@ knitr::kable(RE_reaction, "latex", escape = FALSE, booktabs = TRUE, caption = "R
### Amplification of DNA fragments by Polymerase Chain Reaction (PCR)
#### Primer design
To enable the amplification of the DNA of interest, appropriate PCR primers were designed applying the following criteria: primers were unique to the annealing site on the designated DNA, 18 to 25 nucleotides long, guanine-cytosine content from 40 to 60%, melting temperature from 55 to 75$^{\circ}$C. Where possible, primers rich in guanine and cytosine at 3’ end were selected to facilitate high specificity of primer binding to the target. The primers were ordered from Eurofins Genomics, subsequently diluted in ddH~2~O to the concentration of 100 pmol/$\mu$l and stored at -20 $^{\circ}$C. Sequences of primers used in this study can be found in Table \@ref(tab:primer-seq1).
To enable the amplification of the DNA of interest, appropriate PCR primers were designed applying the following criteria: primers were unique to the annealing site on the designated DNA, 18 to 25 nucleotides long, guanine-cytosine content from 40 to 60 %, melting temperature from 55 to 75 $^{\circ}$C. Where possible, primers rich in guanine and cytosine at 3’ end were selected to facilitate high specificity of primer binding to the target. The primers were ordered from Eurofins Genomics, subsequently diluted in ddH~2~O to the concentration of 100 pmol/$\mu$l and stored at -20 $^{\circ}$C. Sequences of primers used in this study can be found in Table \@ref(tab:primer-seq1).
```{r primer-seq1, echo=FALSE}
library(kableExtra)
library(dplyr)
pcr_primer_seqs <- data.frame(
DNA.product = c("Ndel-pelB-3C-SalI", "SalI,$\\alpha$7ECD-2GSC-NheI", "CHRNA7", "eat-2"),
DNA.product = c("\\textit{Ndel-pelB-3C-SalI}", "\\textit{SalI,$\\alpha$7ECD-2GSC-NheI}", "\\textit{CHRNA7}", "\\textit{eat-2}"),
Primer = c("Fw: gaaggagatatacatatgaaatacctg\nRv: TAGCTTGTCGACgggcccctggaacagaacttc", "Fw: AGCTCCGTCGACtttcagcgtaaactgtacaaag\nRv: ACTAGCTAGCTTAaagcttagccgcaccacggcg", "Fw: atgcgctgctcgccgggaggcg\nRv: ttacgcaaagtctttggacacggc", "Fw: atgaccttgaaaatcgca\nRv: ttattcaatatcaacaatcgg"),
Size = c("1560", "1051", "1509", "1425"))
......@@ -81,7 +81,7 @@ kable("latex", booktabs = T, escape = F,
\newpage
#### PCR Protocol
PCR was performed using either Phusion® High-Fidelity DNA Polymerase (Thermo Scientific) or Pfu DNA polymerase (Promega) as indicated. The components mixed and cycling conditions used are listed in Tables \@ref(tab:Phusion-pol) and \@ref(tab:Pfu-pol).
PCR was performed using either Phusion High-Fidelity DNA Polymerase (Thermo Scientific) or Pfu DNA polymerase (Promega) as indicated. The components mixed and cycling conditions used are listed in Tables \@ref(tab:Phusion-pol) and \@ref(tab:Pfu-pol).
<!-- Table: (\#tab:PCR-cond) PCR conditions used to amplify DNA fragments. -->
......@@ -146,7 +146,7 @@ library(kableExtra)
library(dplyr)
phusion_components <- data.frame(
Component = c("Buffer", "dNTP mix", "Reverse/\nForward primer", "DNA", "Polymerase", "ddH$_2$O"),
Concentration = c("1x", "200 $\\mu$M", "500 nM", "10ng / 50 $\\mu$L reaction", "0.5U / 50$\\mu$L reaction", "up to 50 $\\mu$L"))
Concentration = c("1x", "200 $\\mu$M", "500 nM", "10 ng / 50 $\\mu$L reaction", "0.5 U / 50 $\\mu$L reaction", "up to 50 $\\mu$L"))
phusion_components %>%
mutate_all(linebreak) %>%
......@@ -177,7 +177,7 @@ library(kableExtra)
library(dplyr)
phusion_components <- data.frame(
Component = c("Buffer", "dNTP mix", "Reverse/\nForward primer", "DNA", "Polymerase", "ddH$_2$O"),