Skip to content
Snippets Groups Projects

Compare revisions

Changes are shown as if the source revision was being merged into the target revision. Learn more about comparing revisions.

Source

Select target project
No results found
Select Git revision
Loading items

Target

Select target project
  • mk11g11/thesis-template
  • ab604/thesis-template
2 results
Select Git revision
Loading items
Show changes
Commits on Source (6)
Show whitespace changes
Inline Side-by-side
Showing
with 6216 additions and 24 deletions
00-preface.Rmd
View file @ e74fe8cf
\phantomsection \phantomsection
\pdfbookmark[0]{Title Page}{title} \pdfbookmark[0]{Title Page}{title}
<!-- Title, name and date --> <!-- Title, name and date -->
\title{\LARGE {\bf My awesome thesis dissertaion title}\\ \title{\LARGE \textbf {Investigation of the selective toxicity of neonicotinoids using the nematode worm \textit {\textbf {Caenorhabditis elegans}}}\\
\vspace*{6mm}} \vspace*{6mm}}
\author{Monika Kudelska} \author{Monika Kudelska}
\maketitle \maketitle
......
01-intro.Rmd
View file @ e74fe8cf
# Introduction {#intro} ---
nocite: |
@chen1997, @araujo1988, @couturier1990, @cooper1991, @lee1967, @brown1936, @mishina1986, @zirger2003, @mongeon2011, @lewis1987, @treinin1998, @richmond1999, @boulin2008, @touroutine2005,
...
Background and introduction chapter # General introduction {#generalintro}
\ No newline at end of file
## Chemical treatment in agriculture
Insecticides are compounds utilised in agriculture, medicine, industry and private households to protect crops, life-stock and human health from pest infestation [@anadon2009; @dryden2009; @oberemok2015]. Their identity evaluated over the years to improve the effectiveness and reduce the undesirable effects on human health and the environment [@casida1998].
Until late 1800s organic, natural compounds contained within the plant or animal matter were utilised [@casida1998]. The first record of agricultural application of nicotine-containing Tobacco [@david1953; @steppuhn2004] dates back to 1690 [@mcindoo1943]. Tobacco plant, has been used in France, England and the US to protect orchards and trees against a wide range of pests including aphids, caterpillars and plant lice [@@mcindoo1943]. *Chrysanthemum* plants containing pyrethrum were used against worms and insects in America and Europe [@elliot1995]. These treatments were however suitable only for small scale agricultural treatment, due to the limited availability.
Arsenic compounds were the earliest inorganic insecticides. Although their history dates back to 5th century [@kerkut1985], they did not gain popularity until the 19th century. Aceto-arsenite Paris Green was used in controlling Colorado potato beetles and mosquitoes [@cullen2008; @peryea1998], whereas lead arsenate was an effective insecticide for apple and cherry orchards [@peryea1998]. Although effective against pests, these substances are toxic to humans [@nelson1973; @gibb2010; @argos2010] thus their use marginal [@echa2017].
In the last century, several synthetic compounds became available, including dichlorodiphenyltrichloroethane (DDT), and members of the carbamate, organophosphate and pyrethroid class of compounds. DTT was one of the most popular insecticides in the 1900s, with the peak annual use of over 85 000 tonnes in the U.S. alone [@phsa2002]. DDT's potent insecticidal activity was discovered 60 years after its synthesis in 1874, by the Swiss chemist Paul Hermann Muller, who was later awarded a Nobel prize in Medicine “for his discovery of the high efficiency of DDT as a contact poison against several arthropods.” [@nobel2019]. DTT became commercially available in the 1940s in Europe and the U.S., and it was used to suppress potato beatles, mosquitoes, fleas and lice. Since 1970s, the use of DDT has been progressively phased out due to its propensity to bio-accumulate in the adipose tissues of animals resulting in the environmental persistence [@EUEPA1975].
Diminishing popularity of DDT, created a market space for organophosphates, carbamates and pyrothroids (Table \@ref(tab:insecticidegroups)). By the 1990s, the respective market share of members of these three classes of insecticides was: 43 %, 15 % and 16 % and the annual sales of 3.42 bn Euros, 1.19 bn Euro and 1.169 bn Euro, respectively [@jeschke2011]. The main issue associated with the use of organophosphates and carbamates is their ability to cause serious human poisonings, some of which can lead to death [@king2015]. The lack of selectivity combined with increasing resistance [@bass2014] instigated new management strategies aimed to combat these negative effects. In the 1990s research activities concentrated on finding new insecticides which have greater selectivity and better environmental and toxicological profiles.
```{r insecticidegroups, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
insecticide_groups <- data.frame(
Class = c("Organophosphates", "Carbamates", "Pyrethroids"),
Chemicals = c("Parathion, malathion, azinphosmethyl", "Aldicarb, carbamyl, carbofuran", "Allethrin, Cypermethrin"),
Mode = c("Acetylcholinesterase\ninhibitor", "Acetylcholinesterase\ninhibitor", "Voltage gated\nsodium channel blocker"))
insecticide_groups %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Class", "Chemical", "Mode of\naction")),
caption = 'Synthetic insecticides') %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote("Sales as of 2008, according to Jeschke et al. 2011",
threeparttable = T)
```
## Neonicotinoids
### Synthesis
In 1970s, the scientists of Shell Development Company Biological Research Centre in California identified alpha- DBPN (2-(dibromonitromethyl)-3-(methylpyridine)), first synthesised by Prof. Henry Feuer [@feuer1986]. This lead compound showed low insecticidal activity against aphid and house fly [@tomizawa2003; @tomizawa2005]. Structural alterations of DBPN resulted in production of nithiazine (Figure \@ref(fig:neonics-structure-label)). Nithiazine showed improved insecticidal activity and was particularly effective as a new housefly repellent [@kollmeyer1999]. Further replacement of the thiazine ring by chloropyridinylmethyl (CPM) group, addition of the imidazolidine or its acyclic counterpart, and retention of the nitromethylene group resulted in generation of more potent compounds, one of which, nitenpyram, exhibited particularly high efficacy. Regrettably, both nithiazine and nitenpyram are not useful in fields, as they are unstable in light. The latter however is successfully used in veterinary medicine as an external parasite treatment for cats and dogs.
To solve the issue of photo-instability, nitromethylene group (CCHNO2) was replaced by nitroguanidine (CNNO2) and cyanoamidine (CNCN) (Figure \@ref(fig:neonics-structure-label) and @kagabu1995). These chemical moieties have absorbance spectra at much shorter wavelengths hence do not degrade upon exposure to sunlight. Further alterations, such as replacement of imidazolidine by thiazolidine or oxadiazinane, and/or chloropyridinylmethyl by chlorothiazole or tetrahydrofuran (THF) did not hinder insecticidal activity [@yamamoto1999]. As a result of these modifications, all 6 currently used neonicotinoids were synthesised. They are grouped according to their pharmacophore into N-nitroguanidines, nitromethylenes and N-cyanoamidines (Figure \@ref(fig:neonics-structure-label)). Generally compounds with acyclic- guanidine or amidine and with nitromethylene are more efficacious against moth- and butterfly- pests than those with cyclic counterparts or nitroimine respectively [@ihara2006], nevertheless all are commonly used in agriculture. Imidacloprid, currently the most widely used neonicotinoid, was synthesised in 1970 in Bayer Agrochemical Japan and introduced to the EU market in 1991. Its trade names include Confidor, Admire and Advantage. Together with thiacloprid (Calypso), imidacloprid is marketed by Bayer CropScience. Thiamethoxam (Actara) is produced by Syngenta, Clothianidin (Poncho, Dantosu, Dantop) and Nitenpyram (Capstar) by Sumitomo Chemical, acetamiprid (Mospilan) by Certis, whereas dinotefuran (Starkle) by Mitsui Chemicals company. Last neonicotinoid (dinotefuran) was launched in the EU in 2008.
Research into novel neonicotinoids continues [@shao2013]. In the last decade, several novel insecticides have been characterised and approved for use in the EU. Sulfoxafrol [@zhu2011; @eu2019a] and flupyradifurone [@nauen2015; @eu2019b] have been classified as representatives of new chemical classes, namely sulfoximines and butenolides. However, due to their mode of action and similar biochemical properties, some argue that they are in fact neonicotinoids, whereas their mis-classification has been deliberate to avoid association with neonicotinoids [@pan2019].
(ref:neonics-structure) **Development and chemical structures of synthetic insecticides neonicotinoids.** Systematic modification of the lead and prototype compounds led to the discovery of seven neonicotinoids currently used in agriculture and animal health. They are structurally related to nicotine (shown in top right corner) and classified according to the pharmacophore moiety into N-nitroguanidines, N-cyanoamidines and nitromethylenes.
```{r neonics-structure-label, fig.cap="(ref:neonics-structure)", fig.scap='Development and chemical structures of synthetic insecticides neonicotinoids.',fig.align='center', out.height = '90%', echo = FALSE}
knitr::include_graphics("fig/general_intro/png/neonics_structure.png")
```
### Economical status ###{#economicalstatus}
The use of neonicotinoids in agriculture has been increasing steadily since their launch in the early 1990s. By 2008, they became major chemicals in the agriculture, replacing organophosphates and carbamates [@jeschke2011]. Continual increase in popularity of neonicotinoids is reflected in the total usage data. In Great Britain, the yearly use of neonicotinoids increased by over 10-fold from 10 tonnes/year in 1996 to over 105 tonnes/year in 2016 [@fera2019]. Similar trends are observed in the U.S. [@usgs2019], Sweden and Japan [@simon-delso2015]. Continual increase in usage coincides with the rise in their economical impact. In 2008, the estimated global market value of neonicotinoids was 1.5 bn dollars [@jeschke2011]. This increased to 3.1 bn dollars in 2012 [@bass2015].
The widespread usage and monetary value of neonicotinoids is a reflection of their many advantages.
<!-- Important in the pest managment, used in over 120 coutries on 140 crop types [@jeschke2011]. -->
### Properties ##{#physchem}
One of the major benefits of neonicotinoids are their physical and chemical profiles (Table \@ref(tab:properties)).
#### Diverse methods of applications
Due to relatively high water solubility, neonicotinoids act as systemic insecticides [@westwood1998]. This means that once applied on crops, they dissolve in the available water and can be taken up by the developing roots or leaves. Upon plant entry, they are then distributed to all parts of the plant [@westwood1998; @stamm2016], providing protection against herbivorous pests [@stamm2016]. This property of neonicotinoids means they can be used as a seed coating, reducing the required frequency of application. Indeed, seed dressing is the most commonly used method, accounting for 60 % of all neonicotinoids applications worldwide [@jeschke2011] and particularly popular to protect potatoes, oilseed rape, cereal, sunflower and sugar beet. In addition, neonicotinoids half-life in soil is from several weeks to years [@cox1997; @sarkar2001; @gupta2007), hence seed-dressing creates a continual source for re-uptake by plants. Neonicotinoids are also suitable for ground treatment and are used as soil drenching for the protection of citrus trees and vines, granules for amenity grassland and ornament flowers and as a trunk-injection to protect trees against herbivores. They are not volatile, therefore can be also applied as spray. This method is used in garden for flowers and vegetables and in agriculture on soft fruits and greenhouse crops. Low lipophilicity, indicated by octanol/water partition coefficient value (log Pow), suggest they do not bio-accumulate in the adipose tissues of animals [@turaga2016]. However, moderate water solubility combined with low lipophilicity means they may have a potential to accumulate in water.
<!-- Although structurally related nicotine has similar properties, it is not appropriate for the agricultural use due to low toxicity to insects [@nauen1996]. -->
```{r properties, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
properties <- data.frame(
Compound = c("Nitenpyram", "Clothianidin", "Thiacloprid"),
log = c("-0.64 (1)", "0.70 (1)", "1.26 (1)"),
pKa = c("3.1 and 11.5", "11.09 (5)", "NA (5)"),
Water = c("590 000 (3)", "340 (3)", "184 (3)"),
Henry = c("4 x 10\\textsuperscript{-13} (5)", "3 x 10\\textsuperscript{-11} (5)", "5 x 10\\textsuperscript{-10} (5)" ),
Water = c("NA (3)", "56.4 (3)", "28.0 (3)"))
properties %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Compound", "log Pow\npH=7.4\n24 $^\\circ$C", "pKa at\n20 $^\\circ$C", "Water solubility\nmg / L\n20 $^\\circ$C\npH=7", "Henry's law\nPa x m$^3$ x mol$^-1$\n20 $^\\circ$C", "Water sediment \nDT50 (days)")),
caption = 'Physichochemical properties of neonicotinoids',
) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote("log Pow = octanol/water partitioning, DT50 = half-life for degradation, 1 = Jeschke and Nauen 2008, 2 = Sangster 1997, 3 = Bonmatin et al., 2015, 4 = Maeda et al., 1978, 5 = Pesticide Properties Database (PPDB), 2019",
threeparttable = T)
```
#### Highly potent against insect pests ####{#potentpests}
<!-- look at this paper to see the symptoms of imi exposure on insects -->
<!-- @sone1994 -->
Neonicotinoids are highly potent against insect pests, as measured by the LC50/LD50 (the concentration/dose of a compound that kills 50 % of the population) in the acute toxicity assays (Table \@ref(tab:toxallanimal)). The lower the LC(D)50, the greater the potency of a compound.
Neonicotinoids are effective against a wide range of piercing-sucking pests such as cotton and peach aphids (**Aphis gossypii** and *Myzus persicae*) [@nauen1996; @mota-sanchez2006; @bass2011], domestic (*Malus domestica*) and may-flies (*Epeorus longimanus*) [@tomizawa2000; @alexander2007] as well as planthoppers (*Nilaparvata lugens*) [@zewen2003]. Their IC50 is in generally the region of 2 $\mu$M. Although all neonicotinoids are highly effective against insect pests, their potency depends on the chemical structure. The rank order of insecticidal potency on the cotton aphid **A. gossypii** and the Colorado potato beetle, *Leptinotarsa decemlineata* was clothianidin > nitenpyram = thiacloprid, suggesting nitroguanidines are generally more potent than nitromethylenes and cyanoamidines [@shi2011; @mota-sanchez2006].
The potency also depends on the route of exposure. LC50s are lower upon systemic or oral administration in comparison to the topical exposure [@alexander2007]. Imidacloprid injected into the abdomen of American cockroaches *Periplaneta americana*, killed 50 % of animals at 1 nM [@ihara2006]. Concentrations of 285.49 nM and 1.83 $\mu$M were required to observe the same effect upon oral or contact exposure, respectively in the peach aphid *Myzus persicae* [@nauen1996]. Effective doses obtained from oral and topical studies are most relevant, since these are the two main routes of exposure of pests in the agriculture.
The LC(D)50 values of neonicotinoids are at least 6-fold higher than those of structurally related nicotine, highlighting the superiority of neonicotinoids as pest controlling agents.
\newpage
```{r toxallanimal, echo=FALSE, warning = FALSE, message = FALSE}
library(kableExtra)
library(dplyr)
footnotea <- "References (Ref) 16: Shi et al. 2011, 1: Nauen et al. 1996, 2: Mota-Sanchez et al. 2006, 3: Bass et al. 2011, 4: Zewen et al. 2003, 5: reported in Tomizawa et al. 2000, 6: Alexander et al. 2007, 7: De Cant and Barrett 2010, 8: Luo et al. 1999, 9: De Cant and Barrett 2010, 10: Wang et al. 2012, 11: Wang et al. 2015, 13: = Dong et al. 2017, 14: Cresswell 2011, 15: = Godfray et al. 2015"
toxic <-data.frame (
Drug = c("Thia", "Clo", "Nit", "Imi", "Imi", "Nic", "Nic", "Imi", "Thtx","Imi", "Thtx","Nic", "Dino", "Thia", "Imi", "Nit", "Thia", "Clo", "Ace", "Imi", "Thia", "Nic", "Imi", "Imi", "Imi", "Imi", "Imi", "Clo", "Thx", "Clo", "Clo", "Clo", "Clo", "Clo", "Clo", "Imi", "Imi", "Clo", "Clo", "Clo", "Imi", "Acet", "Nit", "Clo", "Thia", "Thia"),
Species = c("A. gossypii", "A. gossypii", "A. gossypii", "M.persicae", "M.persicae", "M.persicae", "M.persicae", "M.persicae", "M.persicae","M.persicae", "M.persicae", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "N.lugens","M. domestica", "M. domestica", "E. longimanus", "E. longimanus", "A. mellifera", "A. mellifera", "A. mellifera","A. mellifera","A. mellifera", "Bobwhite quail", "Bobwhite quail", "Mallard duck", "Mouse", "O. mykiss", "L. macrochirus", " E. fetida", "E. fetida", "E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", "M. incognita"),
Taxon = c("Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect","Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "insect", "Insect", "Insect", "Bird", "Bird", "Bird", "Mammal", "Fish", "Fish", "Earth worm", "Earth worm","Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Nematode"),
LD50 = c("-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "0.35 ng/mg", "0.05 ng/mg", "6.8 ng/beetle", "0.34 ng/beetle", "0.20 ng/beetle", "0.18 ng/mg", "0.15 ng/mg", "0.14 ng/mg", "0.82 ng/mg", "3 ng/mg", ">50 ng/mg", "-", "-", "-", "0.81 ng/mg", "0.81 ng/mg", "0.44 ng/mg", "0.24 ng/mg", ">200 mg/kg (acute)", ">5040 mg/kg (5 days)", ">5230 mg/kg (5 days)", "389-465 mg/kg", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-"),
LC50 = c("9.35 $\\mu$M", "7.29 $\\mu$M", "9.12 $\\mu$M", "1.83 $\\mu$M", "285.49 nM", "1.85 mM", "27.74 mM", "3.87 $\\mu$M", "2.19 $\\mu$M", "257.52 nM", "1.64 mg/L", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "82.13 nM (24 hrs)", "2.54 nM (96 hrs)", "6.88 $\\mu$M", "-", "-","-","-","-", "-", "-", "-", "424.51 $\\mu$M", "468.60 $\\mu$M", "4.81 $\\mu$M (24 hours)", "2.74 $\\mu$M (48 hours)", "62.08 $\\mu$M (14 days)", "24.24 $\\mu$M (7 days)", "24.27 $\\mu$M (14 days)", "11.93 $\\mu$M (14 days)", "12.08 $\\mu$M (14 days)", "26.75 $\\mu$M (14 days)", "3.72 $\\mu$M (14 days)", "10.60 $\\mu$M (14 days)", "143. 24 $\\mu$M (6 hours)"),
Bioassay = c("Topical", "Topical", "Topical", "Topical", "Oral", "Topical", "Oral", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "?", "?", "Topical", "Topical", "Oral", "Oral", "Topical", "Topical", "Topical", "Oral","Oral", "Oral", "Oral", "?", "?", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical"),
Ref = c("16", "16", "16", "1", "1", "1", "1", "3", "3", "3", "3", "2", "2", "2", "2", "2", "2", "2", "2", "4", "5", "5", "6", "6", "14", "14", "15", "15", "15", "7", "7", "7", "7", "7", "7", "8", "8", "9", "10", "10", "11", "11", "11", "11", "12", "13"))
toxic %>%
kable("latex", align = "l", escape = F, booktabs = TRUE, longtable = TRUE,
caption = 'Toxicity of nicotine and neonicotinoids') %>%
kable_styling(font_size=10, position = "center", full_width = FALSE, latex_options = c( "hold_position", "repeat_header")) %>%
footnote(general = footnotea,
threeparttable = TRUE)
```
```{r tox, echo=FALSE, warning = FALSE, message = FALSE}
library(kableExtra)
library(dplyr)
# toxic <-data.frame (
# Drug = c("Thia", "Clo", "Nit", "Thia", "Clo", "Nit", "Nic"),
# Species = c("Aphis gossypii", "Aphis gossypii", "Aphis gossypii", "Aphis gossypii", "L. decemlineata", "L. decemlineata", "L. decemlineata"),
# Taxon = c("Insect", "Insect", "Insect", "Insect","Insect", "Insect", "Insect"),
# LD50 = c("", "", "", "0.18 ng/mg", "0.15 ng/mg", "0.20 ng/mg", "0.35 ng/mg"),
# LC50 = c("9.35 $\\mu$M", "7.29 $\\mu$M", "9.12 $\\mu$M", "", "", "", ""),
# Bioassay = c("Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical"),
# Ref = c( "Mota-Sanchez et al. 2006", "Mota-Sanchez et al. 2006", "Mota-Sanchez et al. 2006"))
#
# toxic %>%
# kable("latex", align = "l", escape = F, booktabs = TRUE, longtable = TRUE,
# caption = 'Toxicity of nicotine and neonicotinoids') %>%
# kable_styling(font_size=10, position = "center", full_width = FALSE, latex_options = c( "hold_position", "repeat_header"))
# to calculate the ng/mg cocroach divided by 175, bee by 100
```
#### Selectively toxic to insect pests. ###{#seltox}
One of the key determinants of success of agrochemical compounds is their ability to selectively target insects over non-target species. Neonicotinoids are generally effective at ~ 2 $\mu$M concentrations against piercing-sucking pest infestations, whereas their LD50s is in the region of 0.2 - 0.3 ng/mg of body weight [@mota-sanchez2006; @zewen2003; @tomizawa2000; @alexander2007]. The LC(D)50 values for non-target species is at least 2 times higher (Table \@ref(tab:toxallanimal)). Honeybees (*Apis mellifera*) are among the most susceptible non-targets, with the average LC50 and LD50 values for imidacloprid of 7.04 $\mu$M and 4.5 ng per mg of body weight, respectively [@cresswell2011]. Some studies report high potency of neonicotinoids on earth worms, with the LC50 as low as 2.74 $\mu$M on redworm *Eisenia fetida* (*E. fetida*) [@luo1999]. Fish and birds are hundred fold less susceptible [@decant2010], whereas mammals are the least susceptible with LD50 doses higher than 130 mg/kg of body weight [@decant2010; @legocki2008]. This differential susceptibility between target and non-target species, in expected to enable an environmental release of neonicotinoids at concentrations which will exterminate pests without killing the non-targets. Indeed, field realistic concentrations of neonicotinoids are higher than those causing lethality of the most susceptible species (i.e. worms and honey bee).
Concentrations of neonicotinoids in nectar, wax and pollen was been investigated. Generally, the highest concentrations are found in the former [@goulson2013]. @cresswell2011 determined that the imidacloprid is present in most commonly bee-consumed nectar at 2.3 - 20 $\mu$M. He also estimated that the average realistic amount of imidacloprid in a nectar load is 0.024-0.3 ng. This is higher than the reported honeybee LC50 and LD50 values of 7.04 $\mu$M and 4.5 ng, respectively [@cresswell2011].
The concentration of neonicotinoids in soils with several years of history of treatment by seed coating were also investigated. Samples were collected 10 months after sowing [@botias2015] just before [@jones2014; @schaafsma2016] or after planting [@perre2015]. The average reported concentrations of neonicotinoids in the centre of the field are in the region of 20 $\mu$M, which is higher than the concentrations effective against earth worms and nematodes; the LC50 against the most susceptible species is 2.74 $\mu$M [@luo1999].
<!-- [@botias2015] -->
<!-- Selected 5 oilseed or wheat fields treated for at least three previous years with neonicotinoids. Soil samples were collected 10 months after sowing. The presence of neonicotinoids was detected using spectrometry. oilseed rape cropland : mean 3.46 ng / g of tmx, 13.28 clo, imc 3.03, thc 0.04 ng / g. -->
<!-- Margin : tmx 0.72 ng / g, clo 6.57, imc 1.92, thc $\le$ 0.01 and this is not significantly differen t from the margins of the wheat fields. -->
<!-- Based on laboratory conditions, half life of neonicotinoids is highly variable ranging from 8 days for nitenpyram to almost 7000 for clothianidin [reviewed in @bonmatin2015]. Several field studies were conducted to estimate dissipation time of neonicotinoids. @schaafsma2016 collected 18 Canadian and pre-planting soil samples over 2 successive years. These samples originated from variable-crop fields which had been treated for at least 4 successive years. Concentration of clothianidin and thiacloprid was measured in year 1 samples and averaged at 19.22 $\mu$M. Based on the history of crops planted and insecticide recharge regime, the degradation half-life (TD50) of clothianidin was estimated at 0.4 years 9 (146 days). It was also concluded that clothianidin and thiacloprid residues would accumulate for 3-4 years and plateau at ~ 23 $\mu$M in agricultural fields with one-year insecticide application routine. Using similar approach, @schaafsma2016 also estimated the DT50 of imidacloprid at 208 days. -->
<!-- Based on these data the average total neonicotinoid concentration is in the region of 20 $\mu$M. Therefore, average concentrations of neonicotinoids in the field are lower than doses causing worm lethality. However, higher concentrations of neonicotinoids may be experienced, particularly during the sowing period. -->
<!-- It is also probable that the concentration of neonicotinods is higher near the coated seed. The coating typically contains from 0.17 - 1 mg of the active ingredient [@goulson2013]. Up to 98 % of the active ingredient leaches into the environment [@goulson2014]. Therefore upper concentrations of environmental doses may have sublethal effect on soil inhabiting worms and nematodes. -->
### Sub-lethal effects of neonicotinoids on non-target species ###{#sublethal}
#### Insect pollinators ####{#sublethalbees}
Pollinating services are provided by many species of bees, flies, beetles and bats [@thapa2006]. Eightly percent of the total pollinating activity is carried out by bees [@thapa2006]. There are over 20 000 species of bees, 267 of each life in the UK [@breeze2012a]. Among them are honeybees (*Apis mellifera*, *A. mellifera*), bumblebees and over 220 species of solitary bees. Honeybees and bumblebees served as platform to determine toxic effect of neonicotinoids on biological pollinators. Although field realistic neonicotinoids are not expected to kill bees, a substantial body of evidence from lab- and field- based experiments suggest that they can impair on the cognitive function and reproduction of these biological pollinators.
##### Reduced olfactory learning and memory
Honeybees are social insects, living in colonies where a clear division of labor exists. Worker bees account for up to 95 % of the entire colony [@sagili2011]. These non-reproductive females are responsible for finding, collecting and transporting nectar or pollen from the flowering plants to the hive. Their ability to process, learn, memorise sensory cues and navigate through the environment is crucial for the survival and overall success of the entire hive. The olfactory learning can be measured with Proboscis Extension Reflex (PER) paradigm. PER conditioning is a process by which an insect learns to extend its tongue (proboscis) in response to olfactory stimuli, typically evoked by the sugar solution contacting the antenna [@takeda1961]. Alternatively, their olfactory learning capability can be measured by scoring various aspects of foraging behaviour. Bees exposed to 93 nM of imidacloprid in the sugar solution showed reduced ability to olfactory learn, as showed by the PER [@decourtye2004]. Imidacloprid also compromised foraging activity of honeybees [@decourtye2004; @gill2012] and bumblebees. 4- week exposure of early-developmental stages to imidacloprid at 23 nM in pollen reduced the foraging efficiency and duration [@gill2012]. Neonicotinoids also reduced the number of bees returning to hives. Increased home failure were noted in honeybees exposed to a single dose of thiamethoxam at 1.35 ng [@henry2012] and in bumblebees fed diet containing imidacloprid at 23 nM and 3 nM for 2 weeks [@feltham2014].
<!-- #### Learning and memory -->
<!-- Honeybees exposed to a , reduced Reducing homing rates were also noted in a study conducted by @schneider2012, where bees were exposed to clothianidin, thiamethoxam and imidacloprid at doses ranging from 0.05 ng/bee to 6 ng/bee. -->
<!-- <!-- Reduced response in conditioning assay was noted in honey bees treated with imidacloprid at 10 and 100 nM chronically (4 days), which were then allowed to recover for three days [@williamson2013]. -->
##### Impaired Reproduction
The reproduction of bees is performed by a single member of the colony - the queen. She lays fertilised and unfertilised eggs into cells of the comb. These eggs develop into larva, pupa and adult male drones and female workers. Neonicotinoids have been shown to negatively impact on various aspects of bees' fecundity. 14-days exposure of bumblebees to imidacloprid at 2, 4 and 23 nM, increased number of empty pupal cells [@whitehorn2012]. Imidacloprid has been shown to reduce the total size of treated colonies, reduce the brood production [@laycock2012] and the number of born queens [@whitehorn2012] and workers [@gill2012] of bumblebees. Exposure of drones to thiamethoxam at 15.5 nM and clothianidin at 6 nM led to shortening of life-spam and hindered sperm vitality and quantity [@straub2016]. Negative impact of neonicotinoids was also seen in the field-studies. Bumblebees foraging on oilseed rape coated with clothianidin, exhibited decreased queen production, colony growth and reduced bumblebee density [@rundlof2015]. More recently, international field studies confirmed negative effects of neonicotinoids on overwinter success and reproduction of honey and wild bees [@woodcock2017].
Insect pollinators play an important ecological, economical and evolutionary role. They pollinate wild plants [@kwak1998], food crops [@klein2007] and promote plant sexual reproduction [@gervasi2017]. The emerging evidence of the negative impact of neonicotinoids on bees and honeybees, restricted their use in Europe in 2013 [@eucomission2013] and is likely to lead to a complete ban of neonicotinoids in the future [@efsa2018].
#### soil worms ####{#sublethalsoilworm}
Soil worms includes segmented worms representing Phylum Annelida and the round worms from Nematoda phylum. The segmented worms include earth dwellers such as redworm *Eisenia fetida* and the common earthworm *Lumbricus terrestris*. All annelids are free-living. Nematodes on the other hand are classified as parasitic and non-parasitic. *C. elegans* is an example of a non-parasitic worm, which feeds on bacteria associated with rotting fruits or vegetables. Soil parasitic worms can be divided into those that infect plans or animals. They can cause large health, life-stock and agricultural loses. For example, *Melyidogyne* species including *Meloidogyne incognita*, account for 95 % of all plant infestation species and cause a loss of 5 % of global crops [@taylor1978] including loss tomatoes, cowpea and blackpepper.
To investigate the effects of neonicotinoids on soil dwellers, worms were exposed to various concentrations of drugs in solution, or in artificial soils. The concentrations effective against various behaviours and parameters such as fecundity, body weight, locomotion, sensory processing and burrowing were noted.
##### Earth worms
Clothianidin and thiacloprid at concentrations $\ge$ than 1.2 $\mu$M and the EC50 of 5.1 $\mu$M and 3.4 $\mu$M, respectively reduced the reproductive potential of redworm *E. fetida*, as measured by the cocoon production [@gomez-eyles2009]. Neonicotinoids showed a negative impact on the reproduction of other species, including *Lumbricus rubellus* (*L. rubellus*) [@baylay2012], *Dendrobaena octaedra* (*D. octaedra*) [@kreutzweiser2008] and *Eisenia andrei* [@alves2013]. Reduction of body weight of *E. fetida* and *D. octaedra* were observed after 14-day treatment with imidacloprid at 27.08 and 54.75 $\mu$M [@kreutzweiser2008]. Imidacloprid at 488.85 nM to 7.82 $\mu$M increased avoidance of *E. andrei* [@alves2013], whereas at 782 nM it reduced the *A. caliginosa* burrowing depth and length [@dittbrenner2011]. Burrowing of *L. terrestris* was also impacted, but at higher imidacloprid concentrations [@dittbrenner2011].
##### Soil nematodes
Neonicotinoids also induce a sublethal effect on the the free-living nematode *C. elegans*. Thiacloprid and imidacloprid have an effect on the reproduction of *C. elegans* with EC50 of 1.14 nM and 2.09 mM, respectively [@gomez-eyles2009]. Thiacloprid at 37 nM has an effect on chemosensing, whereas at 18 $\mu$M it impairs motility of this free living nematode [@hopewell2017]. Impaired motility of *C. elegans* in response to $\ge$ 120 $\mu$M imidacloprid was also recorded [@mugova2018]. Taken together, neonicotinoids have sublethal effects on earth worms and soil nematodes at concentrations as low as nM.
Most of the doses effective against worms are higher than the average doses of neonicotinoids in the field. However, the presence of clothianidin, imidacloprid and thiamethoxam has been detected at lower than average levels, such as 80.10 nM for imidacloprid, 23.01 nM for imidacloprid and 68.56 nM for thiamethoxam [@jones2014]. This suggests that the environmentally relevant concentrations of neonicotinoids may negatively impact on the the well-being of soil dwellers.
<!-- Data regarding toxicity of neonicotinoids on soil worms and nematodes focuses on earthworm *Eisenia fetida* (*E. fetida*, redworm). The toxicity is assessed either following treatment in solution or in the artificial soils. In solution, the LC50 of imidacloprid after 24 hour exposure is 62.08 $\mu$M [@luo1999]. This increases to 24.24 $\mu$M after 48 hour exposure [@luo1999]. Clothianidin is less potent; its LC50 after 14 days is 24.27 $\mu$M [@decant2010]. -->
#### Birds
Evidence suggests that environmental relevant concentrations of neonicotinoids may have negative effects on birds [@hallmann2014]. In particular, granivorous and insectivorous birds may be at risk, should they consume neonicotinoid-contaminated seeds and/or insects [@goulson2013]. Environmental neonicotinoids may impair their migratory ability [@eng2017] and negatively impact on their growth and reproduction [@sanchez-bayo2016].
The environmental ecotoxicity of neonicotinoids highlights the importance of selective toxicity of agrochemical compounds in successful pest management programmes. The development of new insecticides, effective against pest and not beneficial insects or other species requires a detailed knowledge of their mode of action.
## Neonicotinoids act on the cholinergic neurotransmission as a nicotine mimic
<!-- ### Nicotinic acetylcholine receptors -->
<!-- Name Cys-loop was devoted because all members contain a disulphide bond between cystines separated by a highly conserved sequence of 13 amino acids. Cys-loop receptors also share a common topology (Figure \@ref(fig:nachr-topology-label)): five receptor subunits arranged around the central pore. The five subunits can be the same, or different and form homo- or hetero-pentamers. -->
<!-- (ref:nachr-topology) **Topology of cys-loop receptors.** A single subunit of the cys-loop receptor consists of 4 transmembrane subunits (M1 - M4) and a conserved disulphide bridge in the N-terminal extracellular domain. 5 subunits come together to form a functional receptor (b). Receptors can be formed from either 5 identical (c) or from a combination of different subunits (d). -->
<!-- ```{r nachr-topology-label, fig.cap="(ref:nachr-topology)", echo=FALSE, fig.scap= 'Topology of cys-loop receptors.', fig.align='center', out.height = '80%', echo=FALSE} -->
<!-- knitr::include_graphics("fig/general_intro/png/nAChR_topology_3.png") -->
<!-- ``` -->
### nAChR structure ###{#structure}
nAChRs are members of the pentameric ligand-gated ion channels which are found in a diversity of species from bacteria to human. They are the representatives of the Cys-loop superfamily of channels which also include $\gamma$ -aminobutyric acid type A (GABA) receptors, 5-hydroxytryptamine type-3 receptors (5-HT3), and glycine receptors. Structural studies of the nAChRs from the muscle of the electric fish **Torpedo** (Figure \@ref(fig:structure-nachr-label)a) shed light on the the stoichiometry, the shape and the size of Cys-loop receptors.
The identity of the NMJ nAChR was first investigated using indirect, biochemical approaches. Membrane bound NMJ receptors were isolated by in-situ cross-linking with a radiolabelled antagonist and a subsequent purification. SDS-resolved fragments pattern suggesting the pentameric nature of these receptors [@hucho1986; @schiebler1980] of the total size 270 000 kDa composed of 4 different subunits namely $\alpha$, $\beta$, $\delta$ and $\gamma$ arranged into a pentamer. The SDS-PAGE pattern and the analysis of nAChR complexes purified with the use of non-denaturing buffer led to a suggestion that the stechiometry is: $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise) [@reynolds1978]. Heterologous expression in Xenopus oocytes confirmed that 4 subunits are needed to achieve expression. In the absence of any other one of the subunits, the responses to acetylcholine were either absent or greatly reduced, therefore 4 subunits are required for the normal function of this protein [@mishina1984].
The stiochiometry and structural details of muscle type nAChRs were confirmed by more direct structural approaches: cryo- and electron-microscopy. The receptor protein is in the shape of an elongated, 125 Å funnel [@unwin1993; @toyoshima1990]. It consists of large, extending to the synaptic space [@toyoshima1990] N-terminal ligand binding domain [@sigel1992], the membrane spanning pore-domain [@eisele1993], intracellular MA helix [@toyoshima1990; @unwin1993], and C-terminus positioned extracellularly. Constituting nAChR subunits are arranged pseudosymmetrically, around the central ion conduction pore [@brisson1985]. The subunit composition of the neuromuscular nAChR follows the strict order of $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise). Each subunit of the nAChR contains 4 transmembrane helices [@noda1982; @noda1983] named M1, M2, M3 and M4, as moving from N- to C- terminus. M1, M3 and M4 are exposed to the plasma membrane [@blanton1994], shielding M2, pore-forming helices [@imoto1986; @hucho1986] from the hydrophobic environment of the bilayer. As the outer helices progress from the outer to the inner leaflet of the membrane, they tilt inwards [@miyazawa2003], narrowing down the width of the channel. M2 on the other hand, bends roughly in the middle of the bilayer [@unwin1995], where it forms the most restricted part of the ion conductivity pathway. There are hydrophobic interactions between the outer helices, which stabilise the outer wall of the receptor and hence limit the conformational changes adopted by the inner helix. In contrast there are no extensive bonds between the inner and outer helices [@miyazawa2003]. As lining pore structures, the inner helix and flanking sequences contain molecular determinants for ion selectivity, permeability, the rate of conductance and gating. These were investigated by pharmacological, biochemical and electrophysiological approaches. [@imoto1988; @imoto1991; @konno1991] investigated the function of several rings of anionic and neutral amino acids with side chains facing towards each other in the centre of the pore. The so called intermediate ring (constituting of αE241 and equivalent) and the adjacent to $\alpha$ E241 in helical configuration central ring, (formed by $\alpha$ L244 and equivalent) form a narrow constriction of the ion pore, hence have the strongest effect on the conductance rate [@imoto1991; @imoto1988]. In addition, the negatively charged side chains of intermediate ring are crucial for ion selectivity [@konno1991]. The gating of the channel is governed by conserved leucine residues, slightly towards the extracellular side from the centre of the bilayer with side chains projecting inwards [@unwin1995], hence occluding the passage for ions.
<!-- ALSO TALK ABOUT THE NEGATIVELY CHARGED VESTIBULE HERE -->
(ref:structure-nachr) **Structural features of the nicotinic acetylcholine receptor.** Torpedo nAChR is a transmembrane protein, made up of 5 subunits (colour-coded), arranged around the ion conductivity pore. Each subunit consists of extracellular ligand-binding, transmembrane and intracellular domain (a) (PBD code:2BG9). Extracellular domain of a single subunit consists of 10 $\beta$-strands and N-terminal $\alpha$-helix. It contains a disulphide bridge between Cys192 and Cys193 (highlighted in yellow) (b). Fully formed receptors have five ligand binding pockets formed by the contributions from the neighboring subunits (A-B, B-C, C-D, D-E and E-A), named the principle and the adjacent components, respectively. Top view of the molluscan AChBP (PDB:1I9B) with amino acids forming the agonist binding site in ball and stick representation (c). Images generated with the UCSF Chimera software.
```{r structure-nachr-label, fig.cap="(ref:structure-nachr)", fig.scap='Structural features of the nicotinic acetylcholine receptor.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/crystal_structure_nachr.png")
```
### Model of the binding site
Determination of the crystal structure of the molluscan acetylcholine binding protein [@brejc2001, Figure \@ref(fig:binding-pocket-label)b and c)] provided a platform to study the ligand binding domain of nAChRs. Acetylcholine binding protein (AChBP) is a soluble protein, secreted by snail glial cells into the cholinergic synapses to bind released ACh and modulate neurotransmission [@sixma2003]. It shares 24 % sequence identity with mammalian $\alpha7$ homopentameric receptor. It is has similar structure to the extracellular domain of the nAChRs mammalian $\alpha1$ [@dellisanti2007] and $alpha7$ [@li2011]. It is a homopentamer with N-terminal helix and 10 $\beta$sheets. It also shares similar pharmacological properties to this receptor. AChBP binds to classical nAChR agonist and antagonists: nicotine, acetylcholine and $\alpha$-bungarotoxin [@smit2001]. Therefore AChBP is considered a good model for the nAChR ligand-binding domain structural studies. The structures of AChBP inactive [@brejc2001], bound to agonist and antagonist [@celie2004; @hansen2005], chimera $\alpha1$ [@dellisanti2007] and $\alpha7$ are known [@li2011]. The common structural features of the ligand binding site emerge from all available data. Here data from the great pond snail *Lymnaea stagnalis* (Ls) will be discussed.
<!-- (it unlike Ac, all aromatic residues in Ls are conserved). -->
### Agonist binding site ###{#bindingsite}
The nicotinic acetylcholine receptor binding pocket is formed on the interface of the adjacent subunits [@brejc2001; @middleton1991; @blount1989, Figure \@ref(fig:binding-pocket-label)]. In case of the neuromuscular heteropentameric receptors, it constitutes of $\alpha$ and non-$\alpha$ subunit contributions, whereas in homopentameric or $\alpha$ heteropentameric receptors it is made up of neighboring subunits. The principal, $\alpha$-subunit site subsides amino acid side chains originating from discontinuous loops A (loop $\beta4$-$\beta5$), B (loop $\beta7$-$\beta8$) and C (loop $\beta9$-$\beta10$), whereas the complementary (non-$\alpha$) subunit contributes amino acid side chains originated from loop D (loop $\beta2$-$\beta3$), E (loop $\beta5$-$\beta6$) and F (loop $\beta8$-$\beta9$). Specific residues involved in the formation of the ligand binding pocket were depicted by the molluscan AChBP (Figure \@ref(fig:binding-pocket-label)). Amino acids of the principal component are: Tyr93, Trp147, Tyr188 and Tyr195, whereas non-$\alpha$ component contributes Trp53, Gln55, Arg104, Val106, Leu112 and Met114, Tyr164.
(ref:binding-pocket) **The ligand binding domain of acetylcholine binding protein.** Agonist binds to the loops situated in the adjecent subunits of the nAChR. In muscle type receptor, there are 2 binding sites, and thee are 5 in homopentameric receptor (a). The ligand binding pocket of the AChBP (PDB:1I9B) is formed from loops of the neighboring subunit (b). Principal and complementary subunits contributed amino acids from loops A, B, C and D, E, F, respectively (c). Crystal structure of the AChBP generated with the USCF Chimera software.
```{r binding-pocket-label, fig.cap="(ref:binding-pocket)", fig.scap='The ligand binding domain of acetylcholine binding protein.', fig.align='center', echo = FALSE}
knitr::include_graphics("fig/general_intro/png/binding_pocket_3.png")
```
### Agonist pharmacophore ####{#pharmacophore}
Crystal structure of the AChBP bound to acetylcholine, carbamylcholine, nicotine [@celie2004] and its analogue epibatidine [@hansen2005] provided some general features of the nAChR binding pocket. More recently, structures of mammalian receptors: $\alpha9$ [@zouridakis2014] bound to methyllycaconitine, the artificially expressed $\alpha2$ extracellular domain bound to epibatidine [@kouvatsos2016] and $\alpha4\beta2$ receptor bound to nicotine [@morales-perez2016] have been obtained. These structures provide details of how structurally varied agonists bind to nAChRs.
Agonist are buried on the interface of the neighboring subunits. They are stabilised in the binding pocket by 5 conserved aromatic residues from A, B and C loops of the principal site (known as the aromatic box), which engulf the cationic atom of the quaternary ammonium atom of the of bound agonist. There are two major and conserved features: cation - $\pi$ interaction and hydrogen bond.
Cation -$\pi$ interactions are formed between the cationic nitrogen and aromatic side chain of tryptophan in loop B (143 in AChBP) of the principal side of the binding pocket. Whereas hydrogen bond is formed between the bond acceptor and amino acids of the complementary side of the binding pocket via water molecule [@celie2004; @olsen2014]. In ACh and nicotine bound to AChBP structures, water bridges to the oxygen of the carbonyl group of Leu112 and amide group of Met114 in loop E [@olsen2014; @celie2004].
Choline is an agonist lacking the hydrogen bond acceptor, which is likely contributing to its lower efficacy and affinity. Heterologously expressed $\alpha7$ are activated with choline with the EC50 between 0.4 and 1.6 mM, whereas the EC50 of nicotine is between 49 and 113 $\mu$M [@wonnacott2007]. Radiolabelled studies report up to 500 times lower binding affinity of choline in comparison to nicotine [@wonnacott2007].
Cation-$\pi$ interactions and a hydrogen bond are the staple features of the ligand-receptor interactions, however there are also some less conserved characteristics. For example, in AChBP-nicotine structures, there is a hydrogen bond between cationic nitrogen of the agonist and the carbonyl of TrpB in the principal site of the receptor [@celie2004]. Similarly, in human $\alpha2$ structures a hydrogen bond between the cationic nitrogen of apibatidine and carbonyl of TrpB or Tyr in loop A is formed [@kouvatsos2016]. In contrast, cationic nitrogen of ACh forms cation-pi with Trp53 in loop D of AChBP and $\alpha2\beta2$ proteins [@morales-perez2016; @olsen2014].
(ref:pharmacophore) **Nicotinic acetylcholine receptor agonist pharmacophore.** Agonists of the nAChRs contain hydrogen bond acceptor (red) and cationic nitrogen (blue) (a). Interactions with the receptor based on the crystal structure of the AChBP and nicotine (PB:1UW6) (b). b is taken from @blum2010. Cation-$\pi$ interactions between protonated nitrogen of tertiary amine and indole of TrpB.
```{r pharmacophore-label, fig.cap="(ref:pharmacophore)", fig.scap='Nicotinic acetylcholine receptor agonist pharmacophore.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/nicotinic_interactions.png")
```
### Neonicotinoid-pharmacophore
Structure of AChBP proved to be valuable in determining structural elements which may account for neonicotinoids’ selectivity. @ihara2008; @talley2008; @ihara2014 derived crystal structures of the great pond snail (Lymnaea stagnalis, Ls) and California sea slug (Aplysia californica, Ac) AChBP complexed with bound neonicotinoids (imidacloprid, clothianidin, thiacloprid), and non-selective nAChR ligands- nicotinoids (nicotine, epibatidine and desmotroimidacloprid). Comparison of these structures revealed differences in binding modes between nicotinoids and neonicotinoids (see Appendix \@ref(fig:pharacophore-seq-label) for sequence alignment), which allowed for predictions of the binding interactions between neonicotinoids and insect receptors (Figure \@ref(fig:imi-binding-label)).
Structures of wild-type and mutant AChBP with increased affinity to neonicotinoids revealed no differences in the interactions between imidacloprid, clothianidin and thiacloprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2008; @talley2008; @matsuda2009; @ihara2015]. Thus, to describe the differences between neonicotinoids and nicotinoids, crystal structures of Ls AChBP complexed with nicotine and imidacloprid are compared (Figure \@ref(fig:imi-binding-label)). The positioning of the pyridine ring of imidacloprid and nicotine is virtually identical. The nitrogen forms identical interactions: hydrogen bond with the amide group of Met114 and carbonyl group of Leu102 of loop E, via water molecule [@@celie2004; @ihara2008; @talley2008]. In addition, chlorine atom of imidacloprid makes van der Waals interactions with oxygen of Ile106 and oxygen of Met116 of AChBP [@talley2008].
Regarding 5-membered ring interactions, in nicotine-bound structures, the cationic nitrogen forms 3 interactions when bound to AChBP: the cation-$\pi$ with the ring of Trp143 (TrpB), as well as hydrogen bond with the backbone carbonyl of TrpB [@celie2004], as well as the cation-$\pi$ interaction with Tyr192 in loop A [@matsuda2009]. In imidacloprid bound structures, the ring stacks with aromatic residue Tyr185 of loop C (this interaction is also seen in epibatidine-bound structures) [@ihara2008]. These stacking interactions result in the formation of CH-$\pi$ interactions between the methyline bridge (CH2-CH2) of imidacloprid and TrpB. All residues described so far are conserved in other agonist-bound nAChR structures, therefore do not account for neonicotinoids-selectivity.
The differences come to light when one begins to dissect the interactions between imidacloprid ring substituents and the AChBP. Partially positive nitro group (NO2) of imidacloprid bridges to glutamine of loop D (Gln55) via hydrogen bond. This interaction was also seen in thiacloprid bound AChBP and in the Gln55Arg mutant of AChBP bound to clothiandin [@ihara2014]. It is interesting that in some nAChR subunits, such as chicken $\alpha2$, honeybee $\alpha6$, $\alpha7$, $\beta1$ and $\beta2$, glutamine corresponds to basic residue (lysine/arginine). Basic residues electrostatically attract nitro group, possibly forming a hydrogen bond, which in turn would strengthen the stacking and aromatic CH/$\pi$ hydrogen bond interactions between the ring and the protein. In contrast, other subunits contain either acidic or polar amino acids in the exact position, repulsing or forming no electrostatic interactions with imidacloprid.
(ref:imi-binding) **Residues forming interactions with nicotine and neonicotinoids in the binding site of AChBP**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with nicotine and imidacloprid.
```{r imi-binding-label, fig.cap="(ref:imi-binding)", fig.scap= "Residues forming interactions with nicotine and neonicotinoids in the binding site of AChBP", fig.align='center', out.height="70%", echo=FALSE}
knitr::include_graphics("fig/general_intro/png/nicotine_imidacloprid_structure.png")
```
Analysis of the structure of Gln55Arg AChBP mutant complexed with neonicotinoids revealed another residues with a potential to confer high binding affinity of these compounds. Basic residue of loop G, namely Lys34, forms electrostatic interaction with the NO2 group of clothianidin and CN group of thiacloprid, but does not interact with imidalcoprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2014].
(ref:all-neonics-binding) **Residues forming interactions with neonicotinoids in the binding site of AChBP**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with imidacloprid, thiacloprid, thiacloprid and nitenpyram. For nitenpyram, the interactions are predicted based on other structures.
```{r all-neonics-binding-label, fig.cap="(ref:all-neonics-binding)", fig.scap="Residues forming interactions with neonicotinoids in the binding site of AChBP", fig.align='center', echo = FALSE, }
knitr::include_graphics("fig/general_intro/png/binding_all_neonics.png")
```
#### Neoniotinoid-selectivity
Based on the structural data, it has been proposed that the basic residue in loop D and G interacting with the nitro or cyano group of neonicotinoids is important in confirming neonicotinoid selectivity in insect nAChR subunits. This is supported by the genetic studies. Loop D arginine to threonine mutation naturally occurring in $\beta1$ subunit of peach aphid *Myzus persicae*, and cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017; @bass2011] gives rise to neonicotinoid resistance. Additionally, @shimomura2002 showed that mutation of glutamine in loop D of human $\alpha7$ to basic residue, markedly increases sensitivity of the $\alpha7$ homopentamer to nitro-containing neonicotinoids, whereas mutation of loop D threonine to acidic residues in chicken $\alpha4\beta2$ and hybrid chicken/Drosophila $\alpha2\beta2$ receptor had an opposite effect [@shimomura2006]. Interestingly, described mutations did not influence the efficacy to nicotinoids, suggesting this interaction is specific to neonicotinoids. In addition, double mutant of avian $\alpha7$ nAChR in which equivalent of Gln55 and were mutated to basic residues showes increased binding affinity of thiacloprid and clothianidin, but not nicotine or acetylcholine [@ihara2014], providing further evidence that these residues are important in confering high binding affinity of neonicotinoids.
Genetic studies identified other amino acids with a potential importance in confering neonicotinoid-selectivity. Imidacloprid-resistant strain of *Nilaparvata lugens* has been found to have Y151S mutation in loop B of $\alpha1$ and $\alpha3$ nAChR subunits [@liu2005]. This residue corresponds to LsAChBP H145 of the loop B.
Loop B, D and G originate from the complementary site, but the principal site may also play a role. Studies on Drosophila/chicken $\alpha2\beta2$ hybrid and chicken $\alpha2\beta4$ receptors showed that the presence of nonpolar proline in YXCC motif of loop C enhances affinity, whereas mutation of proline to glutamate markedly reduces affinity of neonicotinoids to these receptors [@shimomura2005]. The importance of C-loop regions was also demonstrated by @meng2015 who showed that chimera receptors are deferentially sensitive to imidacloprid at least partly due to the difference in loop C region, equivalent to Ls184-191.
### Cholinergic neurotransmission
<!-- Upon arrival of an electrical signal at the presynpatic terminal, acetylcholine is released into the synaptic cleft. It then binds to nicotinic acetylcholine receptors (nAChRs) expressed at the post-synpatic membrane. Binding of acetylcholine results in depolarisation and excitation of the post-synaptic neurons, or muscle contraction at the neuromusclular junction (NMJ) [@hille1978]. Acetylcholine can also act on other class of receptors, the metabotropic cholinergic G-protein coupled receptor, which are involved in the modulatation of neurotransmission release. The acetylcholine-evoked signal is terminated mainly by synaptic enzyme cholinesterase which hydrolyses acetylcholine to choline and acetate [@fukuto1990], but also by choline uptake to the presynaptic cell by Na^+^-choline transporter. -->
Cholinergic neurotransmission is the process of signal propagation between neurons as well as neurons and muscle cells mediated by a neurotransmitter acetylcholine (ACh) (Figure \@ref(fig:cholineric-synapse-label)) [@williamson2009], via nAChRs. The function and properties of these receptors were studied using mammalian and amphibian muscle preparations.
In 1930s, @brown1936; @bacq1937 demonstrated that the application of acetylcholine, as well as nicotine and choline to the isolated mammalian muscle leads to sustained contraction, as showed by the increase in the muscle tension. The muscle contraction was associated with an increase in the frequency of the action potential firings [@brown1936] and the depolarisation of the end-plate [@katz1957]. Acetylcholine-evoked responses could be inhibited by pre-incubation with several compounds, including snake venom proteins, $\alpha$-bungarotoxin [@chang1963].
Prolonged exposure to high concentration of agonist has a secondary effects on the muscle: desensitisation [@katz1957]. Desensitisation is a post-contraction period, after the removal of the agonist, at which the muscle is relaxed and a subsequent contraction cannot be elicited [@thesleft1955]. Recovery from desensitisation typically lasts few seconds after the agonist removal [@bouzat2008], however the duration varies depending on the receptor, the compound [@briggs1998] and its concentration [@gerzanich1994]. Full recovery may not occur or may be slower if the receptor are exposed to the large doses of agonist for a prolonged time [@katz1957].
Biochemical, electrophysiological, genetic and pharmacological approaches were utilised to identify the role of nAChRs in neurotransmission. nAChRs were solubilised and purified from the electric organ of the *Torpedo* and reconstituted into liposomes [@anholt1982]. In the presence of acetylcholine and other agonists, the ionic current was elicited, confirming nAChR is an ion channel [@anholt1982]. Acetylcholine evoked activation ans desensitisation of nAChRs, which correspond to the effects in the muscle, provided evidence that nAChRs mediate fast synaptic transmission at the cholinergic synapse.
Kinetic properties of nAChRs were studies with the patch clamp technique. Patch clamp is a technique which enables for the resolution of agonist-evoked responses at a single receptor level [@colquhoun1981; @colquhoun1985]. In response to acetylcholine the channel switches between active and inactive form, with the active form interrupted by the short-lived channel closing bursts. Temporal characterisation revealed the average duration of each event. The receptor remains opened for 1.4 ms; this is interrupted by channel closing bursts of 20 $\mu$s which occur at a frequency of 1.9 closures/opening burst. The mean period between the successive channel openings is 342 ms. Further experiments provided the showed that channel opening is not an all or nothing event. Instead, a channel exhibits multiple conductance states, one on which it is fully opened, named a full conductance state (i.e. the active form), and one in which the channel is partially opened, named the sub-conductance state [@colquhoun1985]. The fine structure of full conductance states (or opening bursts) and sub-conductance states varies depending on the agonist used and a receptor protein [@colquhoun1985; @nagata1996; @nagata1998].
(ref:cholineric-synapse) **Chemical transmission at the cholinergic synapse.** Upon excitation of the presynaptic neuron (1), synaptic vesicles fuse with the membrane, releasing neurotransmitter (2). Neurotransmitter binds to the ligand-gated ion channel (LGIC) expressed on the post-synaptic membrane (3) leading to opening of ion channels and a flux of ions down their electrochemical gradient (4). This leads to either excitation or inhibition of the post-synaptic neuron (5). The signal is terminated by the action of cholinesterase which cleaves the ACh into choline and acetic acid. Choline is then transported back into the synapse and used to make more ACh.
```{r cholineric-synapse-label, fig.cap="(ref:cholineric-synapse)", echo=FALSE, fig.scap= 'Chemical transmission at the cholinergic synapse.', fig.align='center', out.height = '60%', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/synapse_general_2.png")
```
<!-- This phenomenon is due to the distinct conformation of nAChRs, at in which they are not capable of ion conduction [@nemecz2016]. -->
<!-- In the continual presence of agonist, the membrane potential gradually repolarises until it reaches the resting state, hovewer the next depolarisation will not occur, until the agonist are washed off and the receptor recovers from desensitisation [@katz1957]. -->
<!-- Development of molecular cloning technique enabled for expression and kinetic characterisation of nAChRs. In 1985, @mishina1984 generated DNA constructs containing cDNA sequences encoding for the muscle type nAChR. These sequences were injected into the *Xenopus oocytes* [@mishina1984]. Upon application of acetylcholine, a current was recorded, suggesting successful cell surface expression. Single channel recordings revealed that in the presence of agonist, nAChR channel switches between active and inactive form. The active form comprises short-lived channel closing and opening [@mishina1986] and longer pauses in-between the receptor twitching. In addition, channel opening does not seem to be an all or nothing event. Instead, a channel exhibits multiple conductance states, one on which it is fully opened, named a full conductance state, and on in which the channel is partially opened, names sub-conductance state [@nagata1996; @nagata1998]. -->
<!-- Intracellulal recordings have shown that this is not due to the muscle cell itself, but rather the insensiticity of membrane receptors [@thesleft1955]. -->
<!-- $\alpha$-bungarotoxin ($\alpha$-bgtx), is a 74-amino acid long, 8 kDa proteins isolated from the venom of a snake *Bungarus multicinctus*. It binds with high affinity to the NMJ post-synaptic membranes [@lee1967] and blocks synaptic responses evoked by acetylcholine and other agonists [@chang1963] by blocking the access of an agoinist to the nAChR binging site [@@mishina1984]. -->
## Biological relevance of the cholinergic neurotransmission ##{#insectachtransmission}
Acetylcholine is the main neurotransmitter in the nervous system of insects [@florey1963]. Its action is mediated predominately by nAChRs, which are the main cholinergic receptor type in their central nervous system [@breer1987]. The presence of nAChR in various brain regions has been detected using biochemical and electrophysiological techniques on neuronal preparations extracted from the Fruit fly *Drosophila melanogaster*, honey bee *Apis mellifera* and American cocroach *Periplaneia americana*. nAChRs have been found to be expressed in the regions associated with learning, formation of memory and the sensory processing [@heisenberg1998], namely the muschroom bodies [@kreissl1989; @gu2006; @oleskevich1999]. They are also present in the insect ganglia, which connects the brain to the peripheral nervous system. In particular, they were identified in the abdominal, thoracic and the terminal ganglia [@sattelle1981; @bai1992], which are involved in the movement of wings, abdomen and legs, as well as the regulation of the anal and reproductive muscles [@smarandache-wellmann2016]. In contrast to mammals and invertebrates (Table \@ref(tab:chlinergic-nts)), insects do not express nAChRs at the neuromuscular junction.
### Biological role of nAChRs in insects
Insect nAChRs are widely expressed in the insect nervous system, where they mediate fast synaptic transmission. Their involvement in the regulation of diverse biological processes is evident from toxicity studies during which insects were exposed to nAChR agonists.
Nicotine is a naturally occurring alkaloid found in the *Solanaceae* family of plants, including tobacco [@steppuhn2004]. It is effective against plant insect pests [@david1953], and used in organic farming in form of tobacco tea [@isman2006]. Exposure of insects to lethal dose of nicotine results in symptoms characteristic for the nervous system intoxication [@chadwick1947] and include increased locomotory activity, followed by convulsions, twitching and eventual death [@carlile2006].
### Neonicotinoids target nAChRs ### {#neonicstarget}
#### Electrophysiological evidence ####{#electrophysevidence}
The effects of neonicotinoids on the neuronal transmission was investigated on insect neuronal preparations which express high levels of nAChRs.
@sone1994 investigated the effects of imidacloprid on the neuronal activity at the thoracic ganglia of male adult American cockroaches, *Periplaneta americana* using extracurricular recordings. This method allows for a record of changes in spontaneous neuronal activity in response to mechanical or pharmacological interventions. At a very low concentration of 1 nM, imidacloprid induced a sustained for over 2 minutes increase in the rate of neuronal firing. At concentrations ranging from 10 nM to 100 $\mu$M, the following sequence of events was noted: an increase of the rate of spontaneous action potentials of neurons followed by a gradual decline, leading to a complete block of neuronal activity [@sone1994]. Imidacloprid had the same effect on various insect preparations including thoracic ganglion of the Leptinotarsa decemlineata [@tan2008] and on the abdominal ganglion of *Periplaneta americana* [@buckingham1997]. The same observations were made for other neonicotinoids [@thany2009; @schroeder1984]. This provided evidence that neonicotinoids stimulate the nervous system of insects. This conclusion was supported by the behavioural observation, whereby the neonicotinoid intoxication mirrors intoxication seen with cholinergic agents (Section . In response to imidacloprid, insects become hyper excited as evident by excessive pacing. They then collapse and exhibit diminishing uncoordinated leg and abdomen movement until eventual death [@sone1994; @elbart1997; @suchail2001]. Sub-lethal doses (i.e. < 4 nM) have distinct effect, such as an inhibition of feeding leading to starvation [@nauen1995; @elbart1997].
@sattelle1989 used isolated cocroach neuronal preparation to record post-synaptic intracellular currents in response to neonicotinoid prototype 2(nitromethylene) tetrahydro-1, 3-thiazine (NMTHT). NMTHT depolarised the post-synaptic unpaired median neurons and the cell body of motor neurons of the abdominal ganglion. Agriculturally relevant neonicotinoids had the same effect on the post-synaptic membranes in the isolated cocroach thoracic ganglia [@tan2007; @thany2009] potato beetle isolated thoracic ganglion [@tan2008], terminal abdominal ganglion of the americal cocroach [@ihara2006] and in the honeybee [@palmer2013] and fruit fly [@brown2006] neurons.
Pharmacological characterisation of neonicotinoids-induced currents provided further evidence for their mode of action. The inward current elicited by neonicotinoids were dose-dependent, whereby the higher the concentration, the grater the depolarisation. EC50 values (concentrations at which the half of the maximum current was observed) are in the region of 1 - 5 $\mu$M [@thany2009; @tan2007]. Such low values indicate highly potent action of neonicotinoids on insects, in agreement with toxicological data (Section \@ref(potentpests)). Neonicotinoid-induced currents were reminiscent of those induced by acetylcholine and nicotine, and were prevented by the application of nAChRs antagonists ($\alpha$-bungarotoxin, methyllycaconitine, mecamylamine or d-tubocurarine) not by muscarinic receptor antagonists (atropine, pirenzepine), suggesting neonicotinoid-induced currents are due to the activation of nicotinic receptors.
#### Biochemical evidence
@tomizawa1996 developed neonicotinoid agarose affinity column to isolate proteins with high binding affinity to neonicotinoids. Using Drosophila and Musca head membrane preparations, he identified three nAChR subunits as potential neonicotinoid-targets.
##### Ligand binding studies #####{#ligbinding}
The binding affinity of imidacloprid to nAChRs expressed in insect membrane homogenates was assessed in the saturation ligand binding studies.
In the saturation binding experiment, various concentration of the labelled ligand is added to the preparation and the concentration of the ligand at the equilibrium is determined. This is then used to derive the binding constant (as a measure of dissociation constant, Kd). Here, it was used to define the binding strength of neonicoinoids to insect nAChRs (Table \@ref(tab:bindignrecombinant)).
Imidacloprid and thiamethoxam bind with high affinity to proteins in the whole membrane preparations of the domestic fly and aphids with the Kd in the low nM range [@liu1993; @wellmann2004; @liu2005]. Interestingly, two binding affinities have been derived from the imidacloprid study in the brown planthopper and pea aphid [@wellmann2004; @taillebois2014] suggesting there are two binding sites in these animals.
The binding affinity of neonicotinoids-related compounds was compared to the insecticidal activity; the correlative relationship between the two was found [@kagabu2002; @liu2005], providing further evidence that neonicotinoids act by targeting nAChRs.
```{r potencyintact, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
potencyintact <- data.frame(
Compound = c("Imidacloprid", "Imidacloprid", "Imidacloprid", "Imidacloprid", "", "Imidacloprid", "", "Thiamethoxam"),
Species = c("Musca domestica", "Aphis craccivora", "Myzus persicae", "Nilaparvata lugens", "", "Acyrthosiphon pisum", "", "Myzus persicae"),
Common = c("domestic fly", "cowpea aphid", "green peach aphid", "brown plantohopper", "", "pea aphid", "", "green peach aphid"),
Kd = c("1.2", "12.3", "4.1", "<0.01", "1.5", "0.008", "0.002", "15.4"),
References = c("Liu et al. 1993", "Wellmann et al. 2004", "", "Liu et al. 2005", "", "Taillebois et al. 2014", "", "Wellmann et al. 2004"))
potencyintact %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Compound", "Species", "Common\nname", "Kd\n(nM)", "References")),
caption = 'Binding affinity of neonicotinoids') %>%
kable_styling(position = "left", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", "Binding affinity measured in the whole membrane or head membrane (Musca domestica experiment)",
threeparttable = T)
```
In addition to the saturation studies, the competitive ligand binding studies were carried out. In the the competitive ligand binding studies, biological preparation is incubated with radiolabelled ligand. The ability of various concentrations of unlabeled ligand is measured to define its equilibrium inhibition constant (Ki). This method informs both on the affinity and on the interactions between ligands.
Various concentrations of neonicotinoid prototype isothiaocynate were incubated with the homogenate of fruit fly *Drosophila melanogaster* and a homogenate of the abdominal nerve cords of *Periplaneta americana* before the exposure to radiolabelled nAChR antagonist $\alpha$-bgtx [@gepner1978]. Isothiaocynate inhibited binding of $\alpha$-bgtx in the concentration dependent manner [@gepner1978], suggesting the two compounds share the binding site. Similarly, imidacloprid has been shown to displace $\alpha$-bgtx from brain membrane preparations from honey bee *Apis mellifera* [@tomizawa1992; @tomizawa1993], *Drosophila melanogaster* [@zhang2004], house fly *Musca domestica* and isolated cockroach nerve cords [@bai1991].
#### Genetic evidence ####{#resgenevidence}
Resistance to neonicotinoids arises from mutations in nAChR subunits. Field isolates of peach aphid *Myzus persicae* [@bass2011], the cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017] and the Colorado potato beetle *Leptinotarsa decemlineata* [@szendrei2012], as well as lab-isolates of brown planthopper, *Nilaparvata lugens* [@liu2005], fruit fly *Drosophila melanogaster* [@perry2008] with decreased sensitivity to neonicotinoids have been identified. Behavioral analysis shows that their sensitivity is up to 1500-fold lower in comparison to the reference strains, as shown by the shift in LD50. Analysis of the coding genome of the resistant strains identified mutations in nAChR subunit coding sequence [@bass2011; @perry2008; @hirata2015].
### Mode of action of neonicotinoids ###{#moaneonicsinsects}
Neonicotinoids can have diverse mode of action. The currents produced by neonicotinoids and ACh on cultured or isolated insect neuronal preparation were compared. Neonicotinoids evoking current lower than that evoked by ACh were classed as partial agonists, those eliciting similar response were classed as true agonists, whereas those more efficacious than ACh, super-agonists. Thiacloprid and imidacloprid are partial agonists, nitenpyram, clothianidin, acetamiprid and dinotefuran are true agonists, whereas thiamethoxam has no effect on the isolated American cockroach thoracic ganglion neurons [@tan2007]. This differs from the mode of action of neonicotinoids on cultured terminal abdominal ganglion neurons of this insect. Currents produced by all neonicotinoids tested was lower than that evoked by ACh [@ihara2006], suggesting they are all partial agonists on these cells. The mode of action of neonicotinoids on the fruit fly [@brown2006] and honey bee neurons [@palmer2013] differs still, implying the presence of distinct nAChRs in different insect species and neuronal preparations.
<!-- cultured Drosophila CNS cholinergic neurons, whereas imidacloprid is a partial agonist there . -->
<!-- Clothianidin and imidacloprid are partial and full, agonist, respectively on the isolated Kenyon cells of the honeybee . In addition imidacloprid, and imidacloprid but not other neonicotinoids tested blocked ACh-induced action on the American cockroach neurons [@ihara2006] and isolated honeybee neurons [@palmer2013], suggesting antagonistic capabilities of these compounds. -->
<!-- Single channel recordings provided mechanistic details of the mode of action of these compounds. Super-agonists have been shown to increased the frequency of larger conductance state openings [@jones2007a], whereas partial agonists increase the activity of the sub- conductance state of nAChRs [@nagata1996; @nagata1998]. -->
<!-- Note that neonicotinoids cause depolarizing block by desensitising receptors [@palmer2012]. -->
<!-- In cultured honeybee mushroom bodies, imidacloprid acts at nM concentrations [@palmer2013]. In the bee Kenyon cells, the EC50 of imidacloprid was 25 $\mu$M [@deglise2002], whereas on the antenna lobe cells 0.87 $\mu$M [@nauen2001]. Similarly, the EC50 of imidacloprid on isolated cockroach neurons [@tan2007; @ihara2006] and in Drosophila CNS neurons [@brown2006] were in a single digit $\mu$M range. -->
<!-- Neonicotinoids are less potent on vertebrate receptors. EC50 of clothianidin and imidacloprid on heterologously expressed human $\alpha7$ nAChRs is 0.74 mM and 0.73 mM, respectively [@cartereau2018]. Whereas the EC50 of imidacloprid on heterogouslty expressed chicken $\alpha7$ is 357 $\mu$M [@ihara2003]. Other vertebral receptors may be more susceptible. Two-digit $\mu$M imidacloprid doses were needed to activate nAChRs in mammalian neurons [@bal2010; @nagata1998], and the EC50 of this compound on cells containing native mammalian $alpha4\beta2$ nAChRs is 70 $\mu$M [@tomizawa2000a]. Higher EC50 of neonicotinoids on vertebrate receptors suggests neonicotinoids bind preferentially to the insect nAChR. This supports the toxicological data demonstrating increased toxicity of neonicotinoids on insects versus vertebrate species (Section \@ref(nontargeteffect)). -->
<!-- In addition, nAChR-like current was evoked in Xenopus oocytes transfected with membrane preparations of pea aphid *Acyrthosiphon pisum* in response to clothianidin, acetylcholine and nicotine [@crespin2016]. -->
<!-- nAChRs are expressed pre-, post- synaptically at the cell body, as determined mainly with electrophysiological approaches, whereby upon application of classical agonists (Section \@ref(pharma-generalintro)), nAChR-like currents were elicited from various parts of neuronal preparations. The agonist-induced currents were blocked with nAChR antagonists. The presence of nAChRs in the Fruit fly *Drosophila melanogaster* (refereed to as Drosophila, in short) Kenyon cells was shown by recording spontaneous and nicotine or acetylcholine-evoked post-synaptic currents of neurons. These responses were blocked by selective nAChR antagonists $\alpha$-Bgtx [@gu2006]. nAChR are also expressed in the postsynapatic neurons of the honeybee mushroom bodies based on the antibody staining against the nAChR as well as staining with labelled $\alpha$-Bgtx [@kreissl1989]. In addition, mushroom bodies produced a nAChR-like current in response to nicotine and ACh, and it was blocked by $\alpha$-Bgtx [@oleskevich1999]. In cocroach, cell bodies in the thoracic ganglion depolarised in the presence of nicotine and was blocked by selective antagonist mecamylamine [@bai1992]. -->
```{r chlinergic-nts, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
footnote1 <- "NT = neurotransmitter, NMJ = neuromuscular junction"
footnote2 <- "References: 1 = Chen and Patrick 1997, 2 = Araujo et al. 1988, 3 = Couturier et al. 1990; Cooper et al. 1991, 4 = Lee et al. 1967; 5 = Brown et al. 1936, 6 = Mishina et al. 1986, 7 = Zirger et al. 2003, 8 = Mongeon et al. 2011, 9 = Lewis et al. 1987, 10 = Treinin et al. 1998, 11 = Richmond and Jorgensen 1999; 12 = Boulin et al. 2008, 13 = Touroutine et al. 2005, 14 = McKay et al. 2004"
library(kableExtra)
library(dplyr)
cholnts <- data.frame(
Species = c("Mouse", "D. melanogaster", "D. rerio", "C. elegans", "A. mellifera"),
Localisation = c("Nervous system\nNMJ", "Nervous system", "Nervous system\nNMJ", "Nervous system\nNMJ", "Nervous system"),
Function = c("NT release modulation\nMuscle contraction", "Major NT", "NT release modulator\nMuscle contraction", "Major NT\nMuscle contraction", "Major NT"),
Major = c("$\\alpha4\\beta2$ and $\\alpha7$\n$\\alpha1\\beta1\\epsilon\\delta$", "?", "$\\alpha4\\beta2$ and $\\alpha7$\n$\\alpha1\\beta1\\epsilon\\delta$", "DES-2/DEG-3\nL-type, N-type and EAT-2 containing", "?"),
Ref = c("1-3\n4-6", "in-text", "7\n8", "9, 10\n11-14", "in-text"))
cholnts %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Species", "Localisation", "Function", "Major\nreceptor", "Ref")),
caption = 'Cholinergic neurotransmission',
) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", c(footnote1, footnote2),
threeparttable = T)
```
### nAChR subunits in insects ###{#expressionfail}
nAChR are assemblies of 5 different or identical receptor subunits (Section \@ref(structure)). Each subunit is encoded by a separate gene and is classified as either $\alpha$ or non-$\alpha$, depending on the primary amino acid sequence, whereby $\alpha$ subunits contain a disulphide bond formed between the adjacent cysteines in the ligand binding domain (Figure \@ref(fig:structure-nachr-label)). Genome sequencing projects enabled identification of nAChR subunit families in several insect species. Fruit fly and model organism *Drosophila melanogaster* has 10 subunits, 7 of which are $\alpha$ ($\alpha1-7$) and 3 are $\beta$ ($\beta1-3$) [@adams2000a; @sattelle2005]. There are 11 subunits in the beneficial insect honeybee *A. mellifera* ($\alpha1-9$, $\beta1-2$) [@jones2006a; @consortium2006], 12 subunits in the pest red flour beetle *Tribolium castaneum* ($\alpha1-11$,, $\beta1$) [@consortium2008] and 7 in the Pea Aphid, *Acyrthosiphon pisum* ($\alpha1-6$, $\beta1-2$) [@yi-peng2013; @Consortium2010]. With the aid of molecular cloning techniques, equivalent subunits have been identified in many other insects, including cat flea *Ctenocephalides felis* [@bass2006] and green peach aphid *Myzus persicae* [@huang2000]. Amino acid sequence alignment of equivalent subunits revealed that they are highly conserved, with sequence identity typically greater than 60 % [@jones2010].
Insect nAChR gene families are among the least diverse when compared to other animal phyla. Mammals express 17 subunits: $\alpha1-10$, $\beta1-4$, $\delta$, $\gamma$ and $\epsilon$ [@millar2009] and there are 29 subunits in the representative of the phylum *Nematoda, C. elegans* [@jones2007b].
### RIC-3 improves recombinant nAChR assembly ###{#ric3insect}
<!-- There are different receptor types in insects. -->
<!-- https://radar.brookes.ac.uk/radar/file/c59cbdb5-d171-49e0-b0e4-101c261c72ed/1/fulltext.pdf -->
To identify which subunits assemble to form functional receptors, recombinant expression techniques were used.
Recombinant expression is a technique receptor stoichiometry and function can be studied in a heterologous system. cDNA is injected into the Xenopus oocytes, or used to transfect insect or mammalian cell line. Using internal cellular machinery, it is transcribed, translated and processed to the surface of the cell. Should a protein form, cell-surface expression can be detected using biochemical approaches (such as ligand binding studies), whereas function studied by means of electrical recordings. These approaches were utilised to identify the major receptor assemblies in mammals, nematode and fish (Table \@ref(tab:chlinergic-nts)).
<!-- To determine which insect nAChR subunits come together to form a functional receptor, various nAChR subunits were injected into the expression systems (*Xenopus oocytes* or cell lines) to determine whether cell surface expression and receptor function can be obtained. -->
To determine which insect subunits form functional nAChRs, @lansdell2012 transfected cultured insect cells with over 70 *Drosophila melanogaster* nAChR subunit cDNAs either singularly or in combinations. No cell surface was achieved, as shown by the radiolabelled ligand binding studies. Difficulties in expression of *Drosophila melanogaster* were also encountered in Xenopus oocytes [@lansdell2012] and mammalian cell lines [@lansdell1997]. The attempts to express receptors from other species were also largely unsuccessful. No ligand binding and/or agonist evoked currents were detected from cells transfected with genes encoding for the brown planthopper *Nilaparvata lugens* [@liu2005; @liu2009; @yixi2009], cat flea *Ctenocephalides felis* [@bass2006], aphid *Myzus persicae* nAChR subunits [@huang2000] and brown dog tick *Rhipicephalus sanguineus* [@lees2014]. Homomeric Locust *Schistocerca gregaria* $\alpha1$ [@marshall1990], *Myzus Persicae* $\alpha1$ and *Myzus Persicae* $\alpha2$ [@sgard1998] produced receptors with nAChR-like pharmacological and electrophysiological characteristics, however the channel-generated currents were of low amplitude, and the expression inconsistent.
Difficulties in recombinant receptor expression highlight the complexity of receptor formation (Figure \@ref(fig:turnover-label)). Assembly and oligomerisation are critical steps in the receptor maturation. These steps require a number of ER and Golgi resident chaperons. RIC-3 (resistant to inhibitors of cholinesterase-3) is an evolutionary conserved, ER-residing [@roncarati2006; @alexander2010] transmembrane protein [@wang2009]. The role of RIC-3 in receptor expression was first described using *C. elegans* and human receptors (Section \@ref(ric-3nacho) and \@ref(ric-3celegans)). More recently, its role in receptor folding and maturation of insect nAChRs has been demonstrated. Co-expression of Dm$\alpha2$-containing and Dm$\alpha5$/$\alpha7$ receptors with RIC-3 improved [@lansdell2008], and in some instances enabled expression in otherwise non-permissible systems [@lansdell2012]. Up to 3.5-fold increase in specific binding of radiolabelled antagonist was noted in insect cells co-transfected with RIC-3, suggesting the presence of greater number of folded receptors on the cell surface [@lansdell2008]. Expressed receptors have been also shown to be functional. In Xenopus oocytes, ionic currents were detected in response to acetylcholine in cells co-expressing RIC-3 [@lansdell2012].
RIC-3 enabled identification of potential nAChR in insects: homomeric $\alpha5$ and $\alpha7$ and heteromeric $\alpha5$/$\alpha7$. The identity of other insect receptors is unknown.
(ref:turnover) **Nicotinic acetylcholine receptor turnover.** Synthesised nAChR subunit peptides undergo folding and oligomerisation in the ER. Correctly folded receptors are transported into the Golgi (1). Misfolded subunits and misassembled receptors are retained in the ER and eventually degraded (2). Receptors transported to the Golgi undergo maturation to be shipped to the plasma membrane (4). Receptors in the plasma membrane are eventually degraded or recycled. Receptors are first packed into the endosome (4) and transported to the lysosome or proteosome for degradation (5) or re-inserted into the plasma membrane (6).
```{r turnover-label, fig.cap="(ref:turnover)", fig.scap= 'Nicotinic acetylcholine receptor turnover.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/nAChR_turnover.png")
```
### Insect sensitivity to neonicotinoids in recombinant systems
Difficulties in expression of recombinant insect nAChRs (Section \@ref(expressionfail)) hiders their pharmacological analysis and identification of receptors sensitive to neonicotinoids. Insect-mammal hybrid receptors served as a platform to investigate the potency and affinity of neonicotinoids.
#### High affinity of neonicotinoids to insect-chimera receptors ####{#chimerareceptors}
Mammalian $\alpha4$/$\beta2$ receptor expresses well in Xenopus oocytes [@cooper1991] and cell lines [@lansdell2000] and it has low affinity to imidacloprid (Kd >1000 $\mu$M) [@lansdell2000]. $\beta2$ from rat and chicken has been shown to enable recombinant expression of several insect $\alpha$ subunits in cell lines. Chimera of rat $\beta2$ and $\alpha$ subunits from the fruit fly *Drosophila melanogaster* [@lansdell2000], aphid *Myzus Persicae* [@huang1999], planthopper *Nilaparvata lugens* [@liu2009], cat flea *Ctenocephalides felis* [@bass2006] and sheep blowfly *Lucilia cuprina* [@dederer2011] have been generated. It needs to be noted that the potency of neonicotinoids on these receptors is unknown due to the lack of reported data, suggesting these receptors are not functional. However, their pharmacological profiles have been determined using saturation ligand binding studies [@hulme2010] (Table \@ref(tab:bindignrecombinant)).
The affinity of neonicotinoids to insect-chimera rectors varies, depending on the identity of the $\alpha$ subunit. Imidacloprid did not bind to Mp$\alpha1$/rat$\beta2$ receptor, whereas its Ki at Mp$\alpha2$ and Mp$\alpha3$-containing receptor was 3 and 2.8 nM, respectively [@huang1999]. Four to five fold-difference between the most and least susceptible *Drosophila melanogaster* and *Ctenocephalides felis* receptor assemblies were also identified [@lansdell2000; @bass2006]
Imidacloprid exhibits the highest affinity against target pest *Myzus Persicae* with the lowest reported Ki of 2.8 nM on $\alpha3$/$\beta2$ receptor [@huang1999]. It binds less tightly to the non-target insect, the fruit fly nAChRs; the Kd values range from 8.4 to 34.9 nM [@lansdell2000], suggesting it is selectively toxic to pest insects.
```{r bindignrecombinant, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
footnotez <- ("Receptors were expressed in insect S2 cell line")
footnotey <- ("Rn = Rattus norvegicus (rat), Dm = *Drosophila melanogaster (fruit fly), Mp = Myzus persicae (aphid), Nl = Nilaparvata lugens (planthopper), Cf = Ctenocephalides felis (cat flea)), N/B = no binding,")
bindingrecombinant <- data.frame(
Receptor = c("Rn$\\alpha4\\beta2$", "Dm$\\alpha1$/Rn$\\beta2$", "Dm$\\alpha2$/Rn$\\beta2$", "Dm$\\alpha3$/Rn$\\beta2$", "Mp$\\alpha1$/Rn$\\beta2$", "Mp$\\alpha2$/Rn$\\beta2$", "Mp$\\alpha3$/Rn$\\beta2$", "Mp$\\alpha4$/Rn$\\beta2$", "Nl$\\alpha1$/Rn$\\beta2$", "Cf$\\alpha1$/Dm$\\alpha2$/Rn$\\beta2$", "Cf$\\alpha3$/Dm$\\alpha2$/Rn$\\beta2$"),
Kd= c(">1000", "34.9", "20", "8.4", "N/B", "3", "2.8", "N/B", "24.3", "141", "28.7"),
References = c("Lansdell and Millar, 2000", "", "", "", "Huang et al., 1999", "", "", "", "Liu et al., 2005", "Bass et al. 2006", ""))
bindingrecombinant %>%
mutate_all(linebreak) %>%
kable("latex", align = "c", booktabs = TRUE, escape = F,
col.names = linebreak(c("Receptor", "Kd\n(nM)", "Rerefence")),
caption = 'Binding affinity of imidacloprid to recombinant insect-hybrid receptors') %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", c(footnotez, footnotey),
threeparttable = T)
```
#### High potency of neonicotinoids on insect-hybrid receptors
The potency of neonicotinoids on insect-mammal hybrid nAChRs have been determined using electrophysiological techniques. $\alpha$ nAChR subunit from the fruit fly, the cat flea and the planthopper were co-expressed with rat or mouse $\beta2$. The responses of the formed channel were recorded in the presence of various neonicotinoids: cyanoamidines clothianidin and imidacloprid, nitroguanidines thiacloprid and acetamiprid and nitromethylene nitenpyram.
Upward (depolarising) current was recorded from cells expressing insect-hybrid nAchRs in responses to all tested neonicotinoids. This response was dose-dependent. The potency of neonicotinoids varied, as indicated by the EC50 value, between 0.04 and 45.8 $\mu$M, however it is generally in the region of 1 $\mu$M.
The rank order of potency of cyanoamidines, nitroguanidine and nitromethylene differs, depending on the receptor identity. For example, in imidacloprid and clothianidin are the most potent on the fruit fly $\alpha1$ containing receptors [@dederer2011], whereas planthopper $\alpha3\alpha8$ hybrid, thiacloprid is the most efficacious [@yixi2009]. Nitenpyram has consistently the highest EC50.
```{r potencyrecombinant, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
footnotew <- ("Receptors were expressed in Xenopus oocytes")
footnotex <- ("Rn = Rattus norvegicus (rat), Gg = Gallus gallus (chicken), Dm = *Drosophila melanogaster (fruit fly), Nl = Nilaparvata lugens (planthopper), Cf = Ctenocephalides felis (cat flea)), Lc = Lucilia cuprina (sheep blowfly)")
potencyrecombinant <- data.frame(
Receptor = c("Nl$\\alpha1$/Rn$\\beta2$", "Nl$\\alpha2$/Rn$\\beta2$", "Nl$\\alpha3$/Rn$\\beta2$", "Nl$\\alpha3\\alpha8$/Rn$\\beta2$", "", "", "", "Dm$\\alpha1$/Gg$\\beta2$", "", "", "", "Dm$\\alpha2$/Gg$\\beta2$", "", "", "", "Cf$\\alpha1$/Gg$\\beta2$", "", "", "", "Cf$\\alpha2$/Gg$\\beta2$", "", "", "", "Cf$\\alpha4$/Gg$\\beta2$", "", "", ""),
Compound = c("Imidacloprid", "Imidacloprid", "Imidaclorprid", "Imidacloprid", "Clothianidin", "Thiacloprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram"),
EC50 = c("61", "870", "350", "3.2", "5.1", "2.8", "5.6", "0.04", "0.34", "0.23", "0.4", "0.84", "5.4", "2", "35.4", "0.02", "0.15", "0.11", "0.63", "1.31", "1.65", "2.63", "24.4", "13.8", "21.3", "9.4", "45.8"),
References = c("Liu et al. 2009", "", "", "Yixi et al. 2009", "", "", "", "Dederer et al. 2011", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", ""))
potencyrecombinant %>%
mutate_all(linebreak) %>%
kable("latex", align = "c", booktabs = TRUE, escape = F,
col.names = linebreak(c("Receptor", "Compound", "EC50\n($\\mu$M)", "Rerefence")),
caption = 'The potency of neonicotinoids on recombinantly expressed insect hybrid nAChRs.') %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", c(footnotew, footnotex),
threeparttable = T)
```
Based on the expression of several potential assemblies have been identified.
Subunits with various degree of sensitivity to neonicotinoids, suggesting some and not all receptors confer neonicotinoid sensitivity.
<!-- clothiandidin on the abdominal ganglion [@thany2009] and imidacloprid on the Colorado potato beetle (CPB), . -->
<!-- Imi IC5 0 = 0.4 mM EC50 = 18.3 nM these vaues are from @tan2007. note he also look at the resistant strain -->
<!-- single-electrode voltage clamp @tan2007 (intracellular) depolarisation and see for comparison of activity between all neonics -->
<!-- @thany2009 also did patch clamp inward current -->
<!-- @ihara2006 whole cell patch clamp inward current -->
<!-- Mannitol-gap recordings - must read this was used @buchingham1997, @tan2007 - extracellular recording schematic in tan2007 -->
<!-- The process starts in the nucleus where nAChR gene is transcribed into the mRNA. mRNA contains specific signal sequence which allows for nucleus exit and targeting to the endoplasmic reticulum (ER). Upon arrival at the ER membrane, the co-translational synthesis of receptor subunit occurs, starting from the N-terminus. The protein is inserted into the ER membrane, the signal sequence is cleaved off, and the N-glycosylation chain is attached to the glycosylation recognition sequence [@blount1990]. In addition, the initial folding and oligomerisation occurs. Upon completion of protein synthesis, post-translation events are taking place which include disulphide bridge formation [@blount1990] and further folding and oligomerisation. There are two models describing the process of subunit assembly based of mammalian muscle receptors. First assumes that fully folded subunit forms dimers, and then assembly into pentameric assemblies [@gu1991]. Second theory describes that trimers are formed before the remainder subunits are added to form a pentamer [@green1993]. -->
<!-- The process of subunit assembly is complex and probably regulated by a set of rules, such as the control over the subunits expression in the cell [@missias1996] and the primary structure of receptor subunits. In particular sequences within N-terminal (extracellular ligand binding domain) [@sumikawa1992; @sumikawa1994; @kreienkamp1995] but also regions within the TM domain [@wang1996a] and C-terminus [@eertmoed1999]. During receptor assembly, these sequences become buried within the folding protein and the receptor can be transported to the cell surface. Should a protein misfold, the sequences become exposed and the protein retained in the ER. -->
<!-- Therefore, the process of receptor biogenesis is complex and highly regulated. Should a protein misfold or misoligomerise, it is sent for degradation [@brodsky1999] mediated by the ER-associated system [@hampton2002]. In contrast, properly folded and oligomerised receptors are targeted to appropriate cellular localisation. Neuronal receptors are sent to the synapse, those in muscle cells are targeted to the NMJ during synaptogenesis, where they can perform their important function in signal propagation. The process of receptor turnover is demostarted in Figure \@ref(fig:turnover-label). -->
<!-- Receptor assembly and -->
<!-- The role of RIC-3 (resistant to inhibitors of cholinesterase-3) protein in an ER residing proteinin receptor maturation was first identified by @@halevi2002, who demonstrated that . Heterogous expression of *C. elegans* however, upon co-expression of RIC-3 proteins, both receptor current and ligand binding were detected [@holevi2002]. -->
<!-- The stoichiometry of these receptors in unknown, however there are some potential assemblies. For example Drosophila receptors contain $\alpha4\beta3$, $\alpha1\alpha2\beta2$ and $\beta1\beta2$ subunits [@chamaon2002], based on the immunoprecipitation using antibodies against various receptor subunit types. Using a similar approach, it was shown that *Nilaparvata lugens* $\alpha1$, $\alpha2$ and $\beta1$, as well as $\alpha3$, $\alpha8$ and $\beta1$ co-assembly. -->
<!-- These neuronal effects are reflected in the behavioural data [@sone1994]. Upon exposure to toxic dose of neonicotinoids, insects udergo convulsions, uncoordinated movement, tremors as well as feeding inhibition, eventual paralysis and death [@suchail2001; @boiteau1997; @alexander2007]. -->
<!-- "connections between afferents sensory neurons with interneurons or with motoneurons in several insects such as the cockroach" -->
### Recombinant receptors
Recombinant insect nAChR are notoriously difficult to express. Several interventions have been tested including expression of hybrid receptor in which insect subunits have been co-expressed with mammalian ones. It need to be noted that this method has several limitations. First, hybrid receptors are not biologically relevant, thus conclusions from these studies should be drawn with caution. Second, some some of the expressed receptors may be folded, but not functional. Lastly, this method enabled expression of only a handful of receptors, thus most remained uncharacterised. This hinders their pharmacological characterisation and identification of subunits important in conferring the agricultural role of neonicotinoids. Heterologous expression of nAChR from insects and other species would allow for the characterisation of the interactions of these proteins with neonicotinoids to better define their mode of action and selective toxicity. Development of the platform in which the heterologous expression of insect nAChRs could be achieved, would open the door to screening of novel insecticides, to combat emerging and spreading neonicotinoid-resistance (Section \@ref(resgenevidence)) and @charaabi2018). In addition, by expressing nAChRs from pest and other species identification of compounds with no adverse effects on beneficial insects and other biologically important species may be achieved. Model organism *C. elegans* is a system in which the mode of action and the selective toxicity can be studied.
## Overview of *C. elegans*
*C. elegans* is a transparent non-parasitic nematode, inhabiting temperate soil environments. This worm was first described as a new species in 1900 [@maupas1900] and named *Caenorhabditis elegans* Greek *caeno* meaning recent, *rhabditis* meaning rod-like and Latin *elegans* meaning elegant. The natural isolate of this species was extracted from the compost heap in Bristol by Sydney Brenner in 1960's and named N2. Since, *C. elegans* has become a valued lab tool and a model organism due to ethical, economical and biological reasons. In contrast to vertebral organisms, *C. elegans* is not protected under most animal research legislation. The cost of use is low, due to the cost of purchase (~$6/strain), maintenance, fast life cycle and high fertility of these animals. *C. elegans* has also is also the first multicellular organism to have the whole genome sequenced [@consortium1998] and the neuronal network has been mapped [@white1986]. It has an advantage over other model organisms in that its nervous system is relatively simple and it is amenable to genetic manipulations.
## General biology ##{#genbiology}
*C. elegans* exists as a male and hermaphrodite, with the latter sex being the more prevalent one. In the lab, 99.9 % of worms are hermaphrodites, which self-fertilize their eggs. *C. elegans* has a fast life-cycle (www.wormbook.org), which is temperature-dependent. At 15^o^C, it takes 5.5 days from egg-fertilization to the development of a worm into an adult. This process is shortened to 3.5 and 2.5 days at 20 and 25 $^\circ$C, respectively (Figure \@ref(fig:life-cycle-label)). At 20 degrees, hermaphrodite lay eggs 2.5 hours after the fertilisation. 8 hours later the embryo hatches as a larvae in the first stage of its development (L1). In the presence of food, larvae develops into an adult through three further developmental stages, namely L2, L3 and L4. The transition between each larval stage is marked by a process of maulting, during which the old cuticle is shed and replaced by a new one. In the absence of food, developing L2 and L3 worms enter the dauer stage. The worms can remain arrested at this low metabolic activity state for up to several weeks, and will develop into adults, should the food re-appear. Hermaphrodites remain fertile for the first three days of their adulthood. Their eggs can be fertilised internally with the sperm produced by the hermaphrodite, or, if there are males available, by mating. Unmated worm can lay up to 350 eggs, whereas mated over a 1000 eggs. Figure \@ref(fig:life-cycle-label) illustrated the full *C. elegans* life cycle.
(ref:life-cycle) **The life cycle of *C. elegans*.** *C. elegans* develops into an adult through 4 larval stages L1- L4. These stages are separated by molts associated with shedding of an old and exposure of a new cuticle. Adults emerge can lay over a 1000 eggs a day which hatch within several hours. Dauer stage is a metabolic compromised worm stage entered in the absence of food. Upon re-appearance of food, worms develop into L4 and adults normally. Figure taken from www.wormatlas.org.
```{r life-cycle-label, fig.cap="(ref:life-cycle)", fig.scap='The life cycle of \\textit{C. elegans}.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/intro_2/life-cycle.jpg")
```
### Nervous system
A great advantage of *C. elegans* is that the entire nervous system has been mapped [@white1986], using electron microscopy of serial worm cross sections. A hermaphrodite has a total of 302 neurons present in the ventral nerve cord, the pharynx, the circumpharangeal ring and the tail. These neurons are assigned to 118 classes based on morphology and positioning. There are 39 sensory neurons, 27 motor neurons and 52 interneurons. Pharyngeal nervous system consists of 20 neurons belonging to 14 types.
### Behaviour as an analytical tool ###{#analytical_behaviour}
Over half of the century of *C. elegans* research developed a great depth of understanding of many of their simple and more sophisticated behaviors. These behaviors can be can be scored and quantified to inform on the effects of compounds or genetic alterations on worms.
#### Pharyngeal pumping
An example of a well defined worm behavior is pharyngeal pumping. Pharyngeal pumping is the feeding behavior of the worm mediated by the pharynx. Successive and timed contraction-relaxation cycles of this muscular organ results in the capture, misceration and passage of the food particles down the alimentary track.
Pharyngeal pumping can be easily scored by counting the number of pharyngeal pumps over time to determine the effects of compounds or genetic alteration on the function of the pharynx. In addition, pharyngeal cellular assays can be performed which offer not only a greater temporal resolution of the activity of the pharynx, but also an analysis of the function of distinct anatomical features of the pharynx.
EPG (electropharyngeogram) is an extracellular electrical recording from the pharynx of the worm. It arises as a result of the flow of ions out of the worm's mouth, due to the changes in the membrane potential of the pharyngeal muscle. A single pharyngeal pump gives rise a series of electrical transients collectively called an EPG. These electrical transients are temporally defined and represents activities of distinct anatomical feature of the phayngeal muscle, namely the corpus, isthmus and the teminal bulb [@raizen1994; @franks2006].
#### Locomotion ####{#locomotionbehaviour}
*C. elegans* exhibits distinct locomotory behavior in liquid and on solid medium. Whilst in liquid it flexes back and forth in the middle of the body. On solid medium, it performs S shaped, crawling movement. The direction of this movement is mostly forward and achieved due to the friction between the substrate and the body [@niebur1993]. By counting the number of bends in the unit of time in the presence and absence of treatment, the effects on locomotory behaviour can be measured.
#### Egg laying ####{#egglayingbehaviour}
*C. elegans* reproduces mainly by self-fertilisation of hermaphrodites or less frequently by mating with males. Hermaphrodite is sexually ready to be fertilized from young adult, the eggs are stored in the uterus and laid in defined spacio-temporal fashion. Typically, 5 eggs are laid at the time in approximately 20 minute intervals [@waggoner1998]. The number of egg laid in the unit of time can be counted and used to inform on the effects of treatment on the reproductive ability of the worm.
### Mode of action studies
*C. elegans* is amenable to genetic manipulations. There is a range of genetic techiques available to generate mutant strains, in which the expression of a certain protein is greatly reduced or eliminated [@boulin2012]. Using these techniques, hundreds of mutant strains have been generated. These strains have been deposited and are available for purchase from the Caenorhabditis Genetics Center (CGC). Behaviour analysis of mutant strains allows for the identification of proteins important in the regulation of many aspects of worm behaviour; an approach used for the mode of action studies.
## Cholinergic neurotransmission regulates feeding, locomotion and reproduction in *C. elegans* ## {#cholinergicneurotransmissioninworms}
Many of the *C. elegans* behaviours are regulated by acetylcholine, which is the major neurotransmitter in the nervous system of *C. elegans*. This is evident for the behavioural analysis of mutant strains in which acetylcholine neurotransmission is affected, as well as from the pharmacological effects of cholinergic agents on the behaviour of worms.
### Evidence from behavioural analysis
The synthesis and packing of acetylcholine into synaptic vesicles are essential steps in cholinergic neurotransmission. These functions are mediated by several proteins (Figure \@ref(fig:cholsynapsecelegand-label)). Choline acetyltransferase (ChAT) encoded by the cha-1 gene catalyses the formation of acetylcholine [@rand1985]. Vesicular acetylcholine transferase (VAChT) encoded by unc-17 loads acetylcholine into synaptic vesicles [@alfonso1993]. Null mutations of these genes are lethal due to the inhibition of worm's locomotion and feeding and its eventual death due to starvation [@rand1989; @alfonso1993]. Polymorphic ChAT and VAChT mutants in which the expression is reduced, but not abolished, revealed somewhat opposite phenotype. The pharyngeal pumping both in the presence and absence of food was reduced [@dalliere2015] the movement highly uncoordinated and jerky [@rand1984], whereas egg-laying increased [@bany2003].
### Pharmacological evidence
#### Aldicarb
Aldicarb is a synthetic carbamate mainly used as a nematicide (compound used to kill plant parasitic nematodes) [@lue1984] in the pest management system. Its mode of action is via inhibition of the acetylcholine esterase (AChE, the enzyme that breakdown acetylcholine released to the synaptic cleft) [@johnson1983]. When applied on worms, aldicarb causes hypercontraction of the body wall muscle ,leading to paralysis [@nguyen1995; @mulcahy2013], hypercontraction of the pharyngeal muscle and inhibition of feeding [@nguyen1995] as well as the inhibition of egg-laying [@nguyen1995]. These observations in conjunction with the phenotypical analysis of *cha-1* and *unc-17* mutants, suggest acetylcholine stimulates feeding, coordinates locomotion and inhibits egg-laying in *C. elegans*.
<!-- #### Levamisole -->
<!-- Levamisole is a synthetic compound used in treatment of parasitic worm infestation in both humans and animals [@miller1980]. It is an agonist of a subset of receptors present at a body wall muscle [@richmond1999]. Levamisole causes spastic paralysis of worms [@lewis1980b], stimulates egg-laying [@trent1983], -->
<!-- #### Nicotine -->
<!-- Nicotine is an exhogenous agonist, naturally occurring in Tobacco plant. Nicotine is an aonist on the second type receptor at a body wall muscle, namely the N-type, but based on the nicotine-intoxication worm phenotype, it is likely to target receptors regulating pharyngeal pumping and vulva muscle. Nicotine inhibits locomotion [@kudelska2017] pharyngeal pumping [@kudelska2018], and egg-laying [@]. -->
<!-- #### Neonicotinoids -->
<!-- #### Neonicotinoids -->
(ref:cholsynapsecelegand) **Enzymes and transporters at the *C. elegans* cholinergic synapse.** Upon release into the synaptic cleft, acetylcholine is broken down to choline and acetate by acetylcholinesterase (AChE). Choline is taken up to the pre-synapse by a choline transporter (ChT). The acetyl group in transferred onto choline to product acetylcholine; a reaction catalysed by choline transferase (ChAT). Generated acetylcholine is pumped back into the synaptic vesicle by the vesicular acetylcholine transporter (AChT) for re-cycling. Names of genes are depicted in small blue letters. Image taken from @rand2006.
```{r cholsynapsecelegand-label, fig.cap="(ref:cholsynapsecelegand)", echo=FALSE, fig.scap='Enzymes and transporters at the *C. elegans* cholinergic synapse.',fig.align='center', echo = FALSE}
knitr::include_graphics("fig/general_intro/png/cholinergic_synapse_C.elegans.jpg")
```
### nAChRs
The action of acetylcholine is mediated by nAChR. *C. elegans* contains 29 genes encoding for nAChR subunits [@jones2007b]. The receptor subunits are assigned to five groups based on the sequence homology: DEG-3, ACR-16, ACR-8, UNC-38, and UNC-26 Figure (\@ref(fig:seqidentityecd-label)).
Sequence identity between the insect and *C. elegans* subunits is low. Mean identity is 35 %. Least homologous are members of the DEG-3 family with the mean value of 28 %. the other three groups between 37 and 41 %.
Low similarity between the residues of the ligand binding domain suggest these subunits diverged during the evolution thus have distinct pharmacophore.
The nAChRs are expresses at the neuromuscular junction [@richmond1999] and in the nervous system [@lewis1987].
To date, four receptors assemblies have been identified. (1) A single neuronal receptor composed of DES-2 and DEG-3 subunits [@treinin1998]. (2) There are two receptor at the body wall muscle differentiated based on their pharmacology into L-(levamisole)type and N-(nicotine)-type [@richmond1999]. The subunit composition of these receptors is respectively: UNC-29, UNC-38, UNC-63, LEV-1, LEV-8 associated with auxiliary subunits RIC-3, UNC-50, and UNC-74 [@boulin2008] and ACR-16 homopentamer [@touroutine2005] (more details is Section \@ref(muscletypenachr)). EAT-2 is a predicted $\beta$ nAChR subunit expressed in the pharyngeal muscle, believed to assemble with auxilary subunit EAT-18, based on common localisation and behavioural phenotypes of *eat-2* and *eat-18 C. elegans* mutants [@mckay2004]. Based on the expression in Xenopus oocytes, ACR-2 and UNC-38 may co-assembly [@squire1995]. However the levamisole-induced currents were of low amplitude, which may suggest a necessity for auxiliary subunits.
<!-- # ```{r celegans-nachrs, echo=FALSE, message = FALSE, warning=FALSE} -->
<!-- # library(kableExtra) -->
<!-- # library(dplyr) -->
<!-- # celegans_nachrs <- data.frame( -->
<!-- # Group = c("DEG-3", "ACR-16", "ACR-8", "UNC-38", "UNC-29"), -->
<!-- # Subunits = c("ACR-17, ACR-18, ACR-20, ACR-22*, ACR-23, DES-2, DEG-3\nACR-24, ACR-5", "ACR-7, ACR-9*, ACR-10, ACR-11, ACR-14*, ACR-15\nACR-16, ACR-19, ACR-21, ACR-25*, EAT-2*", "ACR-8, ACR-12, LEV-8", "UNC-38, UNC-63, ACR-6", "ACR-2*, ACR-3*, UNC-29*, LEV-1*")) -->
<!-- # -->
<!-- # celegans_nachrs %>% -->
<!-- # mutate_all(linebreak) %>% -->
<!-- # kable(format = "latex", align = "l", booktabs = TRUE, escape = FALSE, -->
<!-- # caption = 'nAChR subunits in \\textit{C. elegans}.') %>% -->
<!-- # kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>% -->
<!-- # footnote(general= " Non-alpha subunits are marked with *. Figure modified from Holden-Dye el al., 2013.", -->
<!-- # threeparttable = T) -->
<!-- # ``` -->
(ref:seqidentityecd) **Amino acid sequence identity between the insect and *C. elegans* nAChR subunits.** Sequences of the honeybee and *C. elegans* extracellular, ligand binding domains were aligned using the MUltiple Sequence Comparison by Log- Expectation (MUSCLE). Sequence identities were derived with the HMMER alignment and color-coded using red-yellow-green scale. *C. elegans* subunits of the UNC-38 group are the most homologous to the insect subunits.
```{r seqidentityecd-label, fig.cap = "(ref:seqidentityecd)", fig.scap="Amino acid sequence identity between the insect and *C. elegans* nAChR subunits", out.height = '120%', fig.align= 'center', echo=FALSE}
knitr::include_graphics("fig/general_intro/pdf/identity_clipped_renamed_aligned_celegans_apismelifera.png")
```
## Heterologous expression of nAChRs in *C. elegans* ##{hetexpeffectsofphysiology}
*C. elegans* can be used as a platform to study functional and pharmacological properties of nAChRs. This method relays on the ability to generate transgenic worms by microinjection.
Microinjection is a process by which a plasmid containing cDNA encoding for a protein of interest is injected into the syncytium distal arm of the gonad(s) of the young adult hermaphrodite worm [@stinchcomb1985]. The injected DNA in taken up by the the residing oocytes [@wolke2007], which become fertilised and develop into an adult worm. Using cellular machinery, the DNA plasmid forms extrachromosomal arrays , from which the cDNA becomes transcribed, translated and expressed [@stinchcomb1985; @mello1991].
*C. elegans* expresses nAChRs are the neuromuscular junction and in nervous cells, thus it possesses cellular machinery necessary for the processing of these proteins. Several *C. elegens* chaperons involved in nAChRs maturation and function have been identified. RIC-3 is a ubiquitously expressed in *C. elegans* (Section \@ref(ric-3celegans)). It has a role in folding and assembly of nematode, insect (Section \@ref(ric3insect)) and vertebrate nAChRs (Section \@ref(ric3insect)). *C. elegans* RIC-3 has been shown to improve heterologous expression of insect hybrid [@lansdell2012] and mammalian nAChR [@lansdell2005] in cell lines and Xenopus oocytes. UNC-74, UNC-50 are ER and Golgi residing proteins, respectively, involved in maturation of *C. elegans* nAChRs. Whereas EAT-18 is a transmembrane protein, expressed on the cell surface, required for the function of nAChRs in the pharyngeal muscle. Details of their function can be found in Sections \@ref(unc50), \@ref(unc74) and \@ref(eat18)). It is therefore predicted that *C. elegans* has a favorable cellular environment for the expression of nAChRs.
The expression of transgene can be driven in specific cells or tissues by utilising native promoters. Conjugated monoclonal antibodies were used to show selective expression of myo-3 (heavy chain of myosin B) at the body-wall muscle and vulva muscle [@ardizzi1987] and myo-2 (myosin heavy chain C) in the pharyngeal muscle [@okkema1993] of the intact worm. Thus, by using myo-3 or myo-2 promoters upstream of the heterologous gene, expression at the body wall or pharyngeal muscle, respectively, can be achieved [@sloan2015; @crisford2011]. There are also promoters, such as H2O, inducing expression in the nervous system [@yabe2005].
Heterologous expression of receptor proteins can have several consequences on the worm:
(1) When re-introduced into the mutant strain, it can restore drug or cellular function [@crisford2011].
<!-- For example, expression of *C. elegans* and human ortholog of the potassium-activated calcium channel Slo-1 at the body wall muscle of *C. elegans slo-1* mutant restored sensitivity to selective agonist emodepsite in locomotory assays -->
(2) Heterologous expression in wild-type worm can lead to new or altered pharmacological sensitivity [@crisford2011].
<!-- emonstrated that the ectopical expression of Slo-1 in the pharyngeal muscle cell confers sensitivity to emodepsite. -->
<!-- The locomotory deficit and levamisole-resistance of *C. elegans unc-38* mutants was reversed upon expression of nAChRs of the parasitic worm UNC-38 [@sloan2015]. Whereas human GPCR A~2a~R expressed in the body wall muscle or nerve cells conferred behavioural response to receptor specific ligand [@salom2012]. In addition, the A~2A~R selective agonist CGS21680 stimulated locomotion of transgenic worms in a dose dependent manner. Enhanced response to non-specific GPCR agonist adenosine in transgenic worms expressing A~2a~R in the body wall muscle was also noted. -->
Thus, heterologous expression combined with behavioural and pharmacological analysis of transgenic worms can inform on their functional and pharmacological properties of recombinant nAChRs.
<!-- Heterologous expression of nAChRs can have several consequences, due to their involvement in many biological processes. *C. elegans* nAChRs are the main excitatory receptors at the neuromuscular junction [@riddle1997) and are involved in regulation of many aspects of worm’s behaviour, including feeding [@avery2012] locomotion [@richmond1999], egg-laying [@schafer2005; @bany2003]. They are also expressed in neuronal cells constituting to sensory and integrating circuits and are involved in chemosensory behaviour, as well as signal integration and neuronal plasticity [@yassin2001]. More recently their implicated in the regulation of development has been investigated [@ruaud2006]. -->
## Aims
The overall aim of this project is to develop *C. elegans* as a platform for the heterologous expression of nAChRs, with the aim to investigate selective toxicity of neonicotinoids insecticides. In order to use *C. elegans* as a heterologous expression system, it is necessary to achieve several goals:
1. Define sensitivity of *C. elegans* to these compounds. The representatives of three distinct chemical classes of neonicotinoids will be used: cyanoamidine clothianidin, nitroguanidine thiacloprid and nitromethylene nitenpyram. Their effects on *C. elegans* will by tested utilising behavioural and cellular assays to define their potency on distinct neuronal circuits and anatomical structured of the worm.
2. Identify suitable *C. elegans* genetic background for the expression of nAChRs.
3. Develop assays by which the functional nAChR expression and drug-sensitivity can be tested.
01-intro_2.Rmd 0 → 100644
View file @ e74fe8cf
---
nocite: |
@chen1997, @araujo1988, @couturier1990, @cooper1991, @lee1967, @brown1936, @mishina1986, @zirger2003, @mongeon2011, @lewis1987, @treinin1998, @richmond1999, @boulin2008, @touroutine2005,
...
# General introduction {#generalintro}
## Chemical treatment in agriculture
Insecticides are compounds utilised in agriculture, medicine, industry and private households to protect crops, life-stock and human health from pest infestation [@anadon2009; @dryden2009; @oberemok2015]. Their identity evaluated over the years to improve the effectiveness and reduce the undesirable effects on human health and the environment [@casida1998].
Until late 1800s organic, natural compounds contained within the plant or animal matter were utilised [@casida1998]. The first record of agricultural application of nicotine-containing Tobacco [@david1953; @steppuhn2004] dates back to 1690 [@mcindoo1943]. Tobacco plant, has been used in France, England and the US to protect orchards and trees against a wide range of pests including aphids, caterpillars and plant lice [@mcindoo1943]. *Chrysanthemum* plants containing pyrethrum were used against worms and insects in America and Europe [@elliot1995]. These treatments were however suitable only for small scale agricultural treatment, due to the limited availability.
Arsenic compounds were the earliest inorganic insecticides. Although their history dates back to 5th century [@kerkut1985], they did not gain popularity until the 19th century. Aceto-arsenite Paris Green was used in controlling Colorado potato beetles and mosquitoes [@cullen2008; @peryea1998], whereas lead arsenate was an effective insecticide for apple and cherry orchards [@peryea1998]. Although effective against pests, these substances are toxic to humans [@nelson1973; @gibb2010; @argos2010] thus their use marginal [@echa2017].
In the last century, several synthetic compounds became available, including dichlorodiphenyltrichloroethane (DDT), and members of the carbamate, organophosphate and pyrethroid class of compounds. DTT was one of the most popular insecticides in the 1900s, with the peak annual use of over 85 000 tonnes in the U.S. alone [@phsa2002]. DDT's potent insecticidal activity was discovered 60 years after its synthesis in 1874, by the Swiss chemist Paul Hermann Muller, who was later awarded a Nobel prize in Medicine “for his discovery of the high efficiency of DDT as a contact poison against several arthropods.” [@nobel2019]. DTT became commercially available in the 1940s in Europe and the U.S., and it was used to suppress potato beatles, mosquitoes, fleas and lice. Since 1970s, the use of DDT has been progressively phased out due to its propensity to bio-accumulate in the adipose tissues of animals resulting in the environmental persistence [@EUEPA1975].
Diminishing popularity of DDT, created a market space for organophosphates, carbamates and pyrothroids (Table \@ref(tab:insecticidegroups)). By the 1990s, the respective market share of members of these three classes of insecticides was: 43 %, 15 % and 16 % and the annual sales of 3.42 bn Euros, 1.19 bn Euro and 1.169 bn Euro, respectively [@jeschke2011]. The main issue associated with the use of organophosphates and carbamates is their ability to cause serious human poisonings, some of which can lead to death [@king2015]. The lack of selectivity combined with increasing resistance [@bass2014] instigated new management strategies aimed to combat these negative effects. In the 1990s research activities concentrated on finding new insecticides which have greater selectivity and better environmental and toxicological profiles.
```{r insecticidegroups, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
insecticide_groups <- data.frame(
Class = c("Organophosphates", "Carbamates", "Pyrethroids"),
Chemicals = c("Parathion, malathion, azinphosmethyl", "Aldicarb, carbamyl, carbofuran", "Allethrin, Cypermethrin"),
Mode = c("Acetylcholinesterase\ninhibitor", "Acetylcholinesterase\ninhibitor", "Voltage gated\nsodium channel blocker"))
insecticide_groups %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Class", "Chemical", "Mode of\naction")),
caption = 'Synthetic insecticides') %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote("Sales as of 2008, according to Jeschke et al. 2011",
threeparttable = T)
```
## Structural diversity of the neonicotinoid insecticides
In 1970s, the scientists of Shell Development Company Biological Research Centre in California identified $\alpha$- DBPN (2-(dibromonitromethyl)-3-(methylpyridine)), first synthesised by Prof. Henry Feuer [@feuer1986]. This lead compound showed low insecticidal activity against aphid and house fly [@tomizawa2003; @tomizawa2005]. Structural alterations of DBPN resulted in production of nithiazine (Figure \@ref(fig:neonics-structure-label)). Nithiazine showed improved insecticidal activity and was particularly effective as a new housefly repellent [@kollmeyer1999]. Further replacement of the thiazine ring by chloropyridinylmethyl (CPM) group, addition of the imidazolidine or its acyclic counterpart, and retention of the nitromethylene group resulted in generation of more potent compounds, one of which, nitenpyram, exhibited particularly high efficacy. Regrettably, both nithiazine and nitenpyram are not useful in fields, as they are unstable in light. The latter however is successfully used in veterinary medicine as an external parasite treatment for cats and dogs.
To solve the issue of photo-instability, nitromethylene group (CCHNO2) was replaced by nitroguanidine (CNNO2) and cyanoamidine (CNCN) (Figure \@ref(fig:neonics-structure-label) and @kagabu1995). These chemical moieties have absorbance spectra at much shorter wavelengths hence do not degrade upon exposure to sunlight. Further alterations, such as replacement of imidazolidine by thiazolidine or oxadiazinane, and/or chloropyridinylmethyl by chlorothiazole or tetrahydrofuran (THF) did not hinder insecticidal activity [@yamamoto1999]. As a result of these modifications, all 6 currently used neonicotinoids were synthesised. They are grouped according to their pharmacophore into N-nitroguanidines, nitromethylenes and N-cyanoamidines (Figure \@ref(fig:neonics-structure-label)). Generally compounds with acyclic- guanidine or amidine and with nitromethylene are more efficacious against moth- and butterfly- pests than those with cyclic counterparts or nitroimine respectively [@ihara2006], nevertheless all are commonly used in agriculture. Imidacloprid, currently the most widely used neonicotinoid, was synthesised in 1970 in Bayer Agrochemical Japan and introduced to the EU market in 1991. Its trade names include Confidor, Admire and Advantage. Together with thiacloprid (Calypso), imidacloprid is marketed by Bayer CropScience. Thiamethoxam (Actara) is produced by Syngenta, Clothianidin (Poncho, Dantosu, Dantop) and Nitenpyram (Capstar) by Sumitomo Chemical, acetamiprid (Mospilan) by Certis, whereas dinotefuran (Starkle) by Mitsui Chemicals company. Last neonicotinoid (dinotefuran) was launched in the EU in 2008.
Research into novel neonicotinoids continues [@shao2013]. In the last decade, several novel insecticides have been characterised and approved for use in the EU. Sulfoxafrol [@zhu2011; @eu2019a] and flupyradifurone [@nauen2015; @eu2019b] have been classified as representatives of new chemical classes, namely sulfoximines and butenolides. However, due to their mode of action and similar biochemical properties, some argue that they are in fact neonicotinoids, whereas their mis-classification has been deliberate to avoid association with neonicotinoids [@pan2019].
(ref:neonics-structure) **Development and chemical structures of the synthetic insecticides, the neonicotinoids.** Systematic modification of the lead and prototype compounds led to the discovery of seven neonicotinoids currently used in agriculture and animal health. They are structurally related to nicotine (shown in top right corner) and classified according to the pharmacophore moiety into N-nitroguanidines, N-cyanoamidines and nitromethylenes.
```{r neonics-structure-label, fig.cap="(ref:neonics-structure)", fig.scap='Development and chemical structures of synthetic insecticides neonicotinoids.',fig.align='center', out.height = '90%', echo = FALSE}
knitr::include_graphics("fig/general_intro/png/neonics_structure.png")
```
## Economical status of neonicotinoids ###{#economicalstatus}
The use of neonicotinoids in agriculture has been increasing steadily since their launch in the early 1990s. By 2008, they became major chemicals in the agriculture, replacing organophosphates and carbamates [@jeschke2011]. Continual increase in popularity of neonicotinoids is reflected in the total usage data. In Great Britain, the yearly use of neonicotinoids increased by over 10-fold from 10 tonnes/year in 1996 to over 105 tonnes/year in 2016 [@fera2019]. Similar trends are observed in the U.S. [@usgs2019], Sweden and Japan [@simon-delso2015]. Continual increase in usage coincides with the rise in their economical impact. In 2008, the estimated global market value of neonicotinoids was 1.5 bn dollars [@jeschke2011]. This increased to 3.1 bn dollars in 2012 [@bass2015].
The widespread usage and monetary value of neonicotinoids is a reflection of their many advantages.
<!-- Important in the pest managment, used in over 120 coutries on 140 crop types [@jeschke2011]. -->
## Psysicochemical properties of neonicotinoids grant versitile methods of application ##{#physchem}
One of the major benefits of neonicotinoids are their physical and chemical profiles (Table \@ref(tab:properties)). Due to relatively high water solubility, neonicotinoids act as systemic insecticides [@westwood1998]. This means that once applied on crops, they dissolve in the available water and can be taken up by the developing roots or leaves. Upon plant entry, they are then distributed to all parts of the plant [@westwood1998; @stamm2016], providing protection against herbivorous pests [@stamm2016]. This property of neonicotinoids means they can be used as a seed coating, reducing the required frequency of application. Indeed, seed dressing is the most commonly used method, accounting for 60 % of all neonicotinoids applications worldwide [@jeschke2011] and particularly popular to protect potatoes, oilseed rape, cereal, sunflower and sugar beet. In addition, neonicotinoids half-life in soil is from several weeks to years [@cox1997; @sarkar2001; @gupta2007), hence seed-dressing creates a continual source for re-uptake by plants. Neonicotinoids are also suitable for ground treatment and are used as soil drenching for the protection of citrus trees and vines, granules for amenity grassland and ornament flowers and as a trunk-injection to protect trees against herbivores. They are not volatile, therefore can be also applied as spray. This method is used in garden for flowers and vegetables and in agriculture on soft fruits and greenhouse crops. Low lipophilicity, indicated by octanol/water partition coefficient value (log Pow), suggest they do not bio-accumulate in the adipose tissues of animals [@turaga2016]. However, moderate water solubility combined with low lipophilicity means they may have a potential to accumulate in water.
<!-- Although structurally related nicotine has similar properties, it is not appropriate for the agricultural use due to low toxicity to insects [@nauen1996]. -->
```{r properties, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
properties <- data.frame(
Compound = c("Nitenpyram", "Clothianidin", "Thiacloprid"),
log = c("-0.64 (1)", "0.70 (1)", "1.26 (1)"),
pKa = c("3.1 and 11.5", "11.09 (5)", "NA (5)"),
Water = c("590 000 (3)", "340 (3)", "184 (3)"),
Henry = c("4 x 10\\textsuperscript{-13} (5)", "3 x 10\\textsuperscript{-11} (5)", "5 x 10\\textsuperscript{-10} (5)" ),
Water = c("NA (3)", "56.4 (3)", "28.0 (3)"))
properties %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Compound", "log Pow\npH=7.4\n24 $^\\circ$C", "pKa at\n20 $^\\circ$C", "Water solubility\nmg / L\n20 $^\\circ$C\npH=7", "Henry's law\nPa x m$^3$ x mol$^-1$\n20 $^\\circ$C", "Water sediment \nDT50 (days)")),
caption = 'Physichochemical properties of neonicotinoids',
) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote("log Pow = octanol/water partitioning, DT50 = half-life for degradation, 1 = Jeschke and Nauen 2008, 2 = Sangster 1997, 3 = Bonmatin et al., 2015, 4 = Maeda et al., 1978, 5 = Pesticide Properties Database (PPDB), 2019",
threeparttable = T)
```
## Neonicotinoids are highly potent against insect pests ####{#potentpests}
<!-- look at this paper to see the symptoms of imi exposure on insects -->
<!-- @sone1994 -->
Neonicotinoids are highly potent against insect pests, as measured by the LC50/LD50 (the concentration/dose of a compound that kills 50 % of the population) in the acute toxicity assays (Table \@ref(tab:toxallanimal)). The lower the LC(D)50, the greater the potency of a compound.
Neonicotinoids are effective against a wide range of piercing-sucking pests such as cotton and peach aphids (*Aphis gossypii* and *Myzus persicae*) [@nauen1996; @mota-sanchez2006; @bass2011], domestic (*Malus domestica*) and may-flies (*Epeorus longimanus*) [@tomizawa2000; @alexander2007] as well as planthoppers (*Nilaparvata lugens*) [@zewen2003]. Their IC50 is in generally the region of 2 $\mu$M. Although all neonicotinoids are highly effective against insect pests, their potency depends on the chemical structure. The rank order of insecticidal potency on the cotton aphid *A. gossypii* and the Colorado potato beetle, *Leptinotarsa decemlineata* was clothianidin > nitenpyram = thiacloprid, suggesting nitroguanidines are generally more potent than nitromethylenes and cyanoamidines [@shi2011; @mota-sanchez2006].
The potency also depends on the route of exposure. LC50s are lower upon systemic or oral administration in comparison to the topical exposure [@alexander2007]. Imidacloprid injected into the abdomen of American cockroaches *Periplaneta americana*, killed 50 % of animals at 1 nM [@ihara2006]. Concentrations of 285.49 nM and 1.83 $\mu$M were required to observe the same effect upon oral or contact exposure, respectively in the peach aphid *Myzus persicae* [@nauen1996]. Effective doses obtained from oral and topical studies are most relevant, since these are the two main routes of exposure of pests in the agriculture.
The LC(D)50 values of neonicotinoids are at least 6-fold higher than those of structurally related nicotine, highlighting the superiority of neonicotinoids as pest controlling agents.
\newpage
```{r toxallanimal, echo=FALSE, warning = FALSE, message = FALSE}
library(kableExtra)
library(dplyr)
footnotea <- "References (Ref) 16: Shi et al. 2011, 1: Nauen et al. 1996, 2: Mota-Sanchez et al. 2006, 3: Bass et al. 2011, 4: Zewen et al. 2003, 5: reported in Tomizawa et al. 2000, 6: Alexander et al. 2007, 7: De Cant and Barrett 2010, 8: Luo et al. 1999, 9: De Cant and Barrett 2010, 10: Wang et al. 2012, 11: Wang et al. 2015, 13: = Dong et al. 2017, 14: Cresswell 2011, 15: = Godfray et al. 2015"
toxic <-data.frame (
Drug = c("Thia", "Clo", "Nit", "Imi", "Imi", "Nic", "Nic", "Imi", "Thtx","Imi", "Thtx","Nic", "Dino", "Thia", "Imi", "Nit", "Thia", "Clo", "Ace", "Imi", "Thia", "Nic", "Imi", "Imi", "Imi", "Imi", "Imi", "Clo", "Thx", "Clo", "Clo", "Clo", "Clo", "Clo", "Clo", "Imi", "Imi", "Clo", "Clo", "Clo", "Imi", "Acet", "Nit", "Clo", "Thia", "Thia"),
Species = c("A. gossypii", "A. gossypii", "A. gossypii", "M.persicae", "M.persicae", "M.persicae", "M.persicae", "M.persicae", "M.persicae","M.persicae", "M.persicae", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "L. decemlineata", "N.lugens","M. domestica", "M. domestica", "E. longimanus", "E. longimanus", "A. mellifera", "A. mellifera", "A. mellifera","A. mellifera","A. mellifera", "Bobwhite quail", "Bobwhite quail", "Mallard duck", "Mouse", "O. mykiss", "L. macrochirus", " E. fetida", "E. fetida", "E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", " E. fetida", "M. incognita"),
Taxon = c("Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect","Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "Insect", "insect", "Insect", "Insect", "Bird", "Bird", "Bird", "Mammal", "Fish", "Fish", "Earth worm", "Earth worm","Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Earth worm", "Nematode"),
LD50 = c("-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "0.35 ng/mg", "0.05 ng/mg", "6.8 ng/beetle", "0.34 ng/beetle", "0.20 ng/beetle", "0.18 ng/mg", "0.15 ng/mg", "0.14 ng/mg", "0.82 ng/mg", "3 ng/mg", ">50 ng/mg", "-", "-", "-", "0.81 ng/mg", "0.81 ng/mg", "0.44 ng/mg", "0.24 ng/mg", ">200 mg/kg (acute)", ">5040 mg/kg (5 days)", ">5230 mg/kg (5 days)", "389-465 mg/kg", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-"),
LC50 = c("9.35 $\\mu$M", "7.29 $\\mu$M", "9.12 $\\mu$M", "1.83 $\\mu$M", "285.49 nM", "1.85 mM", "27.74 mM", "3.87 $\\mu$M", "2.19 $\\mu$M", "257.52 nM", "1.64 mg/L", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "-", "82.13 nM (24 hrs)", "2.54 nM (96 hrs)", "6.88 $\\mu$M", "-", "-","-","-","-", "-", "-", "-", "424.51 $\\mu$M", "468.60 $\\mu$M", "4.81 $\\mu$M (24 hours)", "2.74 $\\mu$M (48 hours)", "62.08 $\\mu$M (14 days)", "24.24 $\\mu$M (7 days)", "24.27 $\\mu$M (14 days)", "11.93 $\\mu$M (14 days)", "12.08 $\\mu$M (14 days)", "26.75 $\\mu$M (14 days)", "3.72 $\\mu$M (14 days)", "10.60 $\\mu$M (14 days)", "143. 24 $\\mu$M (6 hours)"),
Bioassay = c("Topical", "Topical", "Topical", "Topical", "Oral", "Topical", "Oral", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "?", "?", "Topical", "Topical", "Oral", "Oral", "Topical", "Topical", "Topical", "Oral","Oral", "Oral", "Oral", "?", "?", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical"),
Ref = c("16", "16", "16", "1", "1", "1", "1", "3", "3", "3", "3", "2", "2", "2", "2", "2", "2", "2", "2", "4", "5", "5", "6", "6", "14", "14", "15", "15", "15", "7", "7", "7", "7", "7", "7", "8", "8", "9", "10", "10", "11", "11", "11", "11", "12", "13"))
toxic %>%
kable("latex", align = "l", escape = F, booktabs = TRUE, longtable = TRUE,
caption = 'Toxicity of nicotine and neonicotinoids') %>%
kable_styling(font_size=10, position = "center", full_width = FALSE, latex_options = c( "hold_position", "repeat_header")) %>%
footnote(general = footnotea,
threeparttable = TRUE)
```
```{r tox, echo=FALSE, warning = FALSE, message = FALSE}
library(kableExtra)
library(dplyr)
# toxic <-data.frame (
# Drug = c("Thia", "Clo", "Nit", "Thia", "Clo", "Nit", "Nic"),
# Species = c("Aphis gossypii", "Aphis gossypii", "Aphis gossypii", "Aphis gossypii", "L. decemlineata", "L. decemlineata", "L. decemlineata"),
# Taxon = c("Insect", "Insect", "Insect", "Insect","Insect", "Insect", "Insect"),
# LD50 = c("", "", "", "0.18 ng/mg", "0.15 ng/mg", "0.20 ng/mg", "0.35 ng/mg"),
# LC50 = c("9.35 $\\mu$M", "7.29 $\\mu$M", "9.12 $\\mu$M", "", "", "", ""),
# Bioassay = c("Topical", "Topical", "Topical", "Topical", "Topical", "Topical", "Topical"),
# Ref = c( "Mota-Sanchez et al. 2006", "Mota-Sanchez et al. 2006", "Mota-Sanchez et al. 2006"))
#
# toxic %>%
# kable("latex", align = "l", escape = F, booktabs = TRUE, longtable = TRUE,
# caption = 'Toxicity of nicotine and neonicotinoids') %>%
# kable_styling(font_size=10, position = "center", full_width = FALSE, latex_options = c( "hold_position", "repeat_header"))
# to calculate the ng/mg cocroach divided by 175, bee by 100
```
#### Selectively toxic to insect pests ###{#seltox}
One of the key determinants of success of agrochemical compounds is their ability to selectively target insects over non-target species. Neonicotinoids are generally effective at ~ 2 $\mu$M concentrations against piercing-sucking pest infestations, whereas their LD50s is in the region of 0.2 - 0.3 ng/mg of body weight [@mota-sanchez2006; @zewen2003; @tomizawa2000; @alexander2007]. The LC(D)50 values for non-target species is at least 2 times higher (Table \@ref(tab:toxallanimal)). Honeybees (*Apis mellifera*) are among the most susceptible non-targets, with the average LC50 and LD50 values for imidacloprid of 7.04 $\mu$M and 4.5 ng per mg of body weight, respectively [@cresswell2011]. Some studies report high potency of neonicotinoids on earth worms, with the LC50 as low as 2.74 $\mu$M on redworm *Eisenia fetida* (*E. fetida*) [@luo1999]. Fish and birds are hundred fold less susceptible [@decant2010], whereas mammals are the least susceptible with LD50 doses higher than 130 mg/kg of body weight [@decant2010; @legocki2008]. This differential susceptibility between target and non-target species, in expected to enable an environmental release of neonicotinoids at concentrations which will exterminate pests without killing the non-targets. Indeed, field realistic concentrations of neonicotinoids are higher than those causing lethality of the most susceptible species (i.e. worms and honey bee).
Concentrations of neonicotinoids in nectar, wax and pollen was been investigated. Generally, the highest concentrations are found in the former [@goulson2013]. @cresswell2011 determined that the imidacloprid is present in most commonly bee-consumed nectar at 2.3 - 20 $\mu$M. He also estimated that the average realistic amount of imidacloprid in a nectar load is 0.024-0.3 ng. This is higher than the reported honeybee LC50 and LD50 values of 7.04 $\mu$M and 4.5 ng, respectively [@cresswell2011].
The concentration of neonicotinoids in soils with several years of history of treatment by seed coating were also investigated. Samples were collected 10 months after sowing [@botias2015] just before [@jones2014; @schaafsma2016] or after planting [@perre2015]. The average reported concentrations of neonicotinoids in the centre of the field are in the region of 20 $\mu$M, which is higher than the concentrations effective against earth worms and nematodes; the LC50 against the most susceptible species is 2.74 $\mu$M [@luo1999].
<!-- [@botias2015] -->
<!-- Selected 5 oilseed or wheat fields treated for at least three previous years with neonicotinoids. Soil samples were collected 10 months after sowing. The presence of neonicotinoids was detected using spectrometry. oilseed rape cropland : mean 3.46 ng / g of tmx, 13.28 clo, imc 3.03, thc 0.04 ng / g. -->
<!-- Margin : tmx 0.72 ng / g, clo 6.57, imc 1.92, thc $\le$ 0.01 and this is not significantly differen t from the margins of the wheat fields. -->
<!-- Based on laboratory conditions, half life of neonicotinoids is highly variable ranging from 8 days for nitenpyram to almost 7000 for clothianidin [reviewed in @bonmatin2015]. Several field studies were conducted to estimate dissipation time of neonicotinoids. @schaafsma2016 collected 18 Canadian and pre-planting soil samples over 2 successive years. These samples originated from variable-crop fields which had been treated for at least 4 successive years. Concentration of clothianidin and thiacloprid was measured in year 1 samples and averaged at 19.22 $\mu$M. Based on the history of crops planted and insecticide recharge regime, the degradation half-life (TD50) of clothianidin was estimated at 0.4 years 9 (146 days). It was also concluded that clothianidin and thiacloprid residues would accumulate for 3-4 years and plateau at ~ 23 $\mu$M in agricultural fields with one-year insecticide application routine. Using similar approach, @schaafsma2016 also estimated the DT50 of imidacloprid at 208 days. -->
<!-- Based on these data the average total neonicotinoid concentration is in the region of 20 $\mu$M. Therefore, average concentrations of neonicotinoids in the field are lower than doses causing worm lethality. However, higher concentrations of neonicotinoids may be experienced, particularly during the sowing period. -->
<!-- It is also probable that the concentration of neonicotinods is higher near the coated seed. The coating typically contains from 0.17 - 1 mg of the active ingredient [@goulson2013]. Up to 98 % of the active ingredient leaches into the environment [@goulson2014]. Therefore upper concentrations of environmental doses may have sublethal effect on soil inhabiting worms and nematodes. -->
### Sub-lethal effects of neonicotinoids on non-target species ###{#sublethal}
#### Insect pollinators ####{#sublethalbees}
Pollinating services are provided by many species of bees, flies, beetles and bats [@thapa2006]. Eighty percent of the total pollinating activity is carried out by bees [@thapa2006]. There are over 20 000 species of bees, 267 of each life in the UK [@breeze2012a]. Among them are honeybees (*Apis mellifera*, *A. mellifera*), bumblebees and over 220 species of solitary bees. Honeybees and bumblebees served as platform to determine toxic effect of neonicotinoids on biological pollinators. Although field realistic neonicotinoids are not expected to kill bees, a substantial body of evidence from lab- and field- based experiments suggest that they can impair on the cognitive function and reproduction of these biological pollinators.
##### Reduced olfactory learning and memory
Honeybees are social insects, living in colonies where a clear division of labor exists. Worker bees account for up to 95 % of the entire colony [@sagili2011]. These non-reproductive females are responsible for finding, collecting and transporting nectar or pollen from the flowering plants to the hive. Their ability to process, learn, memorise sensory cues and navigate through the environment is crucial for the survival and overall success of the entire hive. The olfactory learning can be measured with Proboscis Extension Reflex (PER) paradigm. PER conditioning is a process by which an insect learns to extend its tongue (proboscis) in response to olfactory stimuli, typically evoked by the sugar solution contacting the antenna [@takeda1961]. Alternatively, their olfactory learning capability can be measured by scoring various aspects of foraging behaviour. Bees exposed to 93 nM of imidacloprid in the sugar solution showed reduced ability to olfactory learn, as showed by the PER [@decourtye2004]. Imidacloprid also compromised foraging activity of honeybees [@decourtye2004; @gill2012] and bumblebees. 4- week exposure of early-developmental stages to imidacloprid at 23 nM in pollen reduced the foraging efficiency and duration [@gill2012]. Neonicotinoids also reduced the number of bees returning to hives. Increased home failure were noted in honeybees exposed to a single dose of thiamethoxam at 1.35 ng [@henry2012] and in bumblebees fed diet containing imidacloprid at 23 nM and 3 nM for 2 weeks [@feltham2014].
<!-- #### Learning and memory -->
<!-- Honeybees exposed to a , reduced Reducing homing rates were also noted in a study conducted by @schneider2012, where bees were exposed to clothianidin, thiamethoxam and imidacloprid at doses ranging from 0.05 ng/bee to 6 ng/bee. -->
<!-- <!-- Reduced response in conditioning assay was noted in honey bees treated with imidacloprid at 10 and 100 nM chronically (4 days), which were then allowed to recover for three days [@williamson2013]. -->
##### Impaired Reproduction
The reproduction of bees is performed by a single member of the colony - the queen. She lays fertilised and unfertilised eggs into cells of the comb. These eggs develop into larva, pupa and adult male drones and female workers. Neonicotinoids have been shown to negatively impact on various aspects of bees' fecundity. 14-days exposure of bumblebees to imidacloprid at 2, 4 and 23 nM, increased number of empty pupal cells [@whitehorn2012]. Imidacloprid has been shown to reduce the total size of treated colonies, reduce the brood production [@laycock2012] and the number of born queens [@whitehorn2012] and workers [@gill2012] of bumblebees. Exposure of drones to thiamethoxam at 15.5 nM and clothianidin at 6 nM led to shortening of life-spam and hindered sperm vitality and quantity [@straub2016]. Negative impact of neonicotinoids was also seen in the field-studies. Bumblebees foraging on oilseed rape coated with clothianidin, exhibited decreased queen production, colony growth and reduced bumblebee density [@rundlof2015]. More recently, international field studies confirmed negative effects of neonicotinoids on overwinter success and reproduction of honey and wild bees [@woodcock2017].
Insect pollinators play an important ecological, economical and evolutionary role. They pollinate wild plants [@kwak1998], food crops [@klein2007] and promote plant sexual reproduction [@gervasi2017]. The emerging evidence of the negative impact of neonicotinoids on bees and honeybees, restricted their use in Europe in 2013 [@eucomission2013] and is likely to lead to a complete ban of neonicotinoids in the future [@efsa2018].
#### soil worms ####{#sublethalsoilworm}
Soil worms includes segmented worms representing Phylum Annelida and the round worms from Nematoda phylum. The segmented worms include earth dwellers such as redworm *Eisenia fetida* and the common earthworm *Lumbricus terrestris*. All annelids are free-living. Nematodes on the other hand are classified as parasitic and non-parasitic. *C. elegans* is an example of a non-parasitic worm, which feeds on bacteria associated with rotting fruits or vegetables. Soil parasitic worms can be divided into those that infect plans or animals. They can cause large health, life-stock and agricultural loses. For example, *Melyidogyne* species including *Meloidogyne incognita*, account for 95 % of all plant infestation species and cause a loss of 5 % of global crops [@taylor1978] including loss tomatoes, cowpea and blackpepper.
To investigate the effects of neonicotinoids on soil dwellers, worms were exposed to various concentrations of drugs in solution, or in artificial soils. The concentrations effective against various behaviours and parameters such as fecundity, body weight, locomotion, sensory processing and burrowing were noted.
##### Earth worms
Clothianidin and thiacloprid at concentrations $\ge$ than 1.2 $\mu$M and the EC50 of 5.1 $\mu$M and 3.4 $\mu$M, respectively reduced the reproductive potential of redworm *E. fetida*, as measured by the cocoon production [@gomez-eyles2009]. Neonicotinoids showed a negative impact on the reproduction of other species, including *Lumbricus rubellus* (*L. rubellus*) [@baylay2012], *Dendrobaena octaedra* (*D. octaedra*) [@kreutzweiser2008] and *Eisenia andrei* [@alves2013]. Reduction of body weight of *E. fetida* and *D. octaedra* were observed after 14-day treatment with imidacloprid at 27.08 and 54.75 $\mu$M [@kreutzweiser2008]. Imidacloprid at 488.85 nM to 7.82 $\mu$M increased avoidance of *E. andrei* [@alves2013], whereas at 782 nM it reduced the *A. caliginosa* burrowing depth and length [@dittbrenner2011]. Burrowing of *L. terrestris* was also impacted, but at higher imidacloprid concentrations [@dittbrenner2011].
##### Soil nematodes #####{#soilnematodesneonicstoxicity}
Neonicotinoids also induce a sublethal effect on the the free-living nematode *C. elegans*. Thiacloprid and imidacloprid have an effect on the reproduction of *C. elegans* with EC50 of 1.14 nM and 2.09 mM, respectively [@gomez-eyles2009]. Thiacloprid at 37 nM has an effect on chemosensing, whereas at 18 $\mu$M it impairs motility of this free living nematode [@hopewell2017]. Impaired motility of *C. elegans* in response to $\ge$ 120 $\mu$M imidacloprid was also recorded [@mugova2018]. Taken together, neonicotinoids have sublethal effects on earth worms and soil nematodes at concentrations as low as nM.
Most of the doses effective against worms are higher than the average doses of neonicotinoids in the field. However, the presence of clothianidin, imidacloprid and thiamethoxam has been detected at lower than average levels, such as 80.10 nM for imidacloprid, 23.01 nM for imidacloprid and 68.56 nM for thiamethoxam [@jones2014]. This suggests that the environmentally relevant concentrations of neonicotinoids may negatively impact on the the well-being of soil dwellers.
<!-- Data regarding toxicity of neonicotinoids on soil worms and nematodes focuses on earthworm *Eisenia fetida* (*E. fetida*, redworm). The toxicity is assessed either following treatment in solution or in the artificial soils. In solution, the LC50 of imidacloprid after 24 hour exposure is 62.08 $\mu$M [@luo1999]. This increases to 24.24 $\mu$M after 48 hour exposure [@luo1999]. Clothianidin is less potent; its LC50 after 14 days is 24.27 $\mu$M [@decant2010]. -->
#### Birds
Evidence suggests that environmental relevant concentrations of neonicotinoids may have negative effects on birds [@hallmann2014]. In particular, granivorous and insectivorous birds may be at risk, should they consume neonicotinoid-contaminated seeds and/or insects [@goulson2013]. Environmental neonicotinoids may impair their migratory ability [@eng2017] and negatively impact on their growth and reproduction [@sanchez-bayo2016].
The environmental ecotoxicity of neonicotinoids highlights the importance of selective toxicity of agrochemical compounds in successful pest management programmes. The development of new insecticides, effective against pest and not beneficial insects or other species requires a detailed knowledge of their mode of action.
## Neonicotinoids act on the cholinergic neurotransmission as a nicotine mimic
<!-- ### Nicotinic acetylcholine receptors -->
<!-- Name Cys-loop was devoted because all members contain a disulphide bond between cystines separated by a highly conserved sequence of 13 amino acids. Cys-loop receptors also share a common topology (Figure \@ref(fig:nachr-topology-label)): five receptor subunits arranged around the central pore. The five subunits can be the same, or different and form homo- or hetero-pentamers. -->
<!-- (ref:nachr-topology) **Topology of cys-loop receptors.** A single subunit of the cys-loop receptor consists of 4 transmembrane subunits (M1 - M4) and a conserved disulphide bridge in the N-terminal extracellular domain. 5 subunits come together to form a functional receptor (b). Receptors can be formed from either 5 identical (c) or from a combination of different subunits (d). -->
<!-- ```{r nachr-topology-label, fig.cap="(ref:nachr-topology)", echo=FALSE, fig.scap= 'Topology of cys-loop receptors.', fig.align='center', out.height = '80%', echo=FALSE} -->
<!-- knitr::include_graphics("fig/general_intro/png/nAChR_topology_3.png") -->
<!-- ``` -->
### nAChR structure ###{#structure}
nAChRs are members of the pentameric ligand-gated ion channels which are found in a diversity of species from bacteria to human. They are the representatives of the Cys-loop superfamily of channels which also include $\gamma$ -aminobutyric acid type A (GABA) receptors, 5-hydroxytryptamine type-3 receptors (5-HT3), and glycine receptors. Structural studies of the nAChRs from the muscle of the electric fish *Torpedo* (Figure \@ref(fig:structure-nachr-label)a) shed light on the the stoichiometry, the shape and the size of Cys-loop receptors.
The identity of the NMJ nAChR was first investigated using indirect, biochemical approaches. Membrane bound NMJ receptors were isolated by in-situ cross-linking with a radiolabelled antagonist and a subsequent purification. SDS-resolved fragments pattern suggesting the pentameric nature of these receptors [@hucho1986; @schiebler1980] of the total size 270 000 kDa composed of 4 different subunits namely $\alpha$, $\beta$, $\delta$ and $\gamma$ arranged into a pentamer. The SDS-PAGE pattern and the analysis of nAChR complexes purified with the use of non-denaturing buffer led to a suggestion that the stechiometry is: $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise) [@reynolds1978]. Heterologous expression in Xenopus oocytes confirmed that 4 subunits are needed to achieve expression. In the absence of any other one of the subunits, the responses to acetylcholine were either absent or greatly reduced, therefore 4 subunits are required for the normal function of this protein [@mishina1984].
The stiochiometry and structural details of muscle type nAChRs were confirmed by more direct structural approaches: cryo- and electron-microscopy. The receptor protein is in the shape of an elongated, 125 Å funnel [@unwin1993; @toyoshima1990]. It consists of large, extending to the synaptic space [@toyoshima1990] N-terminal ligand binding domain [@sigel1992], the membrane spanning pore-domain [@eisele1993], intracellular MA helix [@toyoshima1990; @unwin1993], and C-terminus positioned extracellularly. Constituting nAChR subunits are arranged pseudosymmetrically, around the central ion conduction pore [@brisson1985]. The subunit composition of the neuromuscular nAChR follows the strict order of $\alpha1$, $\beta1$, $\delta$, $\alpha1$, $\gamma$ (clockwise). Each subunit of the nAChR contains 4 transmembrane helices [@noda1982; @noda1983] named M1, M2, M3 and M4, as moving from N- to C- terminus. M1, M3 and M4 are exposed to the plasma membrane [@blanton1994], shielding M2, pore-forming helices [@imoto1986; @hucho1986] from the hydrophobic environment of the bilayer. As the outer helices progress from the outer to the inner leaflet of the membrane, they tilt inwards [@miyazawa2003], narrowing down the width of the channel. M2 on the other hand, bends roughly in the middle of the bilayer [@unwin1995], where it forms the most restricted part of the ion conductivity pathway. There are hydrophobic interactions between the outer helices, which stabilise the outer wall of the receptor and hence limit the conformational changes adopted by the inner helix. In contrast there are no extensive bonds between the inner and outer helices [@miyazawa2003]. As lining pore structures, the inner helix and flanking sequences contain molecular determinants for ion selectivity, permeability, the rate of conductance and gating. These were investigated by pharmacological, biochemical and electrophysiological approaches. [@imoto1988; @imoto1991; @konno1991] investigated the function of several rings of anionic and neutral amino acids with side chains facing towards each other in the centre of the pore. The so called intermediate ring (constituting of $\alpha$E241 and equivalent) and the adjacent to $\alpha$ E241 in helical configuration central ring, (formed by $\alpha$ L244 and equivalent) form a narrow constriction of the ion pore, hence have the strongest effect on the conductance rate [@imoto1991; @imoto1988]. In addition, the negatively charged side chains of intermediate ring are crucial for ion selectivity [@konno1991]. The gating of the channel is governed by conserved leucine residues, slightly towards the extracellular side from the centre of the bilayer with side chains projecting inwards [@unwin1995], hence occluding the passage for ions.
<!-- ALSO TALK ABOUT THE NEGATIVELY CHARGED VESTIBULE HERE -->
(ref:structure-nachr) **Structural features of the nicotinic acetylcholine receptor.** Torpedo nAChR is a transmembrane protein, made up of 5 subunits (colour-coded), arranged around the ion conductivity pore. Each subunit consists of extracellular ligand-binding, transmembrane and intracellular domain (a) (PBD code:2BG9). Extracellular domain of a single subunit consists of 10 $\beta$-strands and N-terminal $\alpha$-helix. It contains a disulphide bridge between Cys192 and Cys193 (highlighted in yellow) (b). Fully formed receptors have five ligand binding pockets formed by the contributions from the neighboring subunits (A-B, B-C, C-D, D-E and E-A), named the principle and the adjacent components, respectively. Top view of the molluscan AChBP (PDB:1I9B) with amino acids forming the agonist binding site in ball and stick representation (c). Images generated with the UCSF Chimera software.
```{r structure-nachr-label, fig.cap="(ref:structure-nachr)", fig.scap='Structural features of the nicotinic acetylcholine receptor.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/crystal_structure_nachr.png")
```
### Model of the nAChR binding site ###{#modelodnachbinding}
Determination of the crystal structure of the molluscan acetylcholine binding protein [@brejc2001, Figure \@ref(fig:binding-pocket-label)b and c)] provided a platform to study the ligand binding domain of nAChRs. Acetylcholine binding protein (AChBP) is a soluble protein, secreted by snail glial cells into the cholinergic synapses to bind released ACh and modulate neurotransmission [@sixma2003]. It shares 24 % sequence identity with mammalian $\alpha7$ homopentameric receptor. It is has similar structure to the extracellular domain of the nAChRs mammalian $\alpha1$ [@dellisanti2007] and $\alpha7$ [@li2011]. It is a homopentamer with N-terminal helix and 10 $\beta$sheets. It also shares similar pharmacological properties to this receptor. AChBP binds to classical nAChR agonist and antagonists: nicotine, acetylcholine and $\alpha$-bungarotoxin [@smit2001]. Therefore AChBP is considered a good model for the nAChR ligand-binding domain structural studies. The structures of AChBP inactive [@brejc2001], bound to agonist and antagonist [@celie2004; @hansen2005], chimera $\alpha1$ [@dellisanti2007] and $\alpha7$ are known [@li2011]. The common structural features of the ligand binding site emerge from all available data. Here data from the great pond snail *Lymnaea stagnalis* (Ls) will be discussed.
<!-- (it unlike Ac, all aromatic residues in Ls are conserved). -->
### Agonist binding site of nAChRs ###{#bindingsite}
The nicotinic acetylcholine receptor binding pocket is formed on the interface of the adjacent subunits [@brejc2001; @middleton1991; @blount1989, Figure \@ref(fig:binding-pocket-label)]. In case of the neuromuscular heteropentameric receptors, it constitutes of $\alpha$ and non-$\alpha$ subunit contributions, whereas in homopentameric or $\alpha$ heteropentameric receptors it is made up of neighboring subunits. The principal, $\alpha$-subunit site subsides amino acid side chains originating from discontinuous loops A (loop $\beta4$-$\beta5$), B (loop $\beta7$-$\beta8$) and C (loop $\beta9$-$\beta10$), whereas the complementary (non-$\alpha$) subunit contributes amino acid side chains originated from loop D (loop $\beta2$-$\beta3$), E (loop $\beta5$-$\beta6$) and F (loop $\beta8$-$\beta9$). Specific residues involved in the formation of the ligand binding pocket were depicted by the molluscan AChBP (Figure \@ref(fig:binding-pocket-label)). Amino acids of the principal component are: Tyr93, Trp147, Tyr188 and Tyr195, whereas non-$\alpha$ component contributes Trp53, Gln55, Arg104, Val106, Leu112 and Met114, Tyr164.
(ref:binding-pocket) **The ligand binding domain of acetylcholine binding protein.** Agonist binds to the loops situated in the adjecent subunits of the nAChR. In muscle type receptor, there are 2 binding sites, and thee are 5 in homopentameric receptor (a). The ligand binding pocket of the AChBP (PDB:1I9B) is formed from loops of the neighboring subunit (b). Principal and complementary subunits contributed amino acids from loops A, B, C and D, E, F, respectively (c). Crystal structure of the AChBP generated with the USCF Chimera software.
```{r binding-pocket-label, fig.cap="(ref:binding-pocket)", fig.scap='The ligand binding domain of acetylcholine binding protein.', fig.align='center', echo = FALSE}
knitr::include_graphics("fig/general_intro/png/binding_pocket_3.png")
```
### Pharmacophore of nAChR agonists ####{#pharmacophore}
Crystal structure of the AChBP bound to acetylcholine, carbamylcholine, nicotine [@celie2004] and its analogue epibatidine [@hansen2005] provided some general features of the nAChR binding pocket. More recently, structures of mammalian receptors: $\alpha9$ [@zouridakis2014] bound to methyllycaconitine, the artificially expressed $\alpha2$ extracellular domain bound to epibatidine [@kouvatsos2016] and $\alpha4\beta2$ receptor bound to nicotine [@morales-perez2016] have been obtained. These structures provide details of how structurally varied agonists bind to nAChRs.
Agonist are buried on the interface of the neighboring subunits. They are stabilised in the binding pocket by 5 conserved aromatic residues from A, B and C loops of the principal site (known as the aromatic box), which engulf the cationic atom of the quaternary ammonium atom of the of bound agonist. There are two major and conserved features: cation - $\pi$ interaction and hydrogen bond.
Cation -$\pi$ interactions are formed between the cationic nitrogen and aromatic side chain of tryptophan in loop B (143 in AChBP) of the principal side of the binding pocket. Whereas hydrogen bond is formed between the bond acceptor and amino acids of the complementary side of the binding pocket via water molecule [@celie2004; @olsen2014]. In ACh and nicotine bound to AChBP structures, water bridges to the oxygen of the carbonyl group of Leu112 and amide group of Met114 in loop E [@olsen2014; @celie2004].
Choline is an agonist lacking the hydrogen bond acceptor, which is likely contributing to its lower efficacy and affinity. Heterologously expressed $\alpha7$ are activated with choline with the EC50 between 0.4 and 1.6 mM, whereas the EC50 of nicotine is between 49 and 113 $\mu$M [@wonnacott2007]. Radiolabelled studies report up to 500 times lower binding affinity of choline in comparison to nicotine [@wonnacott2007].
Cation-$\pi$ interactions and a hydrogen bond are the staple features of the ligand-receptor interactions, however there are also some less conserved characteristics. For example, in AChBP-nicotine structures, there is a hydrogen bond between cationic nitrogen of the agonist and the carbonyl of TrpB in the principal site of the receptor [@celie2004]. Similarly, in human $\alpha2$ structures a hydrogen bond between the cationic nitrogen of apibatidine and carbonyl of TrpB or Tyr in loop A is formed [@kouvatsos2016]. In contrast, cationic nitrogen of ACh forms cation-pi with Trp53 in loop D of AChBP and $\alpha2\beta2$ proteins [@morales-perez2016; @olsen2014].
(ref:pharmacophore) **Nicotinic acetylcholine receptor agonist pharmacophore.** Agonists of the nAChRs contain hydrogen bond acceptor (red) and cationic nitrogen (blue) (a). Interactions with the receptor based on the crystal structure of the AChBP and nicotine (PB:1UW6) (b). b is taken from @blum2010. Cation-$\pi$ interactions between protonated nitrogen of tertiary amine and indole of TrpB.
```{r pharmacophore-label, fig.cap="(ref:pharmacophore)", fig.scap='Nicotinic acetylcholine receptor agonist pharmacophore.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/nicotinic_interactions.png")
```
### Pharmacophore of neonicotinoids ###{#pharmacophoreofneonics}
Structure of AChBP proved to be valuable in determining structural elements which may account for neonicotinoids’ selectivity. @ihara2008; @talley2008; @ihara2014 derived crystal structures of the great pond snail (Lymnaea stagnalis, Ls) and California sea slug (Aplysia californica, Ac) AChBP complexed with bound neonicotinoids (imidacloprid, clothianidin, thiacloprid), and non-selective nAChR ligands- nicotinoids (nicotine, epibatidine and desmotroimidacloprid). Comparison of these structures revealed differences in binding modes between nicotinoids and neonicotinoids (see Appendix \@ref(fig:pharacophore-seq-label) for sequence alignment), which allowed for predictions of the binding interactions between neonicotinoids and insect receptors (Figure \@ref(fig:imi-binding-label)).
Structures of wild-type and mutant AChBP with increased affinity to neonicotinoids revealed no differences in the interactions between imidacloprid, clothianidin and thiacloprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2008; @talley2008; @matsuda2009; @ihara2015]. Thus, to describe the differences between neonicotinoids and nicotinoids, crystal structures of Ls AChBP complexed with nicotine and imidacloprid are compared (Figure \@ref(fig:imi-binding-label)). The positioning of the pyridine ring of imidacloprid and nicotine is virtually identical. The nitrogen forms identical interactions: hydrogen bond with the amide group of Met114 and carbonyl group of Leu102 of loop E, via water molecule [@celie2004; @ihara2008; @talley2008]. In addition, chlorine atom of imidacloprid makes van der Waals interactions with oxygen of Ile106 and oxygen of Met116 of AChBP [@talley2008].
Regarding 5-membered ring interactions, in nicotine-bound structures, the cationic nitrogen forms 3 interactions when bound to AChBP: the cation-$\pi$ with the ring of Trp143 (TrpB), as well as hydrogen bond with the backbone carbonyl of TrpB [@celie2004], as well as the cation-$\pi$ interaction with Tyr192 in loop A [@matsuda2009]. In imidacloprid bound structures, the ring stacks with aromatic residue Tyr185 of loop C (this interaction is also seen in epibatidine-bound structures) [@ihara2008]. These stacking interactions result in the formation of CH-$\pi$ interactions between the methyline bridge (CH2-CH2) of imidacloprid and TrpB. All residues described so far are conserved in other agonist-bound nAChR structures, therefore do not account for neonicotinoids-selectivity.
The differences come to light when one begins to dissect the interactions between imidacloprid ring substituents and the AChBP. Partially positive nitro group (NO2) of imidacloprid bridges to glutamine of loop D (Gln55) via hydrogen bond. This interaction was also seen in thiacloprid bound AChBP and in the Gln55Arg mutant of AChBP bound to clothianidin [@ihara2014]. It is interesting that in some nAChR subunits, such as *M. pyrsicae* $\beta1$, honeybee $\beta1-2$ and $\alpha7$, glutamine corresponds to basic residue (lysine/arginine). Basic residues electrostatically attract nitro group, possibly forming a hydrogen bond, which in turn would strengthen the stacking and aromatic CH/$\pi$ hydrogen bond interactions between the ring and the protein. In contrast, other subunits such as human $\alpha7$ or *C. elegans* ACR-16 and EAT-2 contain either acidic or polar amino acids in the exact position, repulsing or forming no electrostatic interactions with imidacloprid, which could at least in part explain low sensitivity of nematodes and mammals to neonicotinoids (Section \@ref(soilnematodesneonicstoxicity)).
(ref:imi-binding) **Pharmacophore of nicotine and imidacloprid**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with nicotine and imidacloprid.
```{r imi-binding-label, fig.cap="(ref:imi-binding)", fig.scap= "Residues forming interactions with nicotine and neonicotinoids in the binding site of AChBP", fig.align='center', out.height="70%", echo=FALSE}
knitr::include_graphics("fig/general_intro/png/nicotine_imidacloprid_structure.png")
```
Analysis of the structure of Gln55Arg AChBP mutant complexed with neonicotinoids revealed another residues with a potential to confer high binding affinity of these compounds. Basic residue of loop G, namely Lys34, forms electrostatic interaction with the NO2 group of clothianidin and CN group of thiacloprid, but does not interact with imidacloprid (Figure \@ref(fig:all-neonics-binding-label)) [@ihara2014].
(ref:all-neonics-binding) **Pharmacophore of neonicotinoids**. Schematic representation of the agonist binding site of AChBP, highlighting residues interacting with imidacloprid, thiacloprid, thiacloprid and nitenpyram. For nitenpyram, the interactions are predicted based on other structures.
```{r all-neonics-binding-label, fig.cap="(ref:all-neonics-binding)", fig.scap="Residues forming interactions with neonicotinoids in the binding site of AChBP", fig.align='center', echo = FALSE, }
knitr::include_graphics("fig/general_intro/png/binding_all_neonics.png")
```
#### Selectivity of neonicotinoids
Based on the structural data, it has been proposed that the basic residue in loop D and G interacting with the nitro or cyano group of neonicotinoids is important in confirming neonicotinoid selectivity in insect nAChR subunits. This is supported by the genetic studies. Loop D arginine to threonine mutation naturally occurring in $\beta1$ subunit of peach aphid *Myzus persicae*, and cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017; @bass2011] gives rise to neonicotinoid resistance. Additionally, @shimomura2002 showed that mutation of glutamine in loop D of human $\alpha7$ to basic residue, markedly increases sensitivity of the $\alpha7$ homopentamer to nitro-containing neonicotinoids, whereas mutation of loop D threonine to acidic residues in chicken $\alpha4\beta2$ and hybrid chicken/Drosophila $\alpha2\beta2$ receptor had an opposite effect [@shimomura2006]. Interestingly, described mutations did not influence the efficacy to nicotinoids, suggesting this interaction is specific to neonicotinoids. In addition, double mutant of avian $\alpha7$ nAChR in which equivalent of Gln55 and Lys34 were mutated to basic residues showed increased binding affinity of thiacloprid and clothianidin, but not nicotine or acetylcholine [@ihara2014], providing further evidence that these residues are important in conferring high binding affinity of neonicotinoids.
Genetic studies identified other amino acids with a potential importance in conferring neonicotinoid-selectivity. Imidacloprid-resistant strain of *Nilaparvata lugens* has been found to have Y151S mutation in loop B of $\alpha1$ and $\alpha3$ nAChR subunits [@liu2005]. This residue corresponds to LsAChBP H145 of the loop B.
Loop B, D and G originate from the complementary site, but the principal site may also play a role. Studies on Drosophila/chicken $\alpha2\beta2$ hybrid and chicken $\alpha2\beta4$ receptors showed that the presence of nonpolar proline in YXCC motif of loop C enhances affinity, whereas mutation of proline to glutamate markedly reduces affinity of neonicotinoids to these receptors [@shimomura2005]. The importance of C-loop regions was also demonstrated by @meng2015 who showed that chimera receptors are deferentially sensitive to imidacloprid at least partly due to the difference in loop C region, equivalent to Ls184-191.
### Cholinergic system in insects
Cholinergic neurotransmission is the process of signal propagation between neurons (or neurons and muscle at the neuromuscular junction (NMJ). Cholinergic synapse is characterised by the presence of several proteins which mediate the breakdown, the synthesis and the processing of the neurotransmitter ACh (Figure \@ref(fig:cholineric-synapse-label)).
#### Protein markers of the cholinergic synapse
<!-- Upon arrival of an electrical signal at the presynpatic terminal, acetylcholine is released into the synaptic cleft. It then binds to nicotinic acetylcholine receptors (nAChRs) expressed at the post-synpatic membrane. Binding of acetylcholine results in depolarisation and excitation of the post-synaptic neurons, or muscle contraction at the neuromusclular junction (NMJ) [@hille1978]. Acetylcholine can also act on other class of receptors, the metabotropic cholinergic G-protein coupled receptor, which are involved in the modulatation of neurotransmission release. The acetylcholine-evoked signal is terminated mainly by synaptic enzyme cholinesterase which hydrolyses acetylcholine to choline and acetate [@fukuto1990], but also by choline uptake to the presynaptic cell by Na^+^-choline transporter. -->
##### Choline acetyltransferase
Choline acetyltransferase (ChAT) is an enzyme synthesizing ACh [@greenspan1980b], by a transfer of acetyl-choA onto choline. There are at least two isoforms in Drosophila, which are produced by alternative splicing from the ChAT gene [@slemmon1982]. One is membrane bound, whereas the other is soluble [@pahud1998]. The soluble isoform performs the majority of enzymatic activity [@pahud1998]. A soluble isoform of ChAT was also isolated from the Locust *Schistocerca gregaria* [@lutz1988].
##### Vesicular acetylcholine transferase
Vesicular acetylcholine transferase (VAChT) mediates ATP-dependent transport [@varoqui1996], which packs ACh into the synaptic vesicles for release [@song1997]. In Drosophila, a single VAChT gene was identified, which is embedded within the ChAT gene [@kitamoto1998].
##### Acetylcholinesterase
Acetylcholinesterase (ACE) is a soluble enzyme that catalyses breakdown of ACh [@chao1980; @hsiao2004]. In Drosophila, it is encoded by the Ace locus [@hall1976]. Acetylcholinesterase is a homodimer covalently bonded by the disulphide bridge [@chao1980; @hsiao2004]. Each monomeric subunits is ~67 kDa, folded into 4-helix bundle [@harel2000].
<!-- The function and properties of these receptors were studied using mammalian and amphibian muscle preparations. -->
<!-- In 1930s, @brown1936; @bacq1937 demonstrated that the application of acetylcholine, as well as nicotine and choline to the isolated mammalian muscle leads to sustained contraction, as showed by the increase in the muscle tension. The muscle contraction was associated with an increase in the frequency of the action potential firings [@brown1936] and the depolarisation of the end-plate [@katz1957]. Acetylcholine-evoked responses could be inhibited by pre-incubation with several compounds, including snake venom proteins, $\alpha$-bungarotoxin [@chang1963]. -->
<!-- Prolonged exposure to high concentration of agonist has a secondary effects on the muscle: desensitisation [@katz1957]. Desensitisation is a post-contraction period, after the removal of the agonist, at which the muscle is relaxed and a subsequent contraction cannot be elicited [@thesleft1955]. Recovery from desensitisation typically lasts few seconds after the agonist removal [@bouzat2008], however the duration varies depending on the receptor, the compound [@briggs1998] and its concentration [@gerzanich1994]. Full recovery may not occur or may be slower if the receptor are exposed to the large doses of agonist for a prolonged time [@katz1957]. -->
<!-- Biochemical, electrophysiological, genetic and pharmacological approaches were utilised to identify the role of nAChRs in neurotransmission. nAChRs were solubilised and purified from the electric organ of the *Torpedo* and reconstituted into liposomes [@anholt1982]. In the presence of acetylcholine and other agonists, the ionic current was elicited, confirming nAChR is an ion channel [@anholt1982]. Acetylcholine evoked activation ans desensitisation of nAChRs, which correspond to the effects in the muscle, provided evidence that nAChRs mediate fast synaptic transmission at the cholinergic synapse. -->
<!-- Kinetic properties of nAChRs were studies with the patch clamp technique. Patch clamp is a technique which enables for the resolution of agonist-evoked responses at a single receptor level [@colquhoun1981; @colquhoun1985]. In response to acetylcholine the channel switches between active and inactive form, with the active form interrupted by the short-lived channel closing bursts. Temporal characterisation revealed the average duration of each event. The receptor remains opened for 1.4 ms; this is interrupted by channel closing bursts of 20 $\mu$s which occur at a frequency of 1.9 closures/opening burst. The mean period between the successive channel openings is 342 ms. Further experiments provided the showed that channel opening is not an all or nothing event. Instead, a channel exhibits multiple conductance states, one on which it is fully opened, named a full conductance state (i.e. the active form), and one in which the channel is partially opened, named the sub-conductance state [@colquhoun1985]. The fine structure of full conductance states (or opening bursts) and sub-conductance states varies depending on the agonist used and a receptor protein [@colquhoun1985; @nagata1996; @nagata1998]. -->
(ref:cholineric-synapse) **Enzymes and transporters at the cholinergic synapse.** Upon release into the synaptic cleft, acetylcholine is broken down to choline and acetate by acetylcholinesterase (AChE). Choline is taken up to the pre-synapse by a choline transporter (ChT). The acetyl group in transferred onto choline to produce acetylcholine. This reaction is catalysed by choline transferase (ChAT). Generated acetylcholine is pumped into the synaptic vesicle by the vesicular acetylcholine transporter (VAChT).
```{r cholineric-synapse-label, fig.cap="(ref:cholineric-synapse)", echo=FALSE, fig.scap= 'Chemical transmission at the cholinergic synapse.', fig.align='center', out.height = '60%', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/synapse_with_enzymes.png")
```
<!-- Development of molecular cloning technique enabled for expression and kinetic characterisation of nAChRs. In 1985, @mishina1984 generated DNA constructs containing cDNA sequences encoding for the muscle type nAChR. These sequences were injected into the *Xenopus oocytes* [@mishina1984]. Upon application of acetylcholine, a current was recorded, suggesting successful cell surface expression. Single channel recordings revealed that in the presence of agonist, nAChR channel switches between active and inactive form. The active form comprises short-lived channel closing and opening [@mishina1986] and longer pauses in-between the receptor twitching. In addition, channel opening does not seem to be an all or nothing event. Instead, a channel exhibits multiple conductance states, one on which it is fully opened, named a full conductance state, and on in which the channel is partially opened, names sub-conductance state [@nagata1996; @nagata1998]. -->
<!-- Intracellulal recordings have shown that this is not due to the muscle cell itself, but rather the insensiticity of membrane receptors [@thesleft1955]. -->
<!-- $\alpha$-bungarotoxin ($\alpha$-bgtx), is a 74-amino acid long, 8 kDa proteins isolated from the venom of a snake *Bungarus multicinctus*. It binds with high affinity to the NMJ post-synaptic membranes [@lee1967] and blocks synaptic responses evoked by acetylcholine and other agonists [@chang1963] by blocking the access of an agoinist to the nAChR binging site [@@mishina1984]. -->
<!-- Behavioural analysis of Drosophila mutants in which cholinegic neurotransmission is diminished, provides evidence for the role of cholinergic neurotransmission in insects. Drosophila Ace null mutants are lethal: flies dye in the early development [@hall1976; @greenspan1980]. CAT mutants Lethal null mutation of drosophila choline acetyltransferase lethal flies dye during embryogenesis. some homozygus are viable but only at 18 deg c (temp sensitive) - some are temperature sensitive: viable at 18 deg due to the sufficient enzyme activity which is dimonished when flies placed in 30 deg. Upon sfift to high temp: characterisitc behaviour: loss of coordinated movement leading to paralysis and evenual death [@greenspan1980b] and disrupted cotrtnership behaviour. REDUCED MOTILITY IN vesicular acetylcholine transporter gene (Vacht) mutant [@kitamoto2000]. -->
<!-- It is effective against plant insect pests [], and used in organic farming in form of tobacco tea [@isman2006] -->
<!-- Exposure of insects to lethal dose of nicotine results in symptoms characteristic for the nervous system intoxication [@chadwick1947] and include increased locomotory activity, followed by convulsions, twitching and eventual death [@mcindoo1943]. -->
#### Localisation of the cholinergic neurons in insects ####{#localisationininsects}
Enzymes and transporters present at the cholinergic synapse have been used as markers for detection of cholinergic neurons in insects. (1) Immunocytochemistry with monoclonal antibodies specific to ChAt and ACE, (2) in-situ hybridization using using sequences complementary to the ChAT mRNA (3) colorimetric technique for detection of AChE activity [@karnovsky1964] (4) and reporter gene fused to the ChaT gene regulatory elements, outlined the presence of cholinergic pathways in Drosophila [@buchner1986; @gorczyca1987; @barber1989; @yasuyama1999], honeybee [@kreissl1989] and locust *Locusta migratoria* [@lutz1987; @geffard1985]. Based on these data, cholinergic neurons are in almost all regions of the brain and in the peripheral nervous system, namely the visual system and the antenna. They are also present in the thoracic, abdominal and the terminal abdominal ganglia involved in the regulation of movement of wings, abdomen and legs, as well as the regulation of the anal and reproductive muscles in insects [@smarandache-wellmann2016].
<!-- . In particular, the muchroom bodies associated with learning, formation of memory and the sensory processing [@heisenberg1998], dorsal lobe where mechanosensory and gustatory neurons project into from the anteanna -->
<!-- In peripheral nervous tissue, cholinergic neurons are the -->
Cholinergic neurons have been also mapped using radiolabelled ligand, specific for nAChRs. $\alpha$-bungarotoxin ($\alpha$-bgtx), is a 74-amino acid long, 8 kDa proteins isolated from the venom of a snake *Bungarus multicinctus*. It binds with high affinity to nAChR [@lee1967] and blocks synaptic responses evoked by acetylcholine and other nAChR agonists [@chang1963]. Incubation of the honeybee brain with $\alpha$-bgtx led to a staining in the optic lobes, antenna lobes, ocellar system and mushroom bodies [@scheidler1990]. This correlated with the staining in the central nervous system of Drosophila [@schmidt-nielsen1977], moth *Manduca sexta* [@hildebrand1979] and cocroach [@orr1990]. Incubation of $\alpha$-bgtx with the ganglia of the american cocroach [@sattelle1983] and cricket *Acheta domesticus* [@meyer1985] identified further regions where $\alpha$-bgtx binds with high affinity: the abdominal ganglion in the region rich in interneurons which make synaptic connections with the sensory afferent neurons [@daley1988], the abdominal ganglia and the thoracic ganglia [@sattelle1981]. Presence of nAChRs at the insect ganglia was confirmed using electrophysiological approaches [@sattelle1981; @bai1992].
Based on the distribution of cholinergic-synapse markers in the insect nervous system and the quantitative analysis of acetylcholine in the insect brain [@florey1963], it was concluded that acetylcholine is a major neurotransmitter in the nervous system of insects. In contrast to vertebrates [@brown1936; @bacq1937; @chang1963] and *C. elegans* [@richmond1999], acetylcholine in insects does not mediate muscle contraction at the NMJ, instead it is mainly involved in the sensory pathways and central information processing.
### Role of nAChRs in insects
<!-- Lerning: [@kerkut1970] acetylcholinesterase inhibitor facilitated the ability of cocroach to learn to raise its leg out of the solution in response to electrical stimuli. Drugs: neostigmine and physostigmine which inhibit acetylcholinesterase [@carlyle1963]. -->
Biological role of nAChRs in insects was investigated in behavioural assays in response to nAChR agonists. Lethal doses of neonicotinoid imidacloprid induced complex symptoms in American cocroach and in honeybee [@sone1994; @elbart1997; @suchail2001]. The following order of events was noted: hyperexcitation as evident by excessive pacing, collapse and diminishing uncoordinated leg and abdomen movement followed by paralysis and eventual death. Lethal dose of insecticide nicotine [@david1953], a naturally occurring alkaloid found in the *Solanaceae* family of plants, including tobacco [@steppuhn2004], induced similar effects on bees [@mcindoo1943]. Distinct behavioural alterations can be induced by sub-lethal doses. Imidacloprid at < 4 nM inhibits feeding of *Myzus persicae*, which leads to their starvation [@nauen1995; @elbart1997]. In honeybees and bumblebees neonicotinoids impair on learning and memory, as well as reproduction (Section \@ref(sublethalbees)).
### Electrohysiological properties of insect nAChRs ###{#eletrophysinsectnachr}
The kinetic properties of insect nAChRs were investigated using neuronal preparations, where high density of nAChRs was found (Section \@ref(localisationininsects)). Acetylcholine and nicotine increased the rate of neuronal firing [@callec1973; @sattelle1976; @meyer1985; @kerkut1969; @sattelle1981; @bai1992]] by depolarising post-synaptic neurons [@callec1973; @sattelle1976; @goldberg1999; @barbara2005; @brown2006; @palmer2013]. These effects were inhibited by nAChR antagonist $\alpha$-bgtx, suggesting effects of nicotine and acetylcholine were induced directly acting on nAChRs and that nAChRs are excitatory. Indeed, analysis of the agonist-evoked nAChR currents in the cultured honey bee neurons showed flux of mainly sodium and potassium but also calcium [@goldberg1999].
<!-- cocroach terminal abdominal ganglion extracellular post synaptic potentials in response to acetylcholine. In the presence of acetylcholinenesterase inhibitor acetylcholine at much lower doses 1 uM - 1 mM elicited Rapid and concentration dependent depolarisation excitation of the post-synapse and the gradual decline of the EPSP leading to their block []. -->
<!-- were recorded intracellularlu t -->
<!-- recording of the interneuron activity nicotine - cholienrgic and evidence of nAChr expression from the biochem studies. In response to blocked by bgtx [@meyer1985] -->
<!-- and was blocked by selective antagonist mecamylamine . -->
#### Single channel kinetics
Single channel recordings showed that insect nAChRs exhibit complex kinetics, resembling those found in vertebrates [@colquhoun1985; @nagata1996; @nagata1998]. Using cholinergic neurons of the larva Drosophila CNS [@albert1993; @brown2006], and cultured neurons of *Musca domestica* [@albert1993] it was shown that in response to nAChR agonists acetylcholine, nicotine, imidacloprid and clothianidin, the channel switches between active and inactive form, with the active form interrupted by the short-lived channel closing bursts. Temporal characterisation of these events reveled that the frequency of channel opening and the duration of opening differs depending on the agonist applied and the neuronal preparation. However, typically receptor remains opened for ~ 1.5 ms; this is interrupted by channel closing bursts of ~ 20 $\mu$s which occur at a frequency of 1-2 closures/opening burst [@albert1993].
Channel opening is not an all or nothing event. Instead, a channel typically exhibits two conductance states, one on which it is fully opened, named a full conductance state (i.e. the active form), and one in which the channel is partially opened, named the sub-conductance state. Although the conductance rates from various insect preparations are similar, the ratio between the two as well as their fine structure varies depending on the concentration, the agonist used and and the neuronal preparation [@albert1993; @brown2006].
#### Desensitisation of insect nAChRs
Exposure of insect neuronal preparations to high concentrations of agonists has a secondary effect. Following rapid depolarisation, the current slowly decreased until it it abolished completely due to nAChR desensitisation [@goldberg1999]. Desensitisation is a period after agonist removal, whereby subsequent depolarisation cannot be elicited by agonist [@goldberg1999]. The time taken for desensitisation varies between hundreds of ms [@goldberg1999] to tens of seconds [@salgado2004] in insects. In vertebrates, there are receptors which desensitise in $\mu$ seconds [@bouzat2008]. Although the process of receptor desensitisation is typically reversible [@goldberg1999; @salgado2004], full recovery may not occur or may be slower if the receptors are exposed to the large doses of agonist for a prolonged time [@katz1957].
<!-- Immunocytochemistry using monoclonal antibodies specifie -->
<!-- In the brain, cholinergic neurons can be found in almost all parts of the brain and the optical lobe. In particular, mushroom bodies, -->
<!-- thoracic ganglia : afferent sensory nurons -->
<!-- In the peripheral primary sensory nerouns of the compound eye and the anntena. -->
<!-- Afferent sensory neurons -->
<!-- interneurones of the thoracic ganglia -->
<!-- Cholinergic neurons in the cortical regions of almost all regions of the insect brain -->
<!-- Immunocytochemistry -->
<!-- Biochemical techniques using monoclonal antibodies specific agains -->
<!-- Large quantities of achetylcholine isolated from the insect brain preparations -->
<!-- also "immunoreactivity first, in -->
<!-- regions of neuropile previously shown by backfilling -->
<!-- with cobalt to contain terminals from sensory neurones. Some roots of peripheral nerves also bind the antibody. Secondly, a small number of neurone cell bodies in the brain and thoracic ganglia are immunoreactive and we assume these belong to interneurones" and " first, there are relatively few immunoreactive cell bodies in the CNS; and second, sensory neuropiles, such as the -->
<!-- ventral association centre and the ventral VAC (vVAC), the anterior ring tract, the tritocerebrum and the antennal lobe, are immunoreactive. That ChAT is contained in sensory neurones is suggested by immunoreactivity found in peripheral neurone cell bodies" [@lutz1987]. -->
<!-- immunoreactivity in almost all brain regions of *D. melanogaster* " apart from -->
<!-- the lobes and the peduncle of the mushroom body and -->
<!-- most of the first visual neuropile (lamina)" [@buchner1986]. -->
<!-- in-situ hybridization: [@barber1989] "Substantial amounts of cRNA probe for ChAT mRNA -->
<!-- were observed associated with cells of all cortical regions of -->
<!-- the optic lobe and brain. Neuropil regions of the -->
<!-- brain displayed insignificant amounts of hybridization with -->
<!-- the experimental probe and specimens incubated with the control probe did not exhibit significant -->
<!-- hybridization in either cortical or neuropil areas . -->
<!-- In peripheral nervous tissue, there was substantial labeling over primary sensory neurons in the antenna, and significant amounts of probe were associated with the -->
<!-- retinular cell layer of the compound eye ". the compound eye is the visual system of the fly. -->
<!-- AND " histochemical detection of reporter gene expression " using x-gal : [@yasuyama1999]. -->
<!-- " cholinergic primary sensory neurons in the Drosophila antennal system" -->
<!-- aceti-cholinesterase : colorimetric determination of acetylcholinesterase activity with -->
<!-- Histochemistry of AChE with colorimetric assay using isothiocholine: -->
<!-- "the optic lobes, fibers connecting the two brain hemispheres, and fiber tracts -->
<!-- as well as soma clusters within the protocerebrum. The calycal input regions of -->
<!-- the mushroom bodies were labelled, whereas the intrinsic Kenyon cells -->
<!-- showed no staining. Although the antennal afferents projecting into the dorsal -->
<!-- lobe showed strong AChE activity, projections into the antennal lobe showed -->
<!-- rather weak staining." [@kreissl1989] the same paper shows a-bungarotoxin (a-BTX) binding sites and AChR monoclonal antibodies with a good overlap in "d immunoreactivity -->
<!-- in neuropiles, tracts, somata, and the antennal nerve. The immunoreactivity -->
<!-- of the optic lobes coincided with the banding pattern of the AChE staining. A -->
<!-- particularly striking overlap of AChR immunoreactivity and AChE staining -->
<!-- was found in the lip neuropile of the mushroom bodies" all in the honeybee -->
<!-- check this paper to see evidence for cholinergic neurons "between the -->
<!-- sensory neurons and interneurons of the cockroach cercal sensory system " paper: " The pharmacology of an insect ganglion: actions of carbamylcholine and acetylcholine" -->
<!-- Its action is mediated predominately by nAChRs, which are the main cholinergic receptor type in their central nervous system [@breer1987]. -->
<!-- The presence of nAChR in various brain regions has been detected using biochemical and electrophysiological techniques on neuronal preparations extracted from the Fruit fly *Drosophila melanogaster*, honey bee *Apis mellifera* and . -->
<!-- nAChRs have been found to be expressed in the regions -->
<!-- , namely the muschroom bodies [@kreissl1989; @gu2006; @oleskevich1999]. -->
<!-- In contrast to mammals and invertebrates (Table \@ref(tab:chlinergic-nts)), insects do not express nAChRs at the neuromuscular junction. -->
<!-- ##### Electrophysiology -->
<!-- Evidence from the application of nAChR: -->
<!-- nicotine: -->
### Structural basis of major conformation states of nAChRs
Nicotinic acetylcholine receptors have three basic conformation states: the closed, the open and the disensitised state [@katz1957; @monod1965]. Structural features of the closed state channel are described in Section \@ref(structure) and \@ref(modelodnachbinding)). Briefly, nAChR is a pentameric assembly of receptor subunits. Each subunits contains 4 transmembrane helices [@noda1982; @noda1983] (M1-M4), an N-terminal helix and 10 $\beta$sheets [@brejc2001; @dellisanti2007; @li2011] and a large C-terminal domain [@unwin1995; @dellisanti2007; @li2011]. The N-terminal domain contains an agonist binding site formed by the loop contributions from the adjecent subunits [@brejc2001]. One of the key features of the closed-channel is the presence of leucine residues originating from the pore-lining M2 helix, which project inwards [@unwin1995]. These residues form a gate which occludes the passage of ions of closed nAChR. High resolution structures of AChBP [@bourne2005; @hansen2005] and human $\alpha7$-AChBP chimera [@li2011] highlighted the structural differences between the open (agonist-bound) and the closed states. In the agonist-bound structures, the aromatic residues in C loop form a cap above the agonist, suggesting that ligand binding leads to movement of the C-loop which folds over the agonist binding site, burying the ligand inside the protein and reducing the dissociation on/off rates. In addition, loop A moves towards the loop B, whereas loop F moves towards the agonist. These local changes propagate the rearrangement of the outer $\beta$ sheet which rotates towards the centre of the pentamer and lead to structural changes at the level of the channel, leading to its opening.
Crystal structures of bacterial pentameric ligand gated ion channels shed light on the possible mechanism of channel opening. Although these channels are not members of the Cys-loop family due to the absence of N-terminal disulphide bond and a large cytoplasmic loop between M3-M4 TM helices, they share common topology with nAChRs. Comparison of closed *Erwinia chrysanthemi* ligand gated ion channels (ELIC) [@hilf2008] to opened *Gloeobacter violaceus* ligand gated ion channels (GLIC) [@hilf2009], showed that in the open state pore-lining helices are tilted inwards, which leads to opening of the gate. An alternative hypothesis of channel opening was derived based on the cryo EM of the mammalian muscle nAChR in closed and open state [@unwin1995]. These structures suggest that binding of the agonist leads to rotation of 5 M2 helices. As they move, the distance between them increases, and so the ion conductivity pathway becomes wider, the gate opens, thus ions flow. More recently a higher resolution structure of muscle type nAChR has been derived [@unwin2012], suggesting that in the open state, TM helices not only rotate, but also bend towards the centre of the pore. Twisting and tilting of inner helices were also observed in the crystal structures of other representative of Cys-loop receptors, namely glycine receptors [@du2015] and glutamine-gated chloride (GluCl) channel [@althoff2014])
In 2016, crystal structure of the human $\alpha4$/$\beta2$ receptor in desensitized state [@morales-perez2016] was derived. This was compared to the structures of open glycine [@du2015], closed GluCl [@althoff2014] and desensitized GABA [@miller2014]. Differences at the interface of the extracellular (ECD) and transmembrane (TM) regions were noted, which arise as a result of the rotation motion at the level of the receptor. The structural rearrangements lead to the occlusion of the ion channel, reducing conduction [@monod1965] and tightening of the ligand binding site leading to an increase in ligand affinity to the desensitised receptor [@monod1965].
### Neonicotinoids target nAChRs ### {#neonicstarget}
#### Mutations in nAChRs give rise to neonicotinoid-resistance ####{#resgenevidence}
Severalk lines of evidence suggest that nAChR are the principal site of action of neonicotinoids. Genetic analysis of the neonicotinoids-resistant strains of insects showed that resistance arises as a consequence of mutations in nAChR subunits. Field isolates of peach aphid *Myzus persicae* [@bass2011], the cotton aphid *Aphis gossypii* [@hirata2015; @hirata2017] and the Colorado potato beetle *Leptinotarsa decemlineata* [@szendrei2012], as well as lab-isolates of brown planthopper, *Nilaparvata lugens* [@liu2005], fruit fly *Drosophila melanogaster* [@perry2008] with decreased sensitivity to neonicotinoids have been identified. Behavioral analysis shows that their sensitivity is up to 1500-fold lower in comparison to the reference strains, as shown by the shift in the LD50. Analysis of the DNA of the resistant strains identified mutations in nAChR subunit coding sequence [@bass2011; @perry2008; @hirata2015].
#### Neonicotinoids evoke nAChR-like current in insect neuronal preparations ####{#electrophysevidence}
Neonicotinoids induce nAChR-like current in insect neuronal preparations, whicn reasssembles that induced by nAChR agonist nicotine (Section \@ref(eletrophysinsectnachr)). @sone1994 investigated the effects of imidacloprid on the neuronal activity at the thoracic ganglia of male adult American cockroaches, *Periplaneta americana* using extracurricular recordings. This method allows for a record of changes in spontaneous neuronal activity in response to mechanical or pharmacological interventions. At a very low concentration of 1 nM, imidacloprid induced a sustained for over 2 minutes increase in the rate of neuronal firing. At concentrations ranging from 10 nM to 100 $\mu$M, the following sequence of events was noted: an increase of the rate of spontaneous action potentials of neurons followed by a gradual decline, leading to a complete block of neuronal activity [@sone1994]. Imidacloprid had the same effect on various insect preparations including thoracic ganglion of the Leptinotarsa decemlineata [@tan2008] and on the abdominal ganglion of *Periplaneta americana* [@buckingham1997]. The same observations were made for other neonicotinoids [@thany2009; @schroeder1984].
<!-- This phenomenon is due to the distinct conformation of nAChRs, at in which they are not capable of ion conduction [@nemecz2016]. -->
<!-- In the continual presence of agonist, the membrane potential gradually repolarises until it reaches the resting state, hovewer the next depolarisation will not occur, until the agonist are washed off and the receptor recovers from desensitisation [@katz1957]. -->
@sattelle1989 used isolated cocroach neuronal preparation to record post-synaptic intracellular currents in response to neonicotinoid prototype 2(nitromethylene) tetrahydro-1, 3-thiazine (NMTHT). NMTHT depolarised the post-synaptic unpaired median neurons and the cell body of motor neurons of the abdominal ganglion. Agriculturally relevant neonicotinoids had the same effect on the post-synaptic membrane of the isolated cocroach thoracic ganglia [@tan2007; @thany2009] potato beetle isolated neurons [@tan2008], and on cultured cocroach [@ihara2006], honeybee [@palmer2013] and fruit fly [@brown2006] neurons.
Pharmacological characterisation of neonicotinoids-induced currents provided further evidence for their mode of action. The inward current elicited by neonicotinoids were dose-dependent, whereby the higher the concentration, the grater the depolarisation. EC50 values (concentrations at which the half of the maximum current was observed) are in the region of 1 - 5 $\mu$M [@thany2009; @tan2007]. Such low values indicate highly potent action of neonicotinoids on insects, in agreement with toxicological data (Section \@ref(potentpests)). Neonicotinoid-induced currents were reminiscent of those induced by acetylcholine and nicotine, and were prevented by the application of nAChRs antagonists ($\alpha$-bungarotoxin, methyllycaconitine, mecamylamine or d-tubocurarine) not by muscarinic receptor antagonists (atropine, pirenzepine), suggesting neonicotinoid-induced currents are due to the activation of nicotinic receptors.
### Mode of action of neonicotinoids ###{#moaneonicsinsects}
Although neonicotinoids typically acts as agonists, they can have diverse mode of action. The currents produced by neonicotinoids and ACh on cultured or isolated insect neuronal preparation were compared. Neonicotinoids evoking current lower than that evoked by ACh were classed as partial agonists, those eliciting similar response were classed as true agonists, whereas those more efficacious than ACh, super-agonists. Thiacloprid and imidacloprid are partial agonists, nitenpyram, clothianidin, acetamiprid and dinotefuran are true agonists, whereas thiamethoxam has no effect on the isolated American cockroach thoracic ganglion neurons [@tan2007]. This differs from the mode of action of neonicotinoids on cultured terminal abdominal ganglion neurons of this insect. Currents produced by all neonicotinoids tested was lower than that evoked by ACh [@ihara2006], suggesting they are all partial agonists on these cells. The mode of action of neonicotinoids on the fruit fly [@brown2006] and honey bee neurons [@palmer2013] differs still, implying the presence of distinct nAChRs in different insect species and neuronal preparations.
#### Neonicotinoids bind with high affinity to insect nAChRs ####{#ligbinding}
<!-- @tomizawa1996 developed neonicotinoid agarose affinity column to isolate proteins with high binding affinity to neonicotinoids. Using Drosophila and Musca head membrane preparations, he identified three nAChR subunits as potential neonicotinoid-targets. -->
<!-- In the saturation binding experiment, various concentration of the labelled ligand is added to the preparation and the concentration of the ligand at the equilibrium is determined. This is then used to derive the binding constant (as a measure of dissociation constant, Kd). Here, it was used to define the binding strength of neonicoinoids to insect nAChRs (Table \@ref(tab:bindignrecombinant)). -->
Neonicotinoids bind to insect nAChRs with high affinity, as shown in the saturation ligand binding studies. In the whole membrane preparations of the domestic fly and aphid, the Kd of imidacloprid and thiamethoxam were in the low nM range [@liu1993; @wellmann2004; @liu2005]. Interestingly, two binding affinities have been derived from the imidacloprid study in the brown planthopper and pea aphid [@wellmann2004; @taillebois2014] suggesting the presence of at least two imidacloprid binding sites in these animals.
```{r potencyintact, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
potencyintact <- data.frame(
Compound = c("Imidacloprid", "Imidacloprid", "Imidacloprid", "Imidacloprid", "", "Imidacloprid", "", "Thiamethoxam"),
Species = c("Musca domestica", "Aphis craccivora", "Myzus persicae", "Nilaparvata lugens", "", "Acyrthosiphon pisum", "", "Myzus persicae"),
Common = c("domestic fly", "cowpea aphid", "green peach aphid", "brown plantohopper", "", "pea aphid", "", "green peach aphid"),
Kd = c("1.2", "12.3", "4.1", "<0.01", "1.5", "0.008", "0.002", "15.4"),
References = c("Liu et al. 1993", "Wellmann et al. 2004", "", "Liu et al. 2005", "", "Taillebois et al. 2014", "", "Wellmann et al. 2004"))
potencyintact %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Compound", "Species", "Common\nname", "Kd\n(nM)", "References")),
caption = 'Binding affinity of neonicotinoids') %>%
kable_styling(position = "left", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", "Binding affinity measured in the whole membrane or head membrane (Musca domestica experiment)",
threeparttable = T)
```
<!-- In the the competitive ligand binding studies, biological preparation is incubated with radiolabelled ligand. The ability of various concentrations of unlabeled ligand is measured to define its equilibrium inhibition constant (Ki). This method informs both on the affinity and on the interactions between ligands. -->
In addition to the saturation studies, the competitive ligand binding studies were carried out. Various concentrations of neonicotinoid prototype isothiaocynate were incubated with the homogenate of fruit fly *Drosophila melanogaster* and a homogenate of the abdominal nerve cords of *Periplaneta americana* before the exposure to radiolabelled nAChR antagonist $\alpha$-bgtx [@gepner1978]. Isothiaocynate inhibited binding of $\alpha$-bgtx in the concentration dependent manner [@gepner1978], suggesting the two compounds share the binding site. Similarly, imidacloprid has been shown to displace $\alpha$-bgtx from brain membrane preparations from honey bee *Apis mellifera* [@tomizawa1992; @tomizawa1993], *Drosophila melanogaster* [@zhang2004], house fly *Musca domestica* and isolated cockroach nerve cords [@bai1991].
The binding affinity of neonicotinoid-related compounds was compared to the insecticidal activity; the correlative relationship between the two was found [@kagabu2002; @liu2005], providing further evidence that neonicotinoids act by targeting nAChRs.
#### High affinity of neonicotinoids to heterologously expressed insect-chimera receptors ####{#chimerareceptors}
Due to the difficulties in the heterologous expression of native insect receptors (Section \@ref(expressionfail)), the binding affinity of neonicotinoids to isolated, native receptors is largely unknown. However, binging studies on hybrid receptors consisting of insect $\alpha$-subunit and vertebrate $\beta$ subunit, were carried out.
<!-- determined. $\beta2$ from rat and chicken has been shown to enable recombinant expression of several insect $\alpha$ subunits in cell lines. -->
Mammalian $\alpha4$/$\beta2$ receptor expresses well in Xenopus oocytes [@cooper1991] and cell lines [@lansdell2000] and it has low affinity to imidacloprid (Kd >1000 $\mu$M) [@lansdell2000]. Chimera of rat $\beta2$ and $\alpha$ subunits from the fruit fly *Drosophila melanogaster* [@lansdell2000], aphid *Myzus Persicae* [@huang1999], planthopper *Nilaparvata lugens* [@liu2009], cat flea *Ctenocephalides felis* [@bass2006] and sheep blowfly *Lucilia cuprina* [@dederer2011] have been generated. It needs to be noted that the potency of neonicotinoids on these receptors is not reported, suggesting these receptors are not functional. However, their pharmacological profiles have been determined using saturation ligand binding studies [@hulme2010] (Table \@ref(tab:bindignrecombinant)).
The affinity of neonicotinoids to insect-chimera rectors varies, depending on the identity of the $\alpha$ subunit. Imidacloprid did not bind to Mp$\alpha1$/rat$\beta2$ receptor, whereas its Ki at Mp$\alpha2$ and Mp$\alpha3$-containing receptor was 3 and 2.8 nM, respectively [@huang1999]. Four to five fold-difference between the most and least susceptible *Drosophila melanogaster* and *Ctenocephalides felis* receptor assemblies were also identified [@lansdell2000; @bass2006]
Imidacloprid exhibits the highest affinity against target pest *Myzus Persicae* with the lowest reported Ki of 2.8 nM on $\alpha3$/$\beta2$ receptor [@huang1999]. It binds less tightly to the non-target insect, the fruit fly nAChRs; the Kd values range from 8.4 to 34.9 nM [@lansdell2000].
```{r bindignrecombinant, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
footnotez <- ("Receptors were expressed in insect S2 cell line")
footnotey <- ("Rn = Rattus norvegicus (rat), Dm = *Drosophila melanogaster (fruit fly), Mp = Myzus persicae (aphid), Nl = Nilaparvata lugens (planthopper), Cf = Ctenocephalides felis (cat flea)), N/B = no binding,")
bindingrecombinant <- data.frame(
Receptor = c("Rn$\\alpha4\\beta2$", "Dm$\\alpha1$/Rn$\\beta2$", "Dm$\\alpha2$/Rn$\\beta2$", "Dm$\\alpha3$/Rn$\\beta2$", "Mp$\\alpha1$/Rn$\\beta2$", "Mp$\\alpha2$/Rn$\\beta2$", "Mp$\\alpha3$/Rn$\\beta2$", "Mp$\\alpha4$/Rn$\\beta2$", "Nl$\\alpha1$/Rn$\\beta2$", "Cf$\\alpha1$/Dm$\\alpha2$/Rn$\\beta2$", "Cf$\\alpha3$/Dm$\\alpha2$/Rn$\\beta2$"),
Kd= c(">1000", "34.9", "20", "8.4", "N/B", "3", "2.8", "N/B", "24.3", "141", "28.7"),
References = c("Lansdell and Millar, 2000", "", "", "", "Huang et al., 1999", "", "", "", "Liu et al., 2005", "Bass et al. 2006", ""))
bindingrecombinant %>%
mutate_all(linebreak) %>%
kable("latex", align = "c", booktabs = TRUE, escape = F,
col.names = linebreak(c("Receptor", "Kd\n(nM)", "Rerefence")),
caption = 'Binding affinity of imidacloprid to recombinant insect-hybrid receptors') %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", c(footnotez, footnotey),
threeparttable = T)
```
#### High potency of neonicotinoids on heterologously expressed insect-mammalian hybrid receptors
The potency of neonicotinoids on insect-mammal hybrid nAChRs have been also determined using cyanoamidines clothianidin and imidacloprid, nitroguanidines thiacloprid and acetamiprid and nitromethylene nitenpyram.
Dose-dependent depolarising current was recorded from cells expressing insect-hybrid nAchRs in responses to all tested neonicotinoids. The potency of neonicotinoids varied, as indicated by the EC50 value, between 0.04 and 45.8 $\mu$M, however it is generally in the region of 1 $\mu$M.
The rank order of potency of cyanoamidines, nitroguanidine and nitromethylene differs, depending on the receptor identity. For example, in imidacloprid and clothianidin are the most potent on the fruit fly $\alpha1$ containing receptors [@dederer2011], whereas planthopper $\alpha3\alpha8$ hybrid, thiacloprid is the most potent [@yixi2009]. Nitenpyram has consistently the highest EC50.
```{r potencyrecombinant, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
footnotew <- ("Receptors were expressed in Xenopus oocytes")
footnotex <- ("Rn = Rattus norvegicus (rat), Gg = Gallus gallus (chicken), Dm = *Drosophila melanogaster (fruit fly), Nl = Nilaparvata lugens (planthopper), Cf = Ctenocephalides felis (cat flea)), Lc = Lucilia cuprina (sheep blowfly)")
potencyrecombinant <- data.frame(
Receptor = c("Nl$\\alpha1$/Rn$\\beta2$", "Nl$\\alpha2$/Rn$\\beta2$", "Nl$\\alpha3$/Rn$\\beta2$", "Nl$\\alpha3\\alpha8$/Rn$\\beta2$", "", "", "", "Dm$\\alpha1$/Gg$\\beta2$", "", "", "", "Dm$\\alpha2$/Gg$\\beta2$", "", "", "", "Cf$\\alpha1$/Gg$\\beta2$", "", "", "", "Cf$\\alpha2$/Gg$\\beta2$", "", "", "", "Cf$\\alpha4$/Gg$\\beta2$", "", "", ""),
Compound = c("Imidacloprid", "Imidacloprid", "Imidaclorprid", "Imidacloprid", "Clothianidin", "Thiacloprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram", "Imidacloprid", "Clothianidin", "Acetamiprid", "Nitenpyram"),
EC50 = c("61", "870", "350", "3.2", "5.1", "2.8", "5.6", "0.04", "0.34", "0.23", "0.4", "0.84", "5.4", "2", "35.4", "0.02", "0.15", "0.11", "0.63", "1.31", "1.65", "2.63", "24.4", "13.8", "21.3", "9.4", "45.8"),
References = c("Liu et al. 2009", "", "", "Yixi et al. 2009", "", "", "", "Dederer et al. 2011", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", ""))
potencyrecombinant %>%
mutate_all(linebreak) %>%
kable("latex", align = "c", booktabs = TRUE, escape = F,
col.names = linebreak(c("Receptor", "Compound", "EC50\n($\\mu$M)", "Rerefence")),
caption = 'The potency of neonicotinoids on recombinantly expressed insect hybrid nAChRs.') %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", c(footnotew, footnotex),
threeparttable = T)
```
<!-- Based on the expression of several potential assemblies have been identified. -->
<!-- Subunits with various degree of sensitivity to neonicotinoids, suggesting some and not all receptors confer neonicotinoid sensitivity. -->
<!-- cultured Drosophila CNS cholinergic neurons, whereas imidacloprid is a partial agonist there . -->
<!-- Clothianidin and imidacloprid are partial and full, agonist, respectively on the isolated Kenyon cells of the honeybee . In addition imidacloprid, and imidacloprid but not other neonicotinoids tested blocked ACh-induced action on the American cockroach neurons [@ihara2006] and isolated honeybee neurons [@palmer2013], suggesting antagonistic capabilities of these compounds. -->
<!-- Single channel recordings provided mechanistic details of the mode of action of these compounds. Super-agonists have been shown to increased the frequency of larger conductance state openings [@jones2007a], whereas partial agonists increase the activity of the sub- conductance state of nAChRs [@nagata1996; @nagata1998]. -->
<!-- Note that neonicotinoids cause depolarizing block by desensitising receptors [@palmer2012]. -->
<!-- In cultured honeybee mushroom bodies, imidacloprid acts at nM concentrations [@palmer2013]. In the bee Kenyon cells, the EC50 of imidacloprid was 25 $\mu$M [@deglise2002], whereas on the antenna lobe cells 0.87 $\mu$M [@nauen2001]. Similarly, the EC50 of imidacloprid on isolated cockroach neurons [@tan2007; @ihara2006] and in Drosophila CNS neurons [@brown2006] were in a single digit $\mu$M range. -->
<!-- Neonicotinoids are less potent on vertebrate receptors. EC50 of clothianidin and imidacloprid on heterologously expressed human $\alpha7$ nAChRs is 0.74 mM and 0.73 mM, respectively [@cartereau2018]. Whereas the EC50 of imidacloprid on heterogouslty expressed chicken $\alpha7$ is 357 $\mu$M [@ihara2003]. Other vertebral receptors may be more susceptible. Two-digit $\mu$M imidacloprid doses were needed to activate nAChRs in mammalian neurons [@bal2010; @nagata1998], and the EC50 of this compound on cells containing native mammalian $alpha4\beta2$ nAChRs is 70 $\mu$M [@tomizawa2000a]. Higher EC50 of neonicotinoids on vertebrate receptors suggests neonicotinoids bind preferentially to the insect nAChR. This supports the toxicological data demonstrating increased toxicity of neonicotinoids on insects versus vertebrate species (Section \@ref(nontargeteffect)). -->
<!-- In addition, nAChR-like current was evoked in Xenopus oocytes transfected with membrane preparations of pea aphid *Acyrthosiphon pisum* in response to clothianidin, acetylcholine and nicotine [@crespin2016]. -->
<!-- nAChRs are expressed pre-, post- synaptically at the cell body, as determined mainly with electrophysiological approaches, whereby upon application of classical agonists (Section \@ref(pharma-generalintro)), nAChR-like currents were elicited from various parts of neuronal preparations. The agonist-induced currents were blocked with nAChR antagonists. The presence of nAChRs in the Fruit fly *Drosophila melanogaster* (refereed to as Drosophila, in short) Kenyon cells was shown by recording spontaneous and nicotine or acetylcholine-evoked post-synaptic currents of neurons. These responses were blocked by selective nAChR antagonists $\alpha$-Bgtx [@gu2006]. nAChR are also expressed in the postsynapatic neurons of the honeybee mushroom bodies based on the antibody staining against the nAChR as well as staining with labelled $\alpha$-Bgtx [@kreissl1989]. In addition, mushroom bodies produced a nAChR-like current in response to nicotine and ACh, and it was blocked by $\alpha$-Bgtx [@oleskevich1999]. In cocroach, cell bodies in the thoracic ganglion depolarised in the presence of nicotine and was blocked by selective antagonist mecamylamine [@bai1992]. -->
```{r chlinergic-nts, echo=FALSE, warning = FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
footnote1 <- "NT = neurotransmitter, NMJ = neuromuscular junction"
footnote2 <- "References: 1 = Chen and Patrick 1997, 2 = Araujo et al. 1988, 3 = Couturier et al. 1990; Cooper et al. 1991, 4 = Lee et al. 1967; 5 = Brown et al. 1936, 6 = Mishina et al. 1986, 7 = Zirger et al. 2003, 8 = Mongeon et al. 2011, 9 = Lewis et al. 1987, 10 = Treinin et al. 1998, 11 = Richmond and Jorgensen 1999; 12 = Boulin et al. 2008, 13 = Touroutine et al. 2005, 14 = McKay et al. 2004"
library(kableExtra)
library(dplyr)
cholnts <- data.frame(
Species = c("Mouse", "D. melanogaster", "D. rerio", "C. elegans", "A. mellifera"),
Localisation = c("Nervous system\nNMJ", "Nervous system", "Nervous system\nNMJ", "Nervous system\nNMJ", "Nervous system"),
Function = c("NT release modulation\nMuscle contraction", "Major NT", "NT release modulator\nMuscle contraction", "Major NT\nMuscle contraction", "Major NT"),
Major = c("$\\alpha4\\beta2$ and $\\alpha7$\n$\\alpha1\\beta1\\epsilon\\delta$", "?", "$\\alpha4\\beta2$ and $\\alpha7$\n$\\alpha1\\beta1\\epsilon\\delta$", "DES-2/DEG-3\nL-type, N-type and EAT-2 containing", "?"),
Ref = c("1-3\n4-6", "in-text", "7\n8", "9, 10\n11-14", "in-text"))
cholnts %>%
mutate_all(linebreak) %>%
kable("latex", align = "l", booktabs = TRUE, escape = F,
col.names = linebreak(c("Species", "Localisation\nof nAChRs", "Function\nof nAChRs", "Major\nreceptor types", "Ref")),
caption = 'Cholinergic neurotransmission',
) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
add_footnote(notation = "none", c(footnote1, footnote2),
threeparttable = T)
```
### nAChR subunits in insects ###{#expressionfail}
The eletrophysiological and ligand binding studies on neuronal preparations and hybrid receptors provides evidence that nAChR are molecular targets of neonicotinoids.
nAChR are assemblies of 5 different or identical receptor subunits (Section \@ref(structure)). Each subunit is encoded by a separate gene and is classified as either $\alpha$ or non-$\alpha$, depending on the primary amino acid sequence, whereby $\alpha$ subunits contain a disulphide bond formed between the adjacent cysteines in the ligand binding domain (Figure \@ref(fig:structure-nachr-label)). Genome sequencing projects enabled identification of nAChR subunit families in several insect species. Fruit fly and model organism *Drosophila melanogaster* has 10 subunits, 7 of which are $\alpha$ ($\alpha1-7$) and 3 are $\beta$ ($\beta1-3$) [@adams2000a; @sattelle2005]. There are 11 subunits in the beneficial insect honeybee *A. mellifera* ($\alpha1-9$, $\beta1-2$) [@jones2006a; @consortium2006], 12 subunits in the pest red flour beetle *Tribolium castaneum* ($\alpha1-11$,, $\beta1$) [@consortium2008] and 7 in the Pea Aphid, *Acyrthosiphon pisum* ($\alpha1-6$, $\beta1-2$) [@yi-peng2013; @Consortium2010]. With the aid of molecular cloning techniques, equivalent subunits have been identified in many other insects, including cat flea *Ctenocephalides felis* [@bass2006] and green peach aphid *Myzus persicae* [@huang2000]. Amino acid sequence alignment of equivalent subunits revealed that they are highly conserved, with sequence identity typically greater than 60 % [@jones2010].
Insect nAChR gene families are among the least diverse when compared to other animal phyla. Mammals express 17 subunits: $\alpha1-10$, $\beta1-4$, $\delta$, $\gamma$ and $\epsilon$ [@millar2009] and there are 29 subunits in the representative of the phylum *Nematoda, C. elegans* [@jones2007a].
### Difficulties in heterologous expression of insect nAChRs
<!-- There are different receptor types in insects. -->
<!-- https://radar.brookes.ac.uk/radar/file/c59cbdb5-d171-49e0-b0e4-101c261c72ed/1/fulltext.pdf -->
To identify which subunits assemble to form functional receptors, recombinant expression techniques were used. Recombinant expression is a technique by which receptor stoichiometry and function can be studied in a heterologous system. cDNA is injected into the Xenopus oocytes, or used to transfect insect or mammalian cell lines. Using internal cellular machinery, it is transcribed, translated and processed to the surface of the cell. Should a protein form, cell-surface expression can be detected using biochemical approaches (such as ligand binding studies), whereas function studied by means of electrical recordings. These approaches were utilised to identify the major receptor assemblies in mammals, nematode and fish (Table \@ref(tab:chlinergic-nts)).
<!-- To determine which insect nAChR subunits come together to form a functional receptor, various nAChR subunits were injected into the expression systems (*Xenopus oocytes* or cell lines) to determine whether cell surface expression and receptor function can be obtained. -->
To determine which insect subunits form functional nAChRs, @lansdell2012 transfected cultured insect cells with over 70 *Drosophila melanogaster* nAChR subunit cDNAs either singularly or in combinations. No cell surface was achieved, as shown by the radiolabelled ligand binding studies. Difficulties in expression of *Drosophila melanogaster* were also encountered in Xenopus oocytes [@lansdell2012] and mammalian cell lines [@lansdell1997]. The attempts to express receptors from other species were also largely unsuccessful. No ligand binding and/or agonist evoked currents were detected from cells transfected with genes encoding for the nAChR subunits of brown planthopper *Nilaparvata lugens* [@liu2005; @liu2009; @yixi2009], cat flea *Ctenocephalides felis* [@bass2006], aphid *Myzus persicae* [@huang2000] and brown dog tick *Rhipicephalus sanguineus* [@lees2014]. Homomeric Locust *Schistocerca gregaria* $\alpha1$ [@marshall1990], *Myzus Persicae* $\alpha1$ and *Myzus Persicae* $\alpha2$ [@sgard1998] produced receptors with nAChR-like pharmacological and electrophysiological characteristics, however the channel-generated currents were of low amplitude, and the expression was inconsistent.
##### Importance of chaperon proteins in heterologous expression of nAChRs ###{#ric3insect}
Difficulties in recombinant receptor expression highlight the complexity of receptor formation. Assembly and oligomerisation are critical steps in the receptor maturation [@brodsky1999]. Co-expression of mammalian and *C. elegans* nAChRs with chaperon proteins highlight the critical role of ER and Golgi resident proteins in receptor maturation. @boulin2008 demonstrated that three chaperon proteins are necessary for the expression of *C. elegans* muscle-type receptors in Xenopus oocytes: UNC-50, UNC-74 and RIC-3 (described in more details in Sections \@ref(ric-3celegans); \@ref(unc50) and \@ref(unc74)); ligand binding and agonist-evoked currents were abolished upon exclusion of any of the three proteins. RIC-3 also improves the cell surface expression of the second type of the BWM *C. elegans* receptor [@ballivet1996] and the neuron-type *C. elegans* receptor in Xenopus oocytes [@halevi2002]. It also plays a role in the maturation of human receptor in Xenopus oocytes and cell lines (Section \@ref(ric-3nacho)). More recently, RIC-3 has been shown to influence folding and maturation of insect nAChRs. Co-expression of Dm$\alpha2$-containing and Dm$\alpha5$/$\alpha7$ receptors with RIC-3 improved [@lansdell2008], and in some instances enabled expression in otherwise non-permissible systems [@lansdell2012]. Up to 3.5-fold increase in specific binding of radiolabelled antagonist was noted in insect cells co-transfected with RIC-3, suggesting the presence of greater number of folded receptors on the cell surface [@lansdell2008]. Expressed receptors have been also shown to be functional. In Xenopus oocytes, ionic currents were detected in response to acetylcholine [@lansdell2012].
<!-- <!-- RIC-3 enabled identification of potential insect nAChRs. Co expression of Drosophila $\alpha5$ and $\alpha7$ either singlularly or in combonation, gave rise to cell-surface expression, as shown by radiolabelled ligand binding [@lansdell] and heteromeric $\alpha5$/$\alpha7$. The identity of other insect receptors is unknown. -->
<!-- (ref:turnover) **Nicotinic acetylcholine receptor turnover.** Synthesised nAChR subunit peptides undergo folding and oligomerisation in the ER. Correctly folded receptors are transported into the Golgi (1). Misfolded subunits and misassembled receptors are retained in the ER and eventually degraded (2). Receptors transported to the Golgi undergo maturation to be shipped to the plasma membrane (4). Receptors in the plasma membrane are eventually degraded or recycled. Receptors are first packed into the endosome (4) and transported to the lysosome or proteosome for degradation (5) or re-inserted into the plasma membrane (6). -->
<!-- ```{r turnover-label, fig.cap="(ref:turnover)", fig.scap= 'Nicotinic acetylcholine receptor turnover.', fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/general_intro/png/nAChR_turnover.png") -->
<!-- ``` -->
<!-- clothiandidin on the abdominal ganglion [@thany2009] and imidacloprid on the Colorado potato beetle (CPB), . -->
<!-- Imi IC5 0 = 0.4 mM EC50 = 18.3 nM these vaues are from @tan2007. note he also look at the resistant strain -->
<!-- single-electrode voltage clamp @tan2007 (intracellular) depolarisation and see for comparison of activity between all neonics -->
<!-- @thany2009 also did patch clamp inward current -->
<!-- @ihara2006 whole cell patch clamp inward current -->
<!-- Mannitol-gap recordings - must read this was used @buchingham1997, @tan2007 - extracellular recording schematic in tan2007 -->
<!-- The process starts in the nucleus where nAChR gene is transcribed into the mRNA. mRNA contains specific signal sequence which allows for nucleus exit and targeting to the endoplasmic reticulum (ER). Upon arrival at the ER membrane, the co-translational synthesis of receptor subunit occurs, starting from the N-terminus. The protein is inserted into the ER membrane, the signal sequence is cleaved off, and the N-glycosylation chain is attached to the glycosylation recognition sequence [@blount1990]. In addition, the initial folding and oligomerisation occurs. Upon completion of protein synthesis, post-translation events are taking place which include disulphide bridge formation [@blount1990] and further folding and oligomerisation. There are two models describing the process of subunit assembly based of mammalian muscle receptors. First assumes that fully folded subunit forms dimers, and then assembly into pentameric assemblies [@gu1991]. Second theory describes that trimers are formed before the remainder subunits are added to form a pentamer [@green1993]. -->
<!-- The process of subunit assembly is complex and probably regulated by a set of rules, such as the control over the subunits expression in the cell [@missias1996] and the primary structure of receptor subunits. In particular sequences within N-terminal (extracellular ligand binding domain) [@sumikawa1992; @sumikawa1994; @kreienkamp1995] but also regions within the TM domain [@wang1996a] and C-terminus [@eertmoed1999]. During receptor assembly, these sequences become buried within the folding protein and the receptor can be transported to the cell surface. Should a protein misfold, the sequences become exposed and the protein retained in the ER. -->
<!-- Therefore, the process of receptor biogenesis is complex and highly regulated. Should a protein misfold or misoligomerise, it is sent for degradation [@brodsky1999] mediated by the ER-associated system [@hampton2002]. In contrast, properly folded and oligomerised receptors are targeted to appropriate cellular localisation. Neuronal receptors are sent to the synapse, those in muscle cells are targeted to the NMJ during synaptogenesis, where they can perform their important function in signal propagation. The process of receptor turnover is demostarted in Figure \@ref(fig:turnover-label). -->
<!-- Receptor assembly and -->
<!-- The role of RIC-3 (resistant to inhibitors of cholinesterase-3) protein in an ER residing proteinin receptor maturation was first identified by @@halevi2002, who demonstrated that . Heterogous expression of *C. elegans* however, upon co-expression of RIC-3 proteins, both receptor current and ligand binding were detected [@holevi2002]. -->
<!-- The stoichiometry of these receptors in unknown, however there are some potential assemblies. For example Drosophila receptors contain $\alpha4\beta3$, $\alpha1\alpha2\beta2$ and $\beta1\beta2$ subunits [@chamaon2002], based on the immunoprecipitation using antibodies against various receptor subunit types. Using a similar approach, it was shown that *Nilaparvata lugens* $\alpha1$, $\alpha2$ and $\beta1$, as well as $\alpha3$, $\alpha8$ and $\beta1$ co-assembly. -->
<!-- These neuronal effects are reflected in the behavioural data [@sone1994]. Upon exposure to toxic dose of neonicotinoids, insects udergo convulsions, uncoordinated movement, tremors as well as feeding inhibition, eventual paralysis and death [@suchail2001; @boiteau1997; @alexander2007]. -->
<!-- "connections between afferents sensory neurons with interneurons or with motoneurons in several insects such as the cockroach" -->
<!-- ### Recombinant receptors -->
<!-- Recombinant insect nAChR are notoriously difficult to express. Several interventions have been tested including expression of hybrid receptor in which insect subunits have been co-expressed with mammalian ones. It need to be noted that this method has several limitations. First, hybrid receptors are not biologically relevant, thus conclusions from these studies should be drawn with caution. Second, some some of the expressed receptors may be folded, but not functional. Lastly, this method enabled expression of only a handful of receptors, thus most remained uncharacterised. This hinders their pharmacological characterisation and identification of subunits important in conferring the agricultural role of neonicotinoids. Heterologous expression of nAChR from insects and other species would allow for the characterisation of the interactions of these proteins with neonicotinoids to better define their mode of action and selective toxicity. Development of the platform in which the heterologous expression of insect nAChRs could be achieved, would open the door to screening of novel insecticides, to combat emerging and spreading neonicotinoid-resistance (Section \@ref(resgenevidence)) and @charaabi2018). In addition, by expressing nAChRs from pest and other species identification of compounds with no adverse effects on beneficial insects and other biologically important species may be achieved. Model organism *C. elegans* is a system in which the mode of action and the selective toxicity can be studied. -->
## *C. elegans* as a model system for expression of nAChRs
As indicated, the expression of insect receptors is limited due to diffuculties in heterologous expression in Xenopus oocytes or cell lines. This suggests that these systems do not offer appropriate cellular environment for receptor maturation. Model organism *C. elegans* is an alternative model in which heterologous receptor expression can be achieved [@crisford2011; @salom2012; @sloan2015].
*C. elegans* is a transparent non-parasitic nematode, inhabiting temperate soil environments. This worm was first described as a new species in 1900 [@maupas1900] and named *Caenorhabditis elegans* Greek *caeno* meaning recent, *rhabditis* meaning rod-like and Latin *elegans* meaning elegant. The natural isolate of this species was extracted from the compost heap in Bristol by Sydney Brenner in 1960's and named N2. Since, *C. elegans* has become a valued lab tool and a model organism due to ethical, economical and biological reasons. In contrast to vertebral organisms, *C. elegans* is not protected under most animal research legislation. The cost of use is low, due to the cost of purchase (~$6/strain), maintenance, fast life cycle and high fertility of these animals. *C. elegans* has also is also the first multicellular organism to have the whole genome sequenced [@consortium1998] and the neuronal network has been mapped [@white1986]. It has an advantage over other model organisms in that its nervous system is relatively simple and it is amenable to genetic manipulations.
### General biology of *C. elegans* ##{#genbiology}
*C. elegans* exists as a male and hermaphrodite, with the latter sex being the more prevalent one. In the lab, 99.9 % of worms are hermaphrodites, which self-fertilize their eggs. *C. elegans* has a fast life-cycle (www.wormbook.org), which is temperature-dependent. At 15^o^C, it takes 5.5 days from egg-fertilization to the development of a worm into an adult. This process is shortened to 3.5 and 2.5 days at 20 and 25 deg;C, respectively (Figure \@ref(fig:life-cycle-label)). At 20 degrees, hermaphrodite lay eggs 2.5 hours after the fertilisation. 8 hours later the embryo hatches as a larvae in the first stage of its development (L1). In the presence of food, larvae develops into an adult through three further developmental stages, namely L2, L3 and L4. The transition between each larval stage is marked by a process of maulting, during which the old cuticle is shed and replaced by a new one. In the absence of food, developing L2 and L3 worms enter the dauer stage. The worms can remain arrested at this low metabolic activity state for up to several weeks, and will develop into adults, should the food re-appear. Hermaphrodites remain fertile for the first three days of their adulthood. Their eggs can be fertilised internally with the sperm produced by the hermaphrodite, or, if there are males available, by mating. Unmated worm can lay up to 350 eggs, whereas mated over a 1000 eggs. Figure \@ref(fig:life-cycle-label) illustrated the full *C. elegans* life cycle.
(ref:life-cycle) **The life cycle of *C. elegans*.** *C. elegans* develops into an adult through 4 larval stages L1- L4. These stages are separated by molts associated with shedding of an old and exposure of a new cuticle. Adults emerge can lay over a 1000 eggs a day which hatch within several hours. Dauer stage is a metabolic compromised worm stage entered in the absence of food. Upon re-appearance of food, worms develop into L4 and adults normally. Figure taken from www.wormatlas.org.
```{r life-cycle-label, fig.cap="(ref:life-cycle)", fig.scap='The life cycle of \\textit{C. elegans}.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/intro_2/life-cycle.jpg")
```
### Nervous system of *C. elegans*
A great advantage of *C. elegans* is that the entire nervous system has been mapped [@white1986], using electron microscopy of serial worm cross sections. A hermaphrodite has a total of 302 neurons present in the ventral nerve cord, the pharynx, the circumpharangeal ring and the tail. These neurons are assigned to 118 classes based on morphology and positioning. There are 39 sensory neurons, 27 motor neurons and 52 interneurons. Pharyngeal nervous system consists of 20 neurons belonging to 14 types.
### Behaviour as an analytical tool ###{#analytical_behaviour}
Over half of the century of *C. elegans* research developed a great depth of understanding of many of their simple and more sophisticated behaviors. These behaviors can be can be scored and quantified to inform on the effects of compounds or genetic alterations on worms.
#### Pharyngeal pumping
An example of a well defined worm behavior is pharyngeal pumping. Pharyngeal pumping is the feeding behavior of the worm mediated by the pharynx. Successive and timed contraction-relaxation cycles of this muscular organ results in the capture, misceration and passage of the food particles down the alimentary track.
Pharyngeal pumping can be easily scored by counting the number of pharyngeal pumps over time to determine the effects of compounds or genetic alteration on the function of the pharynx. In addition, pharyngeal cellular assays can be performed which offer not only a greater temporal resolution of the activity of the pharynx, but also an analysis of the function of distinct anatomical features of the pharynx.
EPG (electropharyngeogram) is an extracellular electrical recording from the pharynx of the worm. It arises as a result of the flow of ions out of the worm's mouth, due to the changes in the membrane potential of the pharyngeal muscle. A single pharyngeal pump gives rise a series of electrical transients collectively called an EPG. These electrical transients are temporally defined and represents activities of distinct anatomical feature of the phayngeal muscle, namely the corpus, isthmus and the teminal bulb [@raizen1994; @franks2006].
#### Locomotion ####{#locomotionbehaviour}
*C. elegans* exhibits distinct locomotory behavior in liquid and on solid medium. Whilst in liquid it flexes back and forth in the middle of the body. On solid medium, it performs S shaped, crawling movement. The direction of this movement is mostly forward and achieved due to the friction between the substrate and the body [@niebur1993]. By counting the number of bends in the unit of time in the presence and absence of treatment, the effects on locomotory behaviour can be measured.
#### Egg laying ####{#egglayingbehaviour}
*C. elegans* reproduces mainly by self-fertilisation of hermaphrodites or less frequently by mating with males. Hermaphrodite is sexually ready to be fertilized from young adult, the eggs are stored in the uterus and laid in defined spacio-temporal fashion. Typically, 5 eggs are laid at the time in approximately 20 minute intervals [@waggoner1998]. The number of egg laid in the unit of time can be counted and used to inform on the effects of treatment on the reproductive ability of the worm.
### Mode of action studies
*C. elegans* is amenable to genetic manipulations. There is a range of genetic techiques available to generate mutant strains, in which the expression of a certain protein is greatly reduced or eliminated [@boulin2012]. Using these techniques, hundreds of mutant strains have been generated. These strains have been deposited and are available from the Caenorhabditis Genetics Center (CGC). Behaviour analysis of mutant strains allows for the identification of proteins important in the regulation of many aspects of worm behaviour; an approach used for the mode of action studies.
### Acetylcholine regulates feeding, locomotion and reproduction in *C. elegans* ## {#cholinergicneurotransmissioninworms}
Many of the *C. elegans* behaviours are regulated by acetylcholine, which is the major neurotransmitter in the nervous system of *C. elegans*. This is evident from the behavioural analysis of mutant strains in which acetylcholine neurotransmission is affected, as well as from the pharmacological effects of cholinergic agents on the behaviour of worms.
*C. elegans* cholinergic synapse expresses enzymes and transporters necessary for the cholinergic neurotransmission. Choline acetyltransferase (ChAT) encoded by the cha-1 gene catalyses the formation of acetylcholine [@rand1985]. Vesicular acetylcholine transferase (VAChT) encoded by unc-17 loads acetylcholine into synaptic vesicles [@alfonso1993]. Null mutations of these genes are lethal due to the inhibition of worm's locomotion and feeding and its eventual death due to starvation [@rand1989; @alfonso1993]. Polymorphic ChAT and VAChT mutants in which the expression is reduced, but not abolished, revealed somewhat opposite phenotype. The pharyngeal pumping both in the presence and absence of food was reduced [@dalliere2015] the movement highly uncoordinated and jerky [@rand1984], whereas egg-laying increased [@bany2003].
Aldicarb is a synthetic carbamate mainly used as a nematicide [@lue1984], commonly used in the pest management system. Its mode of action is via inhibition of the acetylcholine esterase (AChE, the enzyme that breakdown acetylcholine released to the synaptic cleft) [@johnson1983]. When applied on worms, aldicarb causes hypercontraction of the body wall muscle ,leading to paralysis [@nguyen1995; @mulcahy2013], hypercontraction of the pharyngeal muscle and inhibition of feeding [@nguyen1995] as well as the inhibition of egg-laying [@nguyen1995]. These observations in conjunction with the phenotypical analysis of *cha-1* and *unc-17* mutants, suggest acetylcholine stimulates feeding, coordinates locomotion and inhibits egg-laying in *C. elegans*.
<!-- #### Levamisole -->
<!-- Levamisole is a synthetic compound used in treatment of parasitic worm infestation in both humans and animals [@miller1980]. It is an agonist of a subset of receptors present at a body wall muscle [@richmond1999]. Levamisole causes spastic paralysis of worms [@lewis1980b], stimulates egg-laying [@trent1983], -->
<!-- #### Nicotine -->
<!-- Nicotine is an exhogenous agonist, naturally occurring in Tobacco plant. Nicotine is an aonist on the second type receptor at a body wall muscle, namely the N-type, but based on the nicotine-intoxication worm phenotype, it is likely to target receptors regulating pharyngeal pumping and vulva muscle. Nicotine inhibits locomotion [@kudelska2017] pharyngeal pumping [@kudelska2018], and egg-laying [@]. -->
<!-- #### Neonicotinoids -->
<!-- #### Neonicotinoids -->
<!-- (ref:cholsynapsecelegand) **Enzymes and transporters at the *C. elegans* cholinergic synapse.** Upon release into the synaptic cleft, acetylcholine is broken down to choline and acetate by acetylcholinesterase (AChE). Choline is taken up to the pre-synapse by a choline transporter (ChT). The acetyl group in transferred onto choline to product acetylcholine; a reaction catalysed by choline transferase (ChAT). Generated acetylcholine is pumped back into the synaptic vesicle by the vesicular acetylcholine transporter (AChT) for re-cycling. Names of genes are depicted in small blue letters. Image taken from @rand2006. -->
<!-- ```{r cholsynapsecelegand-label, fig.cap="(ref:cholsynapsecelegand)", echo=FALSE, fig.scap='Enzymes and transporters at the *C. elegans* cholinergic synapse.',fig.align='center', echo = FALSE} -->
<!-- knitr::include_graphics("fig/general_intro/png/cholinergic_synapse_C.elegans.jpg") -->
<!-- ``` -->
### *C. elegans* nAChRs ###{#celegansnacheintro}
*C. elegans* contains 29 genes encoding for nAChR subunits [@jones2007a]. The receptor subunits are assigned to five groups based on the sequence homology: DEG-3, ACR-16, ACR-8, UNC-38, and UNC-26. The ECD domain sequence identity between members of these five groups and insect receptors is low (Figure (\@ref(fig:seqidentityecd-label)), suggesing distinct pharmacophore in the nAChRs of *C. elegans* and insects.
<!-- The amino acid sequences from the ligand binding domains of insect and *C. elegans* were aligned and the sequence identities between the insect and *C. elegans* subunits is low with the average identity of 35 %. Least homologous subunits are members of the DEG-3 family with the mean value of 28 %, the sequence identity between insects and other three groups of *C. elegans* receptors varies between 37 and 41 %. Low similarity between the residues of the ligand binding domain suggest these subunits diverged during the evolution thus have distinct pharmacophore. -->
In *C. elegans* nAChRs are expresses at the neuromuscular junction [@richmond1999] and in the nervous system [@lewis1987]. To date, four receptors assemblies have been identified. (1) A single neuronal receptor composed of DES-2 and DEG-3 subunits [@treinin1998]. (2) There are two receptor at the body wall muscle differentiated based on their pharmacology into L-(levamisole) type and N-(nicotine) type [@richmond1999]. The subunit composition of these receptors is respectively: UNC-29, UNC-38, UNC-63, LEV-1, LEV-8 associated with auxiliary subunits RIC-3, UNC-50, and UNC-74 [@boulin2008] and ACR-16 homopentamer [@touroutine2005] (more details is Section \@ref(muscletypenachr)). EAT-2 is a predicted $\beta$ nAChR subunit expressed in the pharyngeal muscle, believed to assemble with auxilary subunit EAT-18, based on common localisation and behavioural phenotypes of *eat-2* and *eat-18 C. elegans* mutants [@mckay2004]. Based on the expression in Xenopus oocytes, ACR-2 and UNC-38 may co-assembly [@squire1995].
<!-- # ```{r celegans-nachrs, echo=FALSE, message = FALSE, warning=FALSE} -->
<!-- # library(kableExtra) -->
<!-- # library(dplyr) -->
<!-- # celegans_nachrs <- data.frame( -->
<!-- # Group = c("DEG-3", "ACR-16", "ACR-8", "UNC-38", "UNC-29"), -->
<!-- # Subunits = c("ACR-17, ACR-18, ACR-20, ACR-22*, ACR-23, DES-2, DEG-3\nACR-24, ACR-5", "ACR-7, ACR-9*, ACR-10, ACR-11, ACR-14*, ACR-15\nACR-16, ACR-19, ACR-21, ACR-25*, EAT-2*", "ACR-8, ACR-12, LEV-8", "UNC-38, UNC-63, ACR-6", "ACR-2*, ACR-3*, UNC-29*, LEV-1*")) -->
<!-- # -->
<!-- # celegans_nachrs %>% -->
<!-- # mutate_all(linebreak) %>% -->
<!-- # kable(format = "latex", align = "l", booktabs = TRUE, escape = FALSE, -->
<!-- # caption = 'nAChR subunits in \\textit{C. elegans}.') %>% -->
<!-- # kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>% -->
<!-- # footnote(general= " Non-alpha subunits are marked with *. Figure modified from Holden-Dye el al., 2013.", -->
<!-- # threeparttable = T) -->
<!-- # ``` -->
(ref:seqidentityecd) **Amino acid sequence identity between the insect and *C. elegans* nAChR subunits.** Sequences of the honeybee and *C. elegans* extracellular, ligand binding domains were aligned using the Multiple Sequence Comparison by Log- Expectation (MUSCLE). Sequence identities were derived with the HMMER alignment and color-coded using red-yellow-green scale. *C. elegans* subunits of the UNC-38 group are the most homologous to the insect subunits.
```{r seqidentityecd-label, fig.cap = "(ref:seqidentityecd)", fig.scap="Amino acid sequence identity between the insect and *C. elegans* nAChR subunits", out.height = '120%', fig.align= 'center', echo=FALSE}
knitr::include_graphics("fig/general_intro/pdf/identity_clipped_renamed_aligned_celegans_apismelifera.png")
```
## Heterologous expression of nAChRs in *C. elegans* ##{#hetexpeffectsofphysiology}
*C. elegans* can be used as a platform to study functional and pharmacological properties of nAChRs. This method relays on the ability to generate transgenic worms by microinjection.
<!-- Microinjection is a process by which a plasmid containing cDNA encoding for a protein of interest is injected into the syncytium distal arm of the gonad(s) of the young adult hermaphrodite worm [@stinchcomb1985]. The injected DNA in taken up by the the residing oocytes [@wolke2007], which become fertilised and develop into an adult worm. Using cellular machinery, the DNA plasmid forms extrachromosomal arrays , from which the cDNA becomes transcribed, translated and expressed [@stinchcomb1985; @mello1991]. -->
*C. elegans* expresses nAChRs are the neuromuscular junction and in nervous cells, thus it possesses cellular machinery necessary for the processing of these proteins. Several *C. elegens* chaperons involved in nAChRs maturation and function have been identified. RIC-3 is a ubiquitously expressed in *C. elegans* (Section \@ref(ric-3celegans)). It has a role in folding and assembly of nematode, insect (Section \@ref(ric3insect)) and vertebrate nAChRs (Section \@ref(ric3insect)). *C. elegans* RIC-3 has been shown to improve heterologous expression of insect hybrid [@lansdell2012] and mammalian nAChR [@lansdell2005] in cell lines and Xenopus oocytes. UNC-74, UNC-50 are ER and Golgi residing proteins, respectively, involved in maturation of *C. elegans* nAChRs. Whereas EAT-18 is a transmembrane protein, expressed on the cell surface, required for the function of nAChRs in the pharyngeal muscle. Details of their function can be found in Sections \@ref(unc50), \@ref(unc74) and \@ref(eat18)). It is therefore predicted that *C. elegans* has a favorable cellular environment for the expression of nAChRs.
The expression of transgene can be driven in specific cells or tissues by utilising native promoters. Conjugated monoclonal antibodies were used to show selective expression of myo-3 (heavy chain of myosin B) at the body-wall muscle and vulva muscle [@ardizzi1987] and myo-2 (myosin heavy chain C) in the pharyngeal muscle [@okkema1993] of the intact worm. Thus, by using myo-3 or myo-2 promoters upstream of the heterologous gene, expression at the body wall or pharyngeal muscle, respectively, can be achieved [@sloan2015; @crisford2011].
Heterologous expression of receptor proteins can have several consequences on the worm:
(1) When re-introduced into the mutant strain, it can restore drug or cellular function [@crisford2011; @salom2012].
<!-- For example, expression of *C. elegans* and human ortholog of the potassium-activated calcium channel Slo-1 at the body wall muscle of *C. elegans slo-1* mutant restored sensitivity to selective agonist emodepsite in locomotory assays -->
(2) Heterologous expression in wild-type worm can lead to new or altered pharmacological sensitivity [@crisford2011; @salom2012].
<!-- emonstrated that the ectopical expression of Slo-1 in the pharyngeal muscle cell confers sensitivity to emodepsite. -->
<!-- The locomotory deficit and levamisole-resistance of *C. elegans unc-38* mutants was reversed upon expression of nAChRs of the parasitic worm UNC-38 [@sloan2015]. Whereas human GPCR A~2a~R expressed in the body wall muscle or nerve cells conferred behavioural response to receptor specific ligand [@salom2012]. In addition, the A~2A~R selective agonist CGS21680 stimulated locomotion of transgenic worms in a dose dependent manner. Enhanced response to non-specific GPCR agonist adenosine in transgenic worms expressing A~2a~R in the body wall muscle was also noted. -->
Thus, heterologous expression combined with behavioural and pharmacological analysis of transgenic worms can inform on their functional and pharmacological properties of recombinant nAChRs.
<!-- Heterologous expression of nAChRs can have several consequences, due to their involvement in many biological processes. *C. elegans* nAChRs are the main excitatory receptors at the neuromuscular junction [@riddle1997) and are involved in regulation of many aspects of worm’s behaviour, including feeding [@avery2012] locomotion [@richmond1999], egg-laying [@schafer2005; @bany2003]. They are also expressed in neuronal cells constituting to sensory and integrating circuits and are involved in chemosensory behaviour, as well as signal integration and neuronal plasticity [@yassin2001]. More recently their implicated in the regulation of development has been investigated [@ruaud2006]. -->
## Aims
The overall aim of this project is to develop *C. elegans* as a platform for the heterologous expression of nAChRs, with the aim to gain insight into selective toxicity of neonicotinoids insecticides :
1. Define sensitivity of *C. elegans* to these compounds. The representatives of three distinct chemical classes of neonicotinoids will be used: cyanoamidine clothianidin, nitroguanidine thiacloprid and nitromethylene nitenpyram. Their effects on *C. elegans* will by tested utilising behavioural and cellular assays to define their potency on distinct neuronal circuits.
2. Identify suitable *C. elegans* genetic background with defined cholinergic function for the expression of nAChRs.
3. Develop assays by which the functional nAChR expression and drug-sensitivity can be tested.
02-methods.Rmd
View file @ e74fe8cf
# Methods {#methods} # Methods {#methods}
Methods chapter. ```{r echo=FALSE, results="hide", include=FALSE}
\ No newline at end of file library(grid)
library(cowplot)
library(tidyverse)
library(ggpubr)
library(readr)
library(ggplot2)
library(scales)
library(curl)
library(devtools)
library(extrafont)
library(magick)
library(kableExtra)
```
## General bacterial methods
### Transformation of *E. coli* with DNA vectors
Briefly, 25 to 50 $\mu$L of chemically competent Mach1 or DH5$\alpha$ *Escherichia coli (E.coli)* cells were combined and gently mixed with ~10 pg of plasmid DNA. The mix was left on ice for 30 minutes. Cells were placed in 42$^\circ$C water bath and after 45 seconds placed back on ice. Next, 250-500 $\mu$L of growth medium (Luria-Bertani (LB) broth) was added and cells placed in the 37 $^\circ$C shaking incubator for 45 minutes to 1 hour. The entire volume of cells was spread onto 10 cm LB-agar plate containing an appropriate antibiotic for selection. Antibiotics used for each vector selection are listed in Table \@ref(tab:antibiotics-used). Cells were spread on plates were left in the 37$^{\circ}$C incubator overnight to allow for growth of transformed cells into colonies.
```{r antibiotics-used, echo=FALSE}
library(kableExtra)
text_tbl <- data.frame(
Plasmid = c("pET26", "pBMH", "pET27b(+)", "pcDNA3.1", "PCR-8-TOPO", "pDEST"),
Antibiotic = c("Kanamycin", "Ampicillin", "Kanamycin", "Ampicillin", "Spectinomycin", "Ampicillin"))
knitr::kable(text_tbl, format = "latex", caption = 'Selection pressure for DNA plasmids used in this study.', booktabs = TRUE) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>%
footnote(general = "Ampicillin used at a final concentration of 0.1 mg/mL, whereas kanamycin and spectinomycin at 0.05 mg/mL.",
threeparttable=T)
```
\newpage
### Isolation of DNA plasmid from *E. coli* ### {#miniprep}
Transformed *E.coli* colony was picked, placed in 5 mL of LB supplemented with appropriate antibiotic and incubated overnight at 37 $^{\circ}$C whilst shaking. DNA was extracted using the MiniPrep Kit (Thermo Scientific or Qiagen) following the manufacturers instructions. Centrifugation was carried out in table top centrifuge at 12 000 g. Isolated DNA was quantified in a Nanodrop UV-Vis spectophotometer.
### Analytic digestion of DNA plasmids
DNA plasmids were digested with restriction enzyme(s) (Promega). The reaction mix (Table \@ref(tab:RE-reaction) was incubated at 37 $^{\circ}$C for 2-8 hours and the DNA fragments were resolved on the agarose gel (Section \@ref(electrophoresis)).
```{r RE-reaction, echo=FALSE}
RE_reaction <- data.frame(
Remove = c("10x Buffer", "BSA", "DNA", "Enzyme", "dH$_2$O"),
Remove = c("1 $\\mu$L", "0.1 $\\mu$L", "1-2 $\\mu$g", "5 units", "up to 10 $\\mu$L"))
names(RE_reaction) <- NULL
knitr::kable(RE_reaction, "latex", escape = FALSE, booktabs = TRUE, caption = "Components assembled to cary out restriction enzyme reaction.") %>%
kable_styling(latex_options = "hold_position")
# %>% kable_styling(position = "center") # use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page). Note that the styling function does not work here because it is from the extra package
```
## General molecular biology methods
### Amplification of DNA fragments by Polymerase Chain Reaction (PCR)
#### Primer design
To enable the amplification of the DNA of interest, appropriate PCR primers were designed applying the following criteria: primers were unique to the annealing site on the designated DNA, 18 to 25 nucleotides long, guanine-cytosine content from 40 to 60 %, melting temperature from 55 to 75 $^{\circ}$C. Where possible, primers rich in guanine and cytosine at 3’ end were selected to facilitate high specificity of primer binding to the target. The primers were ordered from Eurofins Genomics, subsequently diluted in ddH~2~O to the concentration of 100 pmol/$\mu$l and stored at -20 $^{\circ}$C. Sequences of primers used in this study can be found in Table \@ref(tab:primer-seq1).
```{r primer-seq1, echo=FALSE}
library(kableExtra)
library(dplyr)
pcr_primer_seqs <- data.frame(
DNA.product = c("\\textit{Ndel-pelB-3C-SalI}", "\\textit{SalI,$\\alpha$7ECD-2GSC-NheI}", "\\textit{CHRNA7}", "\\textit{eat-2}"),
Primer = c("Fw: gaaggagatatacatatgaaatacctg\nRv: TAGCTTGTCGACgggcccctggaacagaacttc", "Fw: AGCTCCGTCGACtttcagcgtaaactgtacaaag\nRv: ACTAGCTAGCTTAaagcttagccgcaccacggcg", "Fw: atgcgctgctcgccgggaggcg\nRv: ttacgcaaagtctttggacacggc", "Fw: atgaccttgaaaatcgca\nRv: ttattcaatatcaacaatcgg"),
Size = c("1560", "1051", "1509", "1425"))
pcr_primer_seqs %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("DNA product", "DNA primer", "Size\n(bp)")), caption = "DNA primers used in this study.") %>%
kable_styling(latex_options = "hold_position") %>%
footnote(general = "Sequences are presented in 5' to 3' direction, non-complementary nucleotides are in capital letters whereas complementary in small letters. Fw stands for forward, whereas Rv for reverse primer.",
threeparttable = T)
```
\newpage
#### PCR Protocol
PCR was performed using either Phusion High-Fidelity DNA Polymerase (Thermo Scientific) or Pfu DNA polymerase (Promega) as indicated. The components mixed and cycling conditions used are listed in Tables \@ref(tab:Phusion-pol) and \@ref(tab:Pfu-pol).
<!-- Table: (\#tab:PCR-cond) PCR conditions used to amplify DNA fragments. -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |Primer |Primer T~M~| Polymerase|PCR T~A~ |Extension | -->
<!-- | |(&deg;C) |used |(&deg;C) |time | -->
<!-- +==========================+===========+===========+==========+==========+ -->
<!-- |Fw/Rv |59.3/81.3 | Pfu |45.0 |3 minutes | -->
<!-- |NdeI-pelB-3C-SalI | | | | | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |Fw/Rv |75.8/79.2 | Phusion |55.4 |30 seconds| -->
<!-- |SalI-Hu$\alpha7$ | | | | | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |/Rv |71.4/62.7 | Phusions | 50-62 |45 seconds| -->
<!-- |CHRNA7 | | | | | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |Fw/Rv |59.7/50.1 |Phusion | 53.4 |45 seconds| -->
<!-- |eat2 | | | | | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- Table: (\#tab:Taq-pol) Components assembled for Taq polymerase-mediated PCR reaction. -->
<!-- +---------------+---------------------------+ -->
<!-- |Component |Concentration | -->
<!-- +===============+===========================+ -->
<!-- |Buffer | 1x | -->
<!-- +---------------+---------------------------+ -->
<!-- |dNTP mix | 200 &mu;M | -->
<!-- +---------------+---------------------------+ -->
<!-- |Reverse/ | | -->
<!-- |Forward primer | 200 nM | -->
<!-- +---------------+---------------------------+ -->
<!-- |DNA | 25 ng/10&mu;L reaction | -->
<!-- +---------------+---------------------------+ -->
<!-- |Indicated | | -->
<!-- |Polymerase | 0.25U/10&mu;L reaction | -->
<!-- +---------------+---------------------------+ -->
<!-- |ddH~2~0 | up to up to 10/50 &mu;L | -->
<!-- +---------------+---------------------------+ -->
<!-- Table: (\#tab:Taq-pol-2) Thermal cycling conditions for Taq polymerase-mediated PCR reaction. -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Step |Duration |Temperature |Number | -->
<!-- | | | |of cycles | -->
<!-- +====================+===========+============+=============+ -->
<!-- |Initial denaturation|2 mins |95 &deg;C |1 | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Denaturation |45 secs |95 &deg;C | | -->
<!-- | | | | | -->
<!-- |Annealing |45 secs |various |25-35 | -->
<!-- | | | | | -->
<!-- |Extension |1 min/kb |72 &deg;C | | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Final extension |5 mins |72 &deg;C |1 | -->
<!-- +--------------------+-----------+------------+-------------+ -->
```{r Phusion-pol, echo=FALSE}
library(kableExtra)
library(dplyr)
phusion_components <- data.frame(
Component = c("Buffer", "dNTP mix", "Reverse/\nForward primer", "DNA", "Polymerase", "ddH$_2$O"),
Concentration = c("1x", "200 $\\mu$M", "500 nM", "10 ng / 50 $\\mu$L reaction", "0.5 U / 50 $\\mu$L reaction", "up to 50 $\\mu$L"))
phusion_components %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
caption = "Components assembled for Phusion polymerase-mediated PCR reaction.") %>%
kable_styling(latex_options = "hold_position")
```
<!-- Table: (\#tab:Phusion-pol-2) Thermal cycling conditions for Phusion polymerase-mediated PCR reaction. -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Step |Duration |Temperature |Number | -->
<!-- | | | |of cycles | -->
<!-- +====================+===========+============+=============+ -->
<!-- |Initial denaturation|20 secs |98 &deg;C |1 | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Denaturation |10 secs |98 &deg;C | | -->
<!-- | | | | | -->
<!-- |Annealing |30 secs |various |25-35 | -->
<!-- | | | | | -->
<!-- |Extension |30s/kb |72 &deg;C | | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Final extension |7 mins |72 &deg;C |1 | -->
<!-- +-----------------------------------------------------------+ -->
```{r Pfu-pol, echo= FALSE}
library(kableExtra)
library(dplyr)
phusion_components <- data.frame(
Component = c("Buffer", "dNTP mix", "Reverse/\nForward primer", "DNA", "Polymerase", "ddH$_2$O"),
Concentration = c("1x", "200 $\\mu$M", "500 nM", "25 ng / 50 $\\mu$L reaction", "0.25 U / 50 $\\mu$L reaction", "up to 50 $\\mu$L"))
phusion_components %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
caption = "Components assembled for Pfu polymerase-mediated PCR reaction.") %>%
kable_styling(latex_options = "hold_position")
```
\newpage
<!-- Table: (\#tab:Pfu-pol-2) Thermal cycling conditions for Pfu polymerase-mediated PCR reaction. -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Step |Duration |Temperature |Number | -->
<!-- | | | |of cycles | -->
<!-- +====================+===========+============+=============+ -->
<!-- |Initial denaturation|5 mins |95 &deg;C |1 | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Denaturation |30 secs |95 &deg;C | | -->
<!-- | | | | | -->
<!-- |Annealing |30 secs |various |25-35 | -->
<!-- | | | | | -->
<!-- |Extension |2 mins/kb |72 &deg;C | | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Final extension |5 mins |72 &deg;C |1 | -->
<!-- +-----------------------------------------------------------+ -->
Thermal cycling conditions used for amplification of *C. elegans* nAChR subunit *eat-2*, whole length and the extracellular domain of human $\alpha7$ nAChR subunit as well as $pelB-HIS-MBP-3C$ sequence (sequence for expression of genes and purification of proteins from *E. coli*) are shown in Tables \@ref(tab:eat2-amplification) - \@ref(tab:human-lgd-amplification).
```{r eat2-amplification, echo=FALSE}
eat2_amplification <- data.frame(
Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
Duration = c("2 mins", "1 mins", "30 secs", "3 mins", "5 mins"),
Temperature = c("95", "95", "51.1", "73", "73"),
Number = c ("1", " ", "30", " ", "1"))
eat2_amplification %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of eat-2 from pTB207 plasmid with Pfu polymerase.") %>%
kable_styling(latex_options = "hold_position")
```
```{r CHRNA7-amplification, echo=FALSE}
library(kableExtra)
library(dplyr)
CHRNA7_amplification <- data.frame(
Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
Duration = c("30 secs", "10 secs", "30 secs", "45 secs", "7 mins"),
Temperature = c("98", "98", "gradient", "72", "72"),
Number = c ("1", " ", "30", " ", "1"))
CHRNA7_amplification %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of human $\\alpha$7 nAChR (CHRNA7) from pcDNA3.1 plasmid with Phusion polymerase.") %>%
kable_styling(latex_options = "hold_position") %>%
footnote(general = "gradient annealing temperatures were: 50, 51.1, 53.4, 57.2, 60.2",
threeparttable = T)
```
\newpage
```{r MBP-amplification, echo=FALSE}
library(kableExtra)
library(dplyr)
mbp_amplification <- data.frame(
Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
Duration = c("3 mins", "1 mins", "30 secs", "3 mins", "5 mins"),
Temperature = c("95", "95", "45", "73", "73"),
Number = c ("1", " ", "35", " ", "1"))
mbp_amplification %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of pelB-HIS-MBP-3C from pET26-GLIC plasmid with Pfu polymerase.") %>%
kable_styling(latex_options = "hold_position")
```
```{r human-lgd-amplification, echo=FALSE}
library(kableExtra)
library(dplyr)
humanlgd_amplification <- data.frame(
Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
Duration = c("30 secs", "10 secs", "45 secs", "45 secs", "7 mins"),
Temperature = c("98", "98", "51.7", "72", "72"),
Number = c ("1", " ", "35", " ", "1"))
humanlgd_amplification %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of human $\\alpha$7 nAChR ligand binding domain from pBMH plasmid with Phusion HF polymerase (Thermo Scientific).") %>%
kable_styling(latex_options = "hold_position")
```
\newpage
### DNA electrophoresis ### {#electrophoresis}
To resolve the size of DNA samples, agarose gel electrophoresis was run using BioRad Wide horizontal electrophoresis system and PowerPac Basic Power Supply. The resolving gel was prepared by addition of agarose (0.6-1.2 % (w/v); Sigma Aldrich) to 1x TAE (40 mM Tris, 20 mM acetic acid, 1 mM EDTA) buffer. This mix was heated in the microwave until agarose completely melted and left on the bench to cool down to ~ 50 $^\circ$C. Subsequently, Nancy-520 DNA Gel Stain (Sigma-Aldrich) at 5 mg/mL was added in 1:1000 (v/v) dilution and the mixture was poured into the gel caster. Meanwhile, the DNA samples were prepared by mixing them with 1 % (v/v) loading dye (Blue/Orange Loading Dye, Promega). Once the gel set, the samples were loaded into wells alongside the indicated molecular weight marker. Markers variously used in this thesis include 1kb Hyperladder (Bioline), 1kb ladder (Promega) or 1 kb Plus DNA ladder (Thermo Scientific). Electrophoresis was run at 70 V until the samples were sufficiently resolved (typically 30 minutes to 2 hours) and gels imaged using Syngenta GBox.
### DNA purification following PCR and electrophoresis
Following gel electrophoresis, the band of interest was visualised under the UV light and isolated by cutting with a surgical blade.
DNA was subsequently purified using GeneJET Gel Extraction Kit (Thermo Scientific) or Gel Extraction Kit (Qiagen) following manufacturers protocols.
<!-- (ref:t4-ligation) Generation of plasmids by T4-dependent ligation. DNA fragment is PCR amplified and gel purified (1). Digestion of plasmid and DNA fragment with restriction enzymes (RE, 2) generates complementary overhangs which can be ligated with T4 ligase (3) to generate recombinant DNA plasmid. -->
<!-- ```{r, t4-ligation-label, fig.cap="(ref:t4-ligation)", echo=FALSE, fig.width=9} -->
<!-- knitr::include_graphics("fig/methods/t4_cloning.png") -->
### Ligation dependent cloning ###{#ligationdependentcloning}
The DNA vector for expression of human nAChR was generated by T4 dependent ligation. PCR-amplified, gel-excised and digested with SalI and NdeI pelB-HIS-MBP-3C gene was inserted into the digested pET27 plasmid. The complementary sequences were ligated with T4 ligase (Table \@ref(tab:T4-ligase)). Next, PCR-amplified, gel-excised and digested with SalI and NheI human $\alpha7$ extracellular domain (ECD) was ligated into the digested pET27-pelB-HIS-MBP-3C. Both times reaction mixtures were incubated at room temperature for 3-4 hours and used to transform chemically competent Mach1 cells. 50-100 $\mu$L of cells were transformed with 2.5-8 $\mu$L ligation reaction mix.
```{r T4-ligase, echo=FALSE}
ligation_table <- data.frame(
Remove = c("Ligase buffer", "Backbone DNA", "Insert DNA", "T4 DNA ligase", "ddH$_2$O"),
Remove = c("1 x", "100 ng", "3:1 insert:backbone ratio", "1 unit", "up to 10 $\\mu$L"))
names(ligation_table) <- NULL
kable(ligation_table, format = "latex", escape = FALSE, align = 'l', booktabs = TRUE, caption = "Components assembled to carry out ligation-dependent cloning reaction.") %>% kable_styling(position = "center", latex_options = "hold_position")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)
```
### Gateway cloning ###{#gatewaycloning}
Vectors for generation of *C. elegans* transgenic genes were generated by recombinant Gateway Cloning.
<!-- (ref:gateway-cloning) Gateway recombinant cloning to generate expression vectors. The gene of interest was PCR amplified, gel pufiried and 3' A overhangs added (1) by Taq polymerase. It was then cloned into TOPO vector by TA recombination (2) reaction to generate the entry clone containing a gene of interest. Expression vector was generated by LR recombination between the L site containing entry clone and R sites containing destination vector. The desired vector was selected with an antibiotic. -->
<!-- ```{r gateway-label, fig.cap="(ref:gateway-cloning)", echo=FALSE} -->
<!-- knitr::include_graphics("fig/methods/Gateway_Cloning.png") -->
<!-- ``` -->
#### Generation of the entry (TOPO) vector by TA recombination ####{#adenosineoverhang}
3' adenine overhangs were added to the amplified and gel purified DNA fragment in the reaction using non-proofreading Extend Long Roche Polymerase (ThermoScientific) (Table \@ref(tab:a-overhangs-addition)).
```{r a-overhangs-addition, echo=FALSE}
gateway_cloning <- data.frame(
Remove = c("Polymerase", "10 x Buffer B", "DNA", "dNTP", "ddH$_2$O"),
Remove = c("5 U/20 $\\mu$L reaction", "1x", "up to 500 ng", "200 $\\mu$M", "up to 10 $\\mu$L"))
names(gateway_cloning) <- NULL
options(knitr.table.format= "latex")
knitr::kable(gateway_cloning, escape = FALSE, booktabs = TRUE, caption = "Addition of adenine overhangs to PCR product for entry clone generation.") %>%
kable_styling(latex_options = "hold_position")
# %>% kable_styling(position = "center")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)
```
TA reaction was assembled (Table \@ref(tab:TA-reaction)), incubated at room temperature for 1 hour and 2 $\mu$L of the reaction mix was used to transform 50 $\mu$L DH5$\alpha$ chemically competent cells. DNA was isolated from transformed colonies and sequenced to ensure the correct sequence and orientation of the insert.
```{r TA-reaction, echo=FALSE}
topo_reaction_tb <- data.frame(
Remove = c("PCR-8 TOPO vector", "Salt solution", "PCR product", "ddH$_2$O"),
Remove = c("1 $\\mu$L", "1 $\\mu$L", "up to 500 ng", "up to 6 $\\mu$L"))
names(topo_reaction_tb) <- NULL
options(knitr.table.format= "latex")
knitr::kable(topo_reaction_tb, escape = FALSE, align = 'l', booktabs = TRUE, caption = "Components assembled for the generation of the entry clone for Gateway cloning.") %>%
kable_styling(latex_options = "hold_position")
# %>% kable_styling(position = "center")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)
```
#### Generation of the expression vector by LR reaction ####{#lr-reaction-section}
LR reaction was assembled using Gateway LR Clonase II Enzyme Mix (Invitrogen) (Table \@ref(tab:LR-reaction). Reaction was incubated at room temperature for 2 hours. To inactivate the enzyme, 2 $\mu$L of proteinase K was added and the reaction mix was incubated at 37 $^\circ$C for 10 minutes. 1 $\mu$L of reaction mix was used to transform 50 $\mu$L of One Shot OmniMAX 2 T1 phage resistant cells (Invitrogen). Transformed cells were plated and grew overnight. Following, plasmid was isolated from transformed cells and subjected to sequencing to ensure successful formation of the plasmid.
```{r LR-reaction, echo=FALSE}
gateway_cloning2 <- data.frame(
Remove = c("Entry clone (PCR-8-TOPO-CHANR7)", "Destination vector (pDEST-Pmyo2)", "LR Clonase II", "TE buffer (pH=8)"),
Remove = c("75 ng", "75 ng", "1 $\\mu$L", "up to 5 $\\mu$L"))
names(gateway_cloning2) <- NULL
options(knitr.table.format= "latex")
knitr::kable(gateway_cloning2, escape = FALSE, align = 'l', booktabs = TRUE, caption = "Components assembled for the generation of recombinant vector by gateway cloning.") %>%
kable_styling(latex_options = "hold_position")
# %>% kable_styling(position = "center")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)
```
## Expression of human $\alpha7$ nAChR in *E. coli*
Heterologous protein was expressed in and subsequently purified from *E. coli* (Figure \@ref(fig:purification-label)).
(ref:purifcation-fig) **The process of heterologous protein expression in *E. coli* and protein purification.** Plasmid containing gene of interest is transformed into *E. coli* cells. Transformed cells are grown in medium and the protein expression induced by addition of IPTG. Cells are subsequently harvested, re-suspended in buffer and cellular content released by sonication. The supernatant containing soluble proteins is isolated from cellular debris by centrifugation and the heterologous protein isolated using metal affinity chromatography. His tagged protein bound to Nickel^2+^ are eluted with imidazole, whereas Maltose Binding Protein (MBP) tagged proteins bound to Dextrin Sepharose beads are eluted with maltose.
```{r purification-label, fig.cap="(ref:purifcation-fig)", fig.scap= "The process of heterologous protein expression in \\textit{E. coli} and subsequent purification.", fig.align= "centre", echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/purification-process.png")
```
### Growth of transformed *E. coli* cells
Chemically competent bacterial cells (BL21(DE3)) engineered for high efficiency protein expression were transformed with the authenticated expression vector as described (Section \@ref(miniprep)). Transformed colonies were resuspended and placed in 5 mL of growth medium supplemented with the appropriate antibiotic. Seed culture was placed in the shaking incubator at 37 $^\circ$C and left to grow until OD~600nm~ of 1-2. This starter culture was used to inoculate growth medium supplemented with appropriate antibiotic in 2 L baffled flasks, to the final OD~600nm~ of 0.01-0.05. Inoculated flasks were placed in a shaking incubator at 37 $^\circ$C, 250 RPM. The following protocol was followed, unless otherwise stated: At OD~600nm~ = 0.5, the temperature was lowered to 18 $^\circ$C. When the 18 $^\circ$C culture reached an OD~600nm~ ≈ 1, 0.2 mM isopropyl $\beta$-D-1-thiogalactopyranoside (IPTG) was added and the growth continued overnight at 18 $^\circ$C.
### Protein purification ### {#purification-general-methods}
*E.coli* were harvested by centrifuging the cell culture at 5000 g for 20 minutes at 4 $^\circ$C and either used immediately or stored at -20 $^\circ$C for further use.
Harvested cells were kept on ice throughout the purification procedure. Two methods of purification were tested: HIS-tag purification using Ni-NTA resin and maltose binding protein (MBP) purification with Sepharose-Dextrin Beads (GE Healthcare Life Sciences).
### HIS-tag purification #### {#his}
The composition of buffers used is as follows :
Re-suspension buffer: 0.1M TRIS (pH=8), 0.15 M NaCl. Wash buffer 1: as previous. Wash buffer 2: 0.1 M TRIS (pH=8), 1 M NaCl. Wash buffer 3: 0.1 M TRIS, (pH=8), 0.15 M NaCl. Elution buffer: 0.1 M TRIS, (pH=8), 0.15 M NaCl, 0.2 M imidazole (pH=7.5)
Cells harvested from 1 L of culture medium were re-suspended in 40 mL re-suspension buffer supplemented with 2 Pierce™ Protease Inhibitor Mini Tablets (Thermo Fisher Scientific) and sonicated on ice using the following settings: power 7, pulse on: 10 seconds, pulse off: 20 seconds, total time 6 minutes. Sonicated cells were subject to 16000 g spin for 45 minutes at 4 $^\circ$C to sediment cellular debris. The supernatant was collected and spun again at 100 000 g for 1 hour at 4 $^\circ$C to separate non-soluble fraction (e.g. aggregated proteins) in the pellet from the supernatant containing soluble fraction. Supernatant was mixed with 0.5 mL of Ni-NTA resin (previously equilibrated in the resuspension buffer) and equilibrated for 1 hour or overnight at 4 $^\circ$C on the rotating tube rotator (speed 8-9). Following this incubation, the mix was decanted into a low pressure 5 mL chromatography column. Resin was washed with 10 mL of each one of the 3 washing buffers. Lastly, bound to Ni-NTA resin proteins were eluted off by addition of 5 x 0.5 mL of elution buffer. Eluted fractions were stored at 4 $^\circ$C. At each stage, a samples consisting of the pre induction (pre-I; post induction (post-I) Homogenate (H) (Whole cells), high speed supernatant (LOAD), Flow through (FT0) wash (W) and eluate (E) fractions were collected for SDS-PAGE analysis (Section \@ref(samples)).
<!-- ### MBP purification -->
<!-- The composition of buffers used is as follows : -->
<!-- ---------- ------------------------------------------- -->
<!-- Buffer A 20 mM TRIS (pH=7.4), 200 mM NaCl, 1mM EDTA -->
<!-- Buffer B 50 mM TRIS (pH=7.4) -->
<!-- Buffer C 50 mM TRIS (pH=7.4), 10 mM maltose -->
<!-- --------- -------------------------------------------- -->
<!-- Cells harvested from 1 L culture was re-suspended in 40 mL of buffer A and processed as described above to genetrate the Load Fraction (Section \@ref(his)). Load Supernatant was equilibrated with 8 mL of sepharose beads, equilibrated in buffer A. Supernatant was decanted into a low pressure 5 mL chromatography column. The beads were washed with 30 mL of buffer A and 5 mL of buffer B. Elution performed by application of 5 x 0.5 mL of buffer C. Purified proteins were stored at 4 &deg;C. At each stage, a sample was collected for SDS-PAGE analysis. -->
### Quantification of protein expression and purification
Protein content of the eluted samples was measured with NanoDrop 1000 Spectrophotometer V3.7 at 280 nM and the following parameters, as measured by Compute pI/Mw tool (http://web.expasy.org/compute_pi/): Mw (kDa) of pentameric full length protein = 420, extinction coefficient (/1000)= 132.95. Two $\mu$L of the elution buffer/buffer C were used to blank the spectrophotometer, and 2 $\mu$L of the elution fractions was used to estimate the protein concentration of the sample.
### Analysis of protein molecular weight using denaturing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
#### Sample preparation #### {#samples}
This section described how each sample was prepared. Pre and post induction whole cell samples: 1 mL of *E. coli* cell culture was taken, spun down in tabletop centrifuge at max speed for 5 minutes. Supernatant was discarded, pellet re-suspended in 150 $\mu$L dH~2~O. Total protein content of 2 $\mu$L samples were measured with NanoDrop by measuring protein absorbance at 280 nm. Seventy mg/ml of protein was loaded onto a gel in each sample. Cell lysate: following sonication, 30 $\mu$L of cell lysate was taken. Cell-debris and supernatant: 30 $\mu$L of cell lysate sample taken, spun down in tabletop centrifuge for 10 mins at maximum speed, at 4 $^\circ$C. supernatant was pipetted into another micro centrifuge (labelled supernatant) tube whereas pellet re-suspended in 30 $\mu$L dH~2~O (labelled whole-cell). Supernatant and Pellet samples: 50 $\mu$L of cell lysate spun down in tabletop centrifuge for 10 mins at maximum speed, at 4 $^\circ$C. Thirty $\mu$L of the supernatant taken, spun down in ultracentrifuge at 100 000 g, at 4 $^\circ$C for 1 hour. Supernatant was pipetted into another microcentrifuge tube (ultra-supernatant) whereas debris was re-suspended in 30 $\mu$L of dH~2~0. The same volumes of cell-lysate, cell-debris, supernatant, ultra-supernatant, ultra-pellet and flow-through were loaded onto SDS-PAGE gels. Protein samples were mixed with sample buffer (2 % SDS, 2 mM DTT, 4 % glycerol, 0.04 M Tris pH = 6.8, 0.01 % bromophenol blue) and boiled for 5 – 10 minutes. Next, 4 – 10 $\mu$L samples were loaded onto 8 – 12 % acrylamide SDS-PAGE gel alongside 4 $\mu$L of Protein Marker PageRulerTM Prestained/Unstained Protein (Thermo Fisher Scientific).
#### Gel electrophoresis
##### Gel preparation ####{#gelprep}
Protein samples were subject to denaturing SDS-PAGE and stained with the Commassie stain to visualise and estimate the size of protein species. SDS-PAGE constituted from a stacking gel (5 % acrylamide/bisacrylamide, 0.72 M Tris pH = 8.4, 0.025 % ammonium persulfate, 0.4 % TEMED, 0.1 % SDS) casted over a resolving gel (12 % acrylamide/bisacrylamide, 1 M Tris pH = 8.4, 0.06 % ammonium persulfate, 0.13 % TEMED, 0.1 % SDS).
BioRad electrophoresis apparatus was used. Electrophoresis chamber was filled with the running buffer (25 mM Tris, 192 mM glycine, 0.1 % SDS) and the electrophoresis proceeded at 80 V for 1 hour and then 120 V for 2 hours. The gel was either stained to visualise all proteins present in samples, or used in Western blot to detect the presence of a specific protein.
#### Coomassie staining and imaging ####{#coomassiestaining}
Following SDS-PAGE electrophoresis, the stack and resolving gel were incubated in fixing buffer (10 % acetic acid, 40 % ethanol, 50 % dH~2~O) placed on an oscillating platform for at least 1 hour to remove background staining. The fixed gel was then washed with dH~2~O and incubated with Coomassie stain (14 mg of Coomassie Blue R-250 (ThermoScientific) /L of dH~2~O) overnight. The gel was de-stained by incubation with dH~2~O for at least 8 hours and imaged with Gel Doc^TM^ XR+ (Bio-Rad).
### Analysis of protein molecular weight using one-dimensional non-denaturing polyacrylamide gel electrophoresis
#### Sample preparation.
Two protein eluate samples were collected from the immobilized metal affinity chromatography (IMAC) and mixed with sample buffer (4 % glycerol, 0.04 M Tris pH = 6.8, 0.01 % bromophenol blue). One sample was boiled for 5 minutes to denature proteins, whereas the other was not. Next, 4 – 10 $\mu$L prepared samples were loaded onto 12 % nondenaturing polyacrylamide gel, alongside 4 $\mu$L of 1 mg/mL of bovine serum albumin, which served as a marker.
##### Gel preparation
Nondenaturing gel (12 % acrylamide/bisacrylamide, 1 M Tris pH = 8.4, 0.06 % ammonium persulfate, 0.13 % TEMED) was used to resolve the size of proteins.
##### Gel electrophoresis
BioRad electrophoresis apparatus was used. Electrophoresis chamber was filled with the running buffer (25 mM Tris, 192 mM glycine) and the electrophoresis proceeded at 80 V for 1 hour and then 120 V for 2 hours. The gel was stained and imaged as described in Section \@ref(coomassiestaining)
### Western blots ###{#western}
#### Protein transfer
Resolved protein are transferred to polyvinylidene difluoride (PVDF). Membrane cut to the size of the resolving gel was equilibrated for 15 minutes to 1 hour in the transfer buffer (12.1 g Tris, 57.6 g glycine, 800 mL methanol in total volume of 4 L) then washed with dH~2~O followed by methanol. Freshly run polyacrylamide gel was placed on top of the submerged in transfer buffer sponge, 2 x filter paper and PVDF membrane stack and covered with 2 x filter paper. Assembled transfer mount with the gel and PVDF membrane was placed in the BioRad Mini Trans-Blot Module which was in turn inserted into Mini-PROTEAN Tetra Cell tank. The tank was filled with transfer buffer and the protein transferred from the gel onto the membrane at 100 V constant voltage for for 1 - 3 hours at 4 $^\circ$C.
#### Antibody binding ####{#abs}
Transfer of his-tagged human $\alpha7$ nAChR ECD-chimera protein were detected using 1 mg/mL monoclonal mouse anti-Hexa-His primary antibodies (Thermo Fisher Scientific) and 1mg/mL IRDye® 680RD Goat anti-Mouse IgG (Li-Cor) used at 1 in 1000 dilution. PVDF membrane was incubated for at least 1 hour in blocking, primary and secondary antibody buffer (Table \@ref(tab:WB-buffers)). To remove residual solution, three 10-minute-long washes were carried out in-between and after last incubations.
```{r WB-buffers, echo=FALSE, fig.pos = 'H'}
wb_bfrs <- data.frame(
A = c("Washing buffer", "Blocking buffer", "Primary Antibody buffer", "Secondary Antibody buffer"),
Remove = c("1 x phosphate buffered saline (PBS), 0.05 $\\%$ TWEEN", "1 x PBS, 0.05 $\\%$ (v/v) TWEEN 20 (BioRad), 5 $\\%$ BSA", "5 mL Blocking buffer, 5 $\\mu$L primary antibody", "5 mL blocking buffer, 5 $\\mu$L secondary antibody")) # note that the percentage sign also has to be in a math mode
names(wb_bfrs) <- NULL
options(knitr.table.format= "latex")
knitr::kable(wb_bfrs, escape = FALSE, align = 'l', booktabs = TRUE, caption = "Composition of buffers used for Western blotting.") %>%
kable_styling(latex_options = "hold_position")# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)
```
#### Western blot imaging
Immunodecorated PVDF were imaged using Odyssey imaging system (Li-Cor Biosciences). Images in the 800 nm channel detects protein bands tagged by the IRDye 800CW secondary antibody. This was cross referenced to images scanned in the 700 nm to detect protein ladder bands and 800 nm channels.
#### Gel filtration
Protein purified and eluted with the Ni-NTA resin were subject to size exclusion chromatography with GE Healthcare Superdex^TM^ 200 10/300GL column with the separation range between 10 and 600 kDa. This methods allows for the molecular weight assessment and separation of proteins present in the sample based on their mobility through the resin-filled column.
#### Sample preparation
Sample prepared with VIVASPIN20 column with the cut off point of 30 kDa (Sartorius) by spinning down in a centrifuge at 36 000 RPM at 4 $^\circ$C.
#### Buffers
Buffer used : 0.1M TRIS (pH=8), 0.15 M NaCl degassed and ddH~2~0 degassed.
#### Calibration of the column ####{#calibration}
To estimate the size of proteins present in the sample, standard curve was generated. Four proteins were selected as protein standards: trypsin of 23.3 kDa, chicken serum albumin of 47.5 kDa, bovine serum albumin of 66.5 kDa and dextrin which forms large aggregates. These aggregates are larger than the column capacity, therefore dextrin serves as void. Solutions of 3 mg/mL of trypsin, chicken and bovine serum albumin were prepared and 1 mg/mL of dextrin. Protein solutions were injected into the column one at the time at a flow rate of 0.4 mL/ min. The eluted volume at which peak position as a function of volume eluted was noted for each protein. All peak positions were normalised to the position of the void (dextrin) (Figure \@ref(fig:protein-standard-label)). Linear regression line was plotted of the log protein size (kDa) as a function of normalised volume eluted (Figure \@ref(fig:standard-curve-gel-filtration-label). The standard equation of the line was derived: y = - 0.1738 * peak position + 2. 776.
\newpage
```{r, echo=FALSE, fig.pos = 'H'}
text_tbl2 <- data.frame (
Protein = c("Blue dextran", "Bovine Serum Albumin", "Chicken Serum Albumin", "Trypsin"),
Mwt = c("NA", "66.45", "47.29", "23.30"),
log = c("NA", "1.82", "1.68", "1.37"),
Peak = c("9.48", "14.73", "16.38", "17.23"),
Nomalised = c("0", "5.25", "6.90", "7.75"))
text_tbl2 %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("Protein", "Mwt (kDa)", "log Mwt", "Peak position\n(mL)", "Normalised\npeak position"))) %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position")
```
(ref:protein-standard) **Gel filtration of protein markers.** Data derived from the spectra and normalised to the dextran void.
```{r protein-standard-label, fig.cap = "(ref:protein-standard)", fig.scap = "Gel filtration of protein markers.", fig.align = 'center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/gel-filtration-spectra.png")
```
\newpage
## *C. elegans* methods
### *C. elegans* strains
Wild type strain:
N2 (Bristol)
Mutant strains:
CB7431 (genotype *bus-17, (allele br2)X.* ; outcrossed x4
AD465 (genotype *eat-2, (allele ad465)II.* ; outcrossed x0
FX863 (genotype *acr-7, (alleletm863)II.* ; outcrossed x0
Transgenic strains:
eat-2 (ad465) II Ex; [pDESTgcy32 (Pmyo-3::GFP)]
eat-2 (ad465) II Ex; [[pDESTgcy32 (Pmyo-2::CHRNA7)]; [pDESTgcy32 (Pmyo-3::GFP)]]
eat-2 (ad465) II Ex; [[pDESTgcy32 (Pmyo-2::EAT-2); [pDESTgcy32 (Pmyo-3::GFP)]]
### *C. elegans* culture
*C. elegans* strains were cultured at 20 $^\circ$C on the nematode growth medium (NGM) [@brenner1974] and fed with OP50 strain of *E. coli*. Worms were picked with a platinum wire.
### Preparation of *C. elegans* plates ### {#plates}
NGM was prepared weekly in 4 or 8 L batches as described: 2 % agar (w/v), 0.25 % peptone (w/v), 50 mM NacL (w/v) in dH~2~0. The components were autoclaved and cooled to 55 $^\circ$C, then 1 mM MgSO~4~, 1 mM CaCl~2~, 1 mM K~2~HPO~4~ and 0.1 % cholesterol were added. 10 mL NGM portions were poured into 5.5 cm Petri dishes with a peristaltic pump. Once solidified, NGM were seeded with 50 $\mu$L of OP50. OP50 was applied in the middle of the plate, creating a round food patch for *C. elegans* to feed on. Prepared plates were left overnight to allow bacteria growth.
### Maintanance and preparation of *E. coli* OP50
Fresh stock of OP50 plates were prepared at monthly intervals. A single colony was picked from the OP50 stock plate and placed in 10 mL of LB. Following overnight growth, cells were streaked on a plate and allowed to form colonies by incubation at 37 $^\circ$C.
### *E. coli* OP50 culture
To prepare OP50 culture, a single colony was picked from the OP50 stock plate and placed in 10 mL of LB. Bacterial culture was grown in a shaking incubator at 37 $^\circ$C until OD~600nm~ reached 0.6 to reach the exponentially growing phase. Cultures were stored at 4 $^\circ$C for up to 2 week and used to seed NGM plates.
### General *C. elegans* methods
All experiments, with the exception of the development assay, were performed on young hermaphrodite adults (L4 + 1 day). Drugs and reagents were purchased from Sigma Aldrich, unless otherwise stated. Behavioral observations were made using a binocular microscope, unless otherwise stated. Results are expressed as mean $\pm$ SEM of ‘N’ determinations. Graph generation and measurement of EC~50~ or IC~50~ were performed in GraphPad (version 6.07). Concentration response curves were fitted into nonlinear regression sigmoidal dose-response (three parameter logistic) equation [@hill1910].
### Drug stocks
5-HT was used in form of serotonin creatinine sulfate monohydrate, ampicillin in form of sodium salt, whereas nicotine was in the form of hydrogen tartrate salt. Stock concentration of FITC-alpha-bungarotoxin (FITC-$\alpha$-Bgtx) at 500 $\mu$g/ml was made in ddH~2~O. Thiacloprid and clothianidin were dissolved in 100 % dimethyl sulfoxide (DMSO). Nitenpyram and nicotine stocks were prepared by dissolving drugs in dH~2~0 and diluted to the indicated final concentrations. Working concentration of 100 $\mu$g/mL FITC-$\alpha$Bgtx was prepared and stored at 4 $^\circ$C for up to 2 weeks. The solution was span down briefly before use to pellet aggregates. Drugs were stored at -18 $^\circ$C for long term storage (>1 month). Once defrosted, they were used within 2 weeks or discarded. Nitenpyram stock was made immediately prior to the experiment and protected from light using foil to prevent photo-degradation. Buffers used for the behavioral assays in liquid were supplemented with 0.1 % (w/v) Bovine Serum Albumin (BSA), which prevents worms from sticking to the bottom of the experimental plate. Therefore, M9 and Dent’s solution refer to buffers supplemented with BSA, unless otherwise stated.
### Effects of drugs on intact *C. elegans* locomotion and feeding behavior upon acute exposure. {#liquidassay}
All assays were performed in M9 medium. M9 buffer composition is (g/litre): 6 g Na~2~HPO~4~, 3 g KH~2~PO~4~, 5 g NaCl, 0.25 g MgSO~4~.H~2~O. Worms were exposed to varying indicated concentrations of nicotine or neonicotinoids for a maximum period of 2 hours. The effects of these compounds on locomotion and feeding was scored.
10 x stock concentrations nicotine, nitenpyram and 5-HT were added to the assay to give the indicated final concentration. To keep the concentration of DMSO below the concentration that have known effects (data not shown) the stocks of thiacloprid and clothianidin in 100 % DMSO were used in 1 in 200 (0.5 %) dilution and mixed vigorously with buffer.
#### Effects of drugs on of intact *C. elegans* in liquid ####{#thrashing}
Whilst in liquid, worms exhibit rhythmical swimming-like behaviour known as thrashing. A single thrash was defined as a complete bend in the mid-point of the body. Experiments were performed in a 24-well plate filled with 450 or 497 $\mu$L buffer. 50 $\mu$L nicotine/ nitenpyram/vehicle or 2.5 $\mu$L thiacloprid/clothianidin was added to the final volume of 500 $\mu$L to achieve final desired concentration.
Worms were picked off the food and transferred to the experimental arena. After 5 minutes of acclimatization to allow recovery from mechanical transfer, the first thrashing count was performed (time 0). This provided baseline thrashing for each worm. Only thrashing worms were included in the analysis. After estimation control thrashing wells were supplemented with drug / vehicle. For experiments with 1.5 mM thiacloprid, worms were transferred in a small volume of liquid (~2 $\mu$L) from the control to the experimental well by pipetting. This method was adopted due to drug’s limited solubility. It must be noted that after a period of about 40 minutes, 1.5 mM thiacloprid began to visibly precipitate. Measurements were taken for 30 seconds typically at time points: 10, 30, 40, 60 and 120 post-addition of the drug/drug vehicle. At least three independent repeats for each condition were carried out. The number of worms in each experiment varied from 2 to 6.
<!-- (ref:thrashing-method) **Diagram of thrashing experimental arena.** -->
<!-- ```{r thrashing-method-figure, fig.cap="(ref:thrashing-method)", fig.scap = "Diagram of thrashing experimental arena.", fig.align='center', echo=FALSE, fig.pos = 'H'} -->
<!-- knitr::include_graphics("fig/methods/thrashing_experiment.png") -->
<!-- ``` -->
#### Onset of paralysis {#onset}
The trashing assay was performed as described above but the time interval between measurements was reduced from 30 seconds to every 2 minutes for the first 10 minutes. Worms were exposed to drug concentrations which induced paralysis in the thrashing experiment. That is wild-type worms were submerged in 100 mM nicotine, whereas *bus-17* in 25 mM nicotine, 50 mM nitenpyram or 1.5 mM thiacloprid. These concentrations were achieved by addition of 100 $\mu$L nicotine stock or vehicle into 900 $\mu$L buffer, 5 $\mu$L of thiacloprid/clothianidin stock or vehicle into 995 $\mu$L buffer or 10 $\mu$L nitenpyram or vehicle into 90 $\mu$L buffer. Twelve well plates were used. The protocol was followed as described in Section \@ref(thrashing), but after a period of acclimatisation, worms were transferred from control to the experimental well by pipetting.
#### Recovery from drug-induced paralysis
The recovery assay was designed to determine if and how quickly worms recovered from drug-induced paralysis. Twenty four-well plates were used and worms assayed in a total volume of 500 $\mu$L (Section \@ref(thrashing)) with the exception of nitenpyram experiment in which 25 $\mu$L nitenpyram stock or vehicle was added to 225 $\mu$L buffer to give a final volume of 250 $\mu$L.
Following the initial thrashing count (Section \@ref(thrashing)), worms were transferred to drug concentrations inducing paralysis. Worms were incubated in nicotine for 20 minutes, thiacloprid or nitenpyram for 1 hour - that is until a steady state inhibition or full paralysis (time point 0). Subsequently, worms were transferred to a wash well to observe the recovery and thrashing was counted at 10, 30, 60, 90, 120 and 150 minutes. Alongside this test group, a positive and a negative control experiments were carried out. For the positive control, worms were transferred from buffer to drug containing medium. For a negative control, worms were transferred from buffer to buffer containing a drug solvent and back to the buffer.
#### Effects of drugs on pharmacologically induced pharyngeal pumping of intact *C. elegans* #### {#pumping}
Pharyngeal pumping assay was employed to determine the effects of compounds on the pharynx - a feeding organ of worms. Pharyngeal pumping is mediated by three main muscular anatomical structures (the corpus, anterior isthmus and the terminal bulb) which contract and relax to suck and push in the food. This activity is coupled with a movement of the grinder - a structure responsible for crushing the food into smaller particles so it can be passed down into the intestine. Therefore, to score this behaviour, the number of grinder movements per minute was counted (where forward lateral movement of the grinder and its return to the resting place was counted as 1). In this experiment, worms were assayed in the presence of the pharyngeal stimulant 5-HT. In liquid the presence of 5-HT causes immobility and stimulate pharyngeal pumping. Experiments were performed in a 24-well plate in a total volume of 500 $\mu$L (or in 250 $\mu$L for nitenpyram). Worms were picked off the food and placed in a well containing buffer. To paralyse worms and stimulate their pharyngeal pumping, 5-HT was added from stock to a final concentration of 10 mM. After 30 minutes, the 5-HT stimulated pump rate was measured. Following, the treatment/solvent was added and the effects on pumping were recorded 30 minutes later. Data was displayed in pumps per second (Hz). Data collection was carried out in collaboration with Amelia Lewis.
#### Effects of drugs on *C. elegans* size
To determine the effects of drug exposure on worms size, *bus-17* worms were submerged in 1 mL of buffer, 50 mM nicotine, 50 mM nitenpyram, 1.5 mM thiacloprid or 2.5 mM clothianidin or vehicle control (dilutions described in Section \@ref(onset)) in 12 well plates. Four hours later, worms were transferred by pipetting onto 2 % agarose pads and immobilised with 6 $\mu$L of 10 mM sodium azide. Images were taken immediately using Nikon Eclipse Microscope.
Size of worms was determined in ImageJ. The scale was set using a graticule and length measured from the tip of the tail to the tip of the head with the freehand function. For improved accuracy, three measurements of each worm were taken and an average was derived.
### Effects of drugs on intact *C. elegans* behaviour upon 24-hour exposure ###{#onplateassay}
On-plate assays were carried out to determine the effects of prolonged drug exposure on *C. elegans* behaviour. Worms were placed on NGM plates containing the indicated drug / drug vehicle and a food source in form of *E. coli* OP50 patch. All drugs were added to the NGM at 1 in 200 dilution.
### Plate preparation
NGM was prepared as described in Section \@ref(plates). Fifty $\mu$L of drug solution at appropriate concentration was added to 10 mL of molten NGM at approx 50 $^\circ$C and mixed by gentle inversion. 3 mL of such mix was placed in each of the three successive wells of a 6-well plate (Figure \@ref(fig:on-plate-assay-method)). The medium was left overnight to solidify. One well was then seeded with 50 $\mu$L of OP50 culture, whereas the other two wells remained unseeded. This provided an experimental arena with the food on, the cleaning well and the experimental arena containing no food. In parallel, control plates containing drug solvent (water or 0.5 % DMSO) were prepared.
Due to heat instability, nitenpyram plates were prepared by pipetting 50 $\mu$L of drug solution onto solidified 3 mL NGM. The plates were left overnight to enable diffusion of the compounds into the solid agar. The appropriate well was then seeded. Nitenpyram-containing plates were covered with aluminium foil at all times, to prevent photodegradation.
(ref:on-plate-assay-fig) **Diagram of the 24-hour “on-plate” assay arena.** Drug or drug solvent was incorporated into the NGM and poured into rows of a 6-well plate. Wells in the first column were seeded with the OP50. Two to four L4 + 1 worms were placed on the experimental arena containing food source. After 24 hours, pumping rate on food and the number of eggs laid per worm were counted. Following, worms were transferred to the cleaning well and left for 5-10 minutes to remove the residual food. Worms were then transferred to the experimental arena containing no food source. After period of acclimatisation (5-10 minutes), their locomotion on food was measured by counting body bends.
```{r on-plate-assay-method, fig.cap= "(ref:on-plate-assay-fig)", fig.scap="Diagram of the 24-hour “on-plate” assay arena.", fig.align='center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/on_plate_experiments.jpg")
```
#### Experimental protocol
Four L4 + 1 worms were picked off food from the culture plate and placed in the first well of the experimental plate containing treatment or solvent. Twenty four hours later, the following behaviours were scored:
1. Pharyngeal pumping on food (feeding behaviour): a pump was defined as described previously (Section \@ref(pumping)). Only worms present on the food lawn were included in analysis.
2. Egg-laying: The number of eggs and larvae was counted to derive the total number of eggs laid over the period of 24-hours. The total value was divided by a number of worms present on a plate. Should a worm disappear from the experimental arena, the results were not included in the analysis.
3. Body bends is the measure of locomotory ability of worms on solid medium. A single body bend was defined as a bend of the below-the-head portion of the body and counted for a period of 1 minute in the absence of food.
4. Egg-hatching: After 24-hour exposure, adults were removed from the plate leaving the eggs and the progeny behind. 24-hours later, the number of unhatched eggs present on the plate was counted. This was expressed as a % of eggs hatched (formula used: 100-(number of unhatched eggs*100/total number of eggs laid).
### Effects of drugs on development of *C. elegans* upon long term (days) exposure
#### Development assay
Experiments were carried out in 12 well plate containing drug or solvent -incorporated and seeded-NGM (prepared as described previously).
Six to twelve young adult hermaphrodites were placed on drug/solvent containing OP50 NGM plates. They were left on a plate for 1 hour to lay eggs, and removed from the plate, leaving the progeny behind. The number of worms in each developmental stage was counted at time points: 24, 30, 48, 54, 72, 80, 96, 120, 144, 168 and 192 hours. Larval stages were scored by following size/vulva/eggs present criteria, described by @karmacharya2009 and shown in Figure \@ref(fig:development-method). If necessary, worms were viewed at higher magnification using Nikon Eclipse E800 microscope. Results were represented as mean % worms in each developmental stage.
(ref:dev-method) ***C. elegans* developmental stages.** Images showing all 4 larval stages of *C. elegans***. L1 are the smallest worms on the plate. L2 are slightly bigger, L3 are bigger still, more mobile and have a pre-vulvar space. L4 has a visible vulva, whereas adults had eggs present in their uterus. The same magnification was used to capture all images, thus scale bar in the top left image applied to all images. Scale bar = 1mm.
```{r development-method, fig.cap= "(ref:dev-method)", fig.scap= "\\textit{C. elegans} developmental stages. ", fig.align='center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/developmental_stages_annotated.jpg")
```
### Effects of drugs on *C. elegans* pharyngeal pumping in dissected head preparation.
#### Dissection of worms to remove the cuticular barrier ####{#cuthead}
L4 + 1 worms were picked off food and placed in 3.5 cm Petri dish filled with 3 mL Dent's saline. Heads containing pharyngeal musculature and nerves is separated from the rest of the body (Figure \@ref(fig:cut-head-image)). By doing so, the cuticular barrier is removed and a portion of the pharynx is exposed to the external solution. The pharynx in cut-head preparation retains its function. It pumps at an average rate of 0.13 Hz over the period of 120 minutes (Figure \@ref(fig:cut-head-ctr-label)). Pumping was defined as described previously (Section \@ref(pumping)), counted for a period of 30 seconds and expressed in Hz. Only worms pumping at rate >0 were used in experiments.
#### Experimental arena
Cut heads were placed in a 12-well plate filled with 1 mL of Dent's saline (glucose 1.8 g, Hepes 1.2 g, NaCl 8.2 g, KCl 0.4 g, CaCl~2~ 0.4 g, MgCl~2~ - 1 mL at 1 M, pH adjusted to 7.4 with 10 M NaoH, 0.1 % BSA (w/v), made daily) with drug solution or vehicle. 100 $\mu$L or nicotine or 5-HT was added to 900 $\mu$L of buffer to achieve desired concentration of the drug. Clothianidin and thiacloprid were used at a 1 in 1000 dilution to keep the DMSO concentration at 0.1 % (v/v). Therefore, 1 $\mu$L of drug stock was added to 999 $\mu$L of buffer. Nitenpyram experiments were performed by addition of 10 $\mu$L of drug stock to 90 $\mu$L of buffer.
(ref:cut-head) **Dissected worm preparation.** The pharynx was liberated from the rest of the body by cutting with a surgical blade just under the terminal bulb whilst viewing under the binocular microscope.
```{r cut-head-image, fig.cap= "(ref:cut-head)", fig.scap= "Dissected worm preparation.", fig.align='center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/WHOLE_AND_CUT_HEAD_2.png")
```
(ref:cut-head-ctr) **Pharyngeal pumping of dissected *C. elegans* in liquid.** Cut heads were placed in Dent's saline and the pharyngeal pumping was counted over time. Measurements were made by visual observations, counted for 30 seconds and expressed in Hz. Data are $\pm$ SEM collected over $\ge$ 2 observations; number of replicates $\ge$ 4. For comparison, the average pharyngeal pumping in the presence of 1 $\mu$M 5-HT is shown is dashed purple line.
```{r cut-head-ctr-label, fig.cap="(ref:cut-head-ctr)", fig.scap= "Pharyngeal pumping of dissected \\textit{C. elegans*} in liquid.", fig.align='center', echo=FALSE, message=FALSE, fig.pos = 'H', warning = FALSE}
#read in cut head data
cut_head <- readRDS("Analysis/Data/Transformed/cut_head/summary_data")
ctr_cut_head_plot <- cut_head %>%
filter(Experiment==12) %>%
filter(Conc==0) %>%
group_by(Time) %>%
ggplot(aes(Time, mean_readout, group=Conc)) +
geom_line() +
geom_point() +
geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se)) +
ylim(0, 5) +
scale_x_continuous(breaks = seq(0, 130, by = 20)) +
ylab("Pumping(Hz)") +
xlab("Time (minutes)") +
theme(text=element_text(size=12, family="sans")) +
ggsave("fig/results3/raw-images/liquid_basal.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results3/liquid_basal_modified.png")
```
### Stimulatory effects of drugs on pharyngeal pumping of dissected *C. elegans*
#### Effects of 5-HT ####{#cuthead-5ht}
Following dissection, the heads were placed in Dent's solution. After 5 minutes the initial count of pharyngeal pumping was made and heads were transferred to a drug containing well. Pharyngeal pumping was estimated at 10, 20, 30, 60 minutes after being placed in the drug. Heads were transferred to Dent’s solution for recovery and pumping measured 30 minutes later (90 minutes after starting the measurements). As a negative control, worms were incubated in buffer throughout the duration of the experiment.
#### Effects of neonicotinoids and nicotine
Experiments were set up as described above (Section \@ref(cuthead-5ht)) but the time points were: 0 (Dent's), 2, 5, 10, 15, 20, 30, 45, 60 65, 75, 90 and 120 (treatment) and 130 (recovery). As a control, cut heads were incubated with a 5-HT concentration eliciting maximal response. That is 1 $\mu$M for wild-type N2 worms and 50 $\mu$M for *eat-2* mutant worms.
### Inhibitory effects of drugs on pharmacologically induced pharyngeal pumping of dissected *C. elegans*
The effects of compounds on 5-HT stimulated pharyngeal pumping was tested.
Cut heads were exposed to 1 $\mu$M 5-HT for 10 minutes to stimulate pumping. Following this, they were transferred to a well containing 5-HT and the indicated treatments. Pharyngeal pumping was measured before and 10, 20, 30, and 50 minutes after transfer into the 5-HT plus treatment incubation. To probe for recovery, heads were placed in 1 $\mu$M 5-HT and the pump rate 5, 10 and 30 minutes after being transferred into recovery (that is 55, 65 and 80 minutes after the start of the experiment) was recorded. As a control, heads were exposed to 5-HT plus solvent throughout the duration of the experiment.
### Extracellular recording from the pharynx of cut head preparation of *C. elegans*
Cut heads were prepared (Section \@ref(cuthead)) and transferred to the experimental arena by pipetting. Extracellular recordings were made with an electropharyngeogram (EPG) technique (Figure \@ref(fig:EPG-setup-method)).
#### Preparation of a microelectrode
Non-filamented borosillicate capillary tube (Havard apparatus) with outer diameter (OD) of 1.5 mm and internal diameter (ID) of 0.1 mm was pulled with a Narishige puller (model PC:10). The puller was set at 98.2 $^\circ$C for step 1 and 72.8 $^\circ$C for step 2 to make a tip of ~ 10 $\mu$m. The needle was back-filled with Dent’s using a micropipette filler (250 $\mu$m ID, 350 $\mu$m OD, World Precision Instruments).
#### Experimental set-up
The microelectrode was inserted into a microelectrode holder containing a silver wire. The microelectrode was inserted into a headstage (HS-2A Asoclamp) and carefully lowered using a micromanipulator (Burleigh) into a recording chamber filled with Dent’s saline and resting on a stage of Axoscope 2 (Zeiss) microscope. The reference electrode was made with a glass capillary filled with 2 % agar in 3 M KCl. The reference electrode was placed in the recording chamber and connected to the amplifier headstage via a dish filled with 3 M KCl solution and a silver wire electrode. The cut head was placed in a recording chamber and a tight seal between the tip of the nose and the microelectrode was made by applying suction. The extracellular electrical signals from the pharynx were amplified by an Axoclamp-2B Microelectrode Amplifier, digitized by Digidata 1322A and recorded with Axoscope 9.2.
(ref:EPG-setup) **Experimental preparation for extracellular recordings from the *C. elegans* pharynx.** A diagram showing the set-up used for EPG experimentation.
```{r EPG-setup-method, fig.cap= "(ref:EPG-setup)", fig.scap = "Experimental preparation for extracellular recordings from the \\textit{C. elegans} pharynx.", fig.align='center', fig.pos = 'H', echo=FALSE}
knitr::include_graphics("fig/methods/EPGsetup.png")
```
#### Experimental protocols
A cut head was placed in a recording chamber. The seal around the tip of the nose and the microelectrode was made and a worm was left for 5 minutes to acclimatise. Solutions changes were were achieved by gravity perfusion with a flow rate of ~ 1 mL/min. The pharyngeal pumping was recorded during control perfusion, drug perfusion and recovery into buffer in 3 equal 5-minute blocks giving a total time of the recording of 15 minutes.
#### Data acquisition and analysis
A single EPG reflects a contruction-relaxation of a pharyngeal muscle. It consists of a series of peaks, including e and E or excitatory peaks, I or inhibitory peak as well as r and R, or repolarising peaks (Figure \@ref(fig:example-epg-label)). The effects of exposure to drugs on three parameters were measured. (1) The pumping rate, which was derived by taking maximum pumping rate in a 10 second window. (2) The E/R ratio, which is the ratio between the ampliture of E and R spikes. This was measured by calculating the average of E/R ratios of all EPGs in the period of the maximum pumping. (2) The pump duration, which is the average duration of all EPGs in the period of the maximum pumping. If there were less then 10 EPGs, 10 consecutive peaks were taken to derive the final pump duration and E/R ratio value.
### Microinjection to generate *C. elegans* transgenic lines ###{#microinjection}
#### Preparation of a needle
Alluminosilicate capillaries SM100F-10 (1 mm external diameter, 0.5 mm internal diameter) needle was pulled with Narishige puller (model PC:10) using the following settings: step 1 at 99 $^\circ$C, step 2 at 79 $^\circ$C. The pulled needle was filled with 1 $\mu$L of injection mix and assembled into Transferman NK2 (Eppendorf) micromanipulator. Microinjection was performed with FemtoJet Microinjector (Eppendorf).
#### Generation of transgenic lines
##### Preparation of DNA microinjection mix
Test DNA plasmid was prepared with a Green Fluorescent Protein (GFP) co-injected marker to identify transgenic worms. Injection mix containing the the test plasmid at (5 ng/μL) and the co-injection marker (30 ng/μL) were resuspended in ddH~2~O and centrifuged at 15000 rpm for 5 minutes to precipitate aggregates. One $\mu$L of the cleared DNA mix was back filled into the injection needle.
##### Injection
A single L4 + 1 was picked from NGM plate and immobilised by gently pressing it into a drop of Halocarbon oil 700 on 2 % agarose pad. The agarose pad was placed on a stage of Nikon Eclipse TE200 microscope and the syncytium of the anterior and/or posterior arm of the *C. elegans* gonad was injected with the DNA mix. Injected worms were gently liberated from the oil with a pick and placed on individual seeded NGM plates.
\newpage
##### Screening of injected plates
The progeny of injected worms were viewed under the fluorescent microscope and GFP filter. Green F1 worms were picked individually onto separate seeded NGM plates and left to propagate. Plates containing green F2s were collected and kept as separate stable lines (Figure \@ref(fig:selection-process-label)).
(ref:selection-process) **Selection of transgenic worms.** L4 + 1 haermaphrodites are co-injected with selectivity marker (i.e. a vector containing gene encoding for GFP under the body wall muscle promoter). Green worms were selected and kept separately as separate lines.
```{r selection-process-label, fig.cap="(ref:selection-process)", fig.scap = "Selection of transgenic worms.", fig.align='center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/select-transgenic-worms.png")
```
\newpage
### Determination of human nAChR expression in the *C. elegans* pharynx by staining with conjugated $\alpha7$ selective antagonist FITC-$\alpha$-bungarotoxin(Bgtx) ###{#fitcmethod}
#### Worm preparation
Worms were submerged in 3 mL of Dent's saline in 5 cm Petri dish. To ease dissection, they were paralysed by placing the dish at -20 $^\circ$C for 5 minutes. Following this, the tip of the nose was cut perpendicular to the head to allow the cuticle to roll back and expose the pharynx. Next, the cut just below the terminal bulb was made and liberated pharynxes collected (Figure \@ref(fig:exposed-pharynx-label)).
(ref:exposed-pharynx-method) **Exposure of the *C. elegans* pharynx.** Using surgical blade, the cut was made at a tip of the nose and just below the terminal bulb (left image, black lines) to expose the pharynx (right).
```{r exposed-pharynx-label, fig.cap= "(ref:exposed-pharynx-method)", fig.scap = "Exposure of the \\textit{C. elegans} pharynx.", fig.align='center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/exposed-pharynx.png")
```
#### Staining
Exposed pharynxes were placed in 1 mL of Dent’s in a single well of a 12 well plate. FITC-$\alpha$Bgtx was added to the final concentration of 1 $\mu$g/mL. The plate was protected from light by covering in foil. The incubation proceeded for 1 hour at room temperature before being washed in 1 mL of Dent’s.
#### Imaging
$\alpha$Bgtx treated pharynxes were transferred onto 2 % agarose pad and covered with a slip. Images were taken immediately at 10x magnification. The preparation was exposed for 0.1 s and FITC filter was applied on NIKON E800 fluorescence microscope. Staining was quantified in ImageJ by subtracting background fluorescence from the fluorescence in the terminal bulb.
03-results-01.Rmd
View file @ e74fe8cf
# First Results {#results-1} # Effects of neonicotinoids on the behaviour and development of *C. elegans* {#results-1}
First results chapter. ```{r echo=FALSE, include=FALSE}
library(cowplot)
library(tidyverse)
library(ggpubr)
library(readr)
library(ggplot2)
library(scales)
library(curl)
library(devtools)
library(knitr)
```
## Introduction
Neonicotinoids are the most commonly used insecticides worldwide due to their high efficacy against pest insects (Section \@ref(potentpests)), selective toxicity to insect pests over mammals (Section \@ref(seltox)) and advantageous physicochemical attributes (Section \@ref(physchem)). The main disadvantage of these compounds is that they can be toxic to non-target species, including bees (Section \@ref(sublethal)). This undesired ecotoxicological effect spurred a debate over their environmental impact and revealed a necessity to further investigate their effects on other ecologically important organisms such as worms.
## Ecological role of non-parasitic worms
Non parasitic earth worms and nematodes, play an important biological role. They are the most abundant multicellular organisms on earth and are significant biomass contributors. In addition, they cycle nutrients contributing as much as 1/5 of all bioavailable nitrogen in soil [@neher2001], promoting plant growth [@ingham1985] and soil fertility. They are also valuable bioindicators and have been used in the assessment of contaminated soil [@lecomte-pradines2014].
## Residues of neonicotinoids in soil
Neonicotinoids are commonly applied as a seed dressing [@jeschke2011; @alford2017], due to a benefit of extended crops protection resulting in a reduction in the insecticide application frequency. However, on average, only 5 % of the active ingredient is taken up by and distributed throughout the developing plant [@sur2003]. The remainder enters the wider environment, including soils, where they can have a negative effect on inhabiting worm species.
The levels of neonicotinoids in terrestrial terrains vary depending on the composition and the physical properties of the soil [@moertl2016; @selim2010; @zhang2018] Numerous studies investigated their levels in various soil types, following variable post planting period and generally report the sub $\mu$M concentrations (reviewed in @wood2017). However, they persist in terrestrial terrains from a few days to several years (reviewed in @goulson2013). Nitenpyram and thiacloprid typically remain there for several weeks, clothianidin for just over a year, whereas imidacloprid for several years. Long dissipation half-life and absorption capacity means that the neonicotinoids may come in contact with soil- residing worms for prolonged time periods. Neonicotinoids can also enter the worm’s interior by multiple routes. They may diffuse across the worm’s cuticle, or be ingested with soil particles [@pisa2015]. Exposure to residual neonicotinoids can have a negative impact on many aspects of worm’s biology.
<!-- ### **C. elegans** in toxicity testing -->
<!-- *C. elegans* is a simple organism, easy to maintain, with well defined anatomy (Sections @\ref(anatomy)) and behaviour (Section @\ref(analytical_behaviour)). One of its major advantages is that it amenable to genetic manipulations (Section @\ref(genmanip)). Since its isolation in 1950, it has grown into an alternative model for the mode of action and toxicity studies of many compounds, most notably antiparasites [@Holden-Dye2014] such as levamisole, as well as an insect repelent N,N-diethyl-meta-toluamide (DEET). *C. elegans* is an attractive platform for the toxicity and the mode of action studies but it may be also useful in drug development screens. Several studies showed that the lethality rank order of hundreds of comounds tested on *C. elegans* correlated well with the lethality rank order in other species [reviewe in @hunt2017]. -->
<!-- One of the limitations of *C. elegans* is their cuticle (Section @\ref(anatomy)). The cuticle is a robost structure, composed primarely from cross-links of collagen. It can limit entry of drugs present in the extenral environment, hindering their bioavailability. To this end, several strains have been identified as "leaky". These strains have mutated bus (Bacterially UnSwollen) genes. To date six such genes have been cloned: bus-2, bus-4, bus-8, bus-12, bus-17 and srf-3. Bus-2, 4 and 17 encode for glycosyltranferases [@gravato-nobre2011]. Bus-8 mannosyltransferase [@partridge2008], whereas bus-8 [@gravato-nobre2011] and srf-3 [@hoflich2004] nucleotide sugar transporters. Bus mutants are characterised by altered surface protein coat, resulting in reduced immune response, cuticle integrity and strength. This in turn leads to blunted pathogen entry and evasion [@gravato-nobre2005; @cipollo2004; @hoflich2004], compromised mechanical defence [@darby2007], as well as markedly increased drug-sensitivity [@partridge2008], abnormal locomotion (skiddy phenotype with low traction [@darby2007] and delayed development [@gravato-nobre2005]. Due to the increased cuticular permeability, **bus** mutants have been suggested an alternative and approprite platform for toxicity studies of pharmaceuticals [@xiong2017]. -->
## Cholinergic regulation of worm behaviour ###{#cholinericwormbeh}
The cholinergic system is the primary target of neonicotinoids in insects (Section \@ref(neonicstarget)). Acetylcholine is pivotal in regulation of worm behaviour (Section \@ref(cholinergicneurotransmissioninworms)). Most of the current knowledge is derived from work on the soil nematode and model organism *C.elegans*.
#### Locomotion ####{#locomotion}
*C. elegans* exhibits distinct locomotory behaviours in liquid and on solid medium (Section \@ref(locomotionbehaviour)). In the liquid medium, it flexes back and forth, whereas on solid medium it crawls is a sinusoidal fashion. These behaviours are mediated by the body musculature composed of 95 muscle cells. The muscle cells are arranged into 4 muscle rows: a pair of longitudinal ventral rows and a pair of dorsal rows. Their function is under the control of the nervous system (Figure \@ref(fig:motility-intro-label)).
There are 4 motor neuron classes synapsing onto the dorsal muscle (AS, DA, DB, and DD) and 4 innervating the ventral muscle (VA, VB, VC, and VD). Motor neurons belonging to class A, B and AS release ACh and are excitatory, whereas motor neurons of class D are inhibitory and release GABA [@mcintire1993]. Bending of the dorsal side is associated with excitation and contraction of the dorsal side and simultaneous inhibition and relaxation of the ventral side, whereas the reverse is true when the ventral side bends. A and B neurons not only innervate muscle, but also send out processes to the collateral side, and synapse onto D, inhibitory neurons [@white1986]. By doing so, acetylcholine acts directly on the muscle to elicit contraction and indirectly to relax the opposite side. Taken together, this allows the bending of a particular portion of one and the relaxation of the opposing side of the body to enable the worm’s locomotory activities. Whereas the propagation of the electrical signal down the axis of the muscle whilst on solid medium, results in forward movement.
<!-- ##### Regulation of locomotory behaviour -->
<!-- The rhythmical pattern of muscular contraction and relaxation of the body wall muscle (BWM) is not regulated by the nervous system. Worms lacking functional D neurons are still capable of classical movement behavior [@riddle1997b]. However, body stretch associated with movement is detected. This results in electrical signal propagation to further segments of the BWM and coordinated movement [@tavernarakis1997]. According to this model, the bend of one segment of the musculature is detected by the proprioceptive ion channels on the adjecent motor neuron. The activation of this leads to a strong contraction of the next muscle in the series reflected in a body bend. This pattern is repeated which leads to a propagation of the signal down the body length. -->
##### Regulation of the direction of movement
The direction of worm’s movement is controlled by so called command interneurons [@chalfie1985; @white1986]. There are 5 command interneurons, namely PVC, AVB, AVA, AVD and AVE. These make synaptic connections with appropriate motor neurons of the BWM. PVC and AVB innervate VB and DB neurons which regulate forward movement. AVA, AVD and AVE innervate VA and VB which regulate backward movement [@chalfie1985; @white1986].
#### Sensory regulation of the locomotion ####{#sensoryregulation}
Locomotion can be regulated by the environmental cues detected by the sensory neurons which relay information into the locomotory circuitry. Locomotion on solid medium is greatly influenced by the present of food [@dalliere2017]. Whilst on food, *C. elegans* exhibits two types of locomotory behaviour: dwelling and roaming. Dwelling is characterised by enhanced turning frequency but low movement speed rate, whereas roaming is associated with decreased turning frequency but higher movement speed. Upon transfer to the area with no food source, worms search for food evidented by enhanced movement speed. *C. elegans* locomotion is also influenced by noxious stimuli and olfactory cues. For example, in response to a range of nociceptive stimuli ASH head neurons are activated [@hilliard2005]. This leads to rapid and transient backward movement, followed by a change of direction in the forward movement (reviewed in @bono2005).
(ref:motility-circuit) **Locomotory circuit in *C. elegans*.** Release of acetylcholine onto dorsal muscles (+) leads to their excitation and contraction. At the same time, acetylcholine activates GABAergic neurons contralaterally. Release of GABA leads to inhibition of ventral muscles. The signal propagates down the axis and leads to coordinated sinusoidal movement. Figure taken from www.wormatlas.org.
```{r motility-intro-label, fig.cap= "(ref:motility-circuit)", fig.scap= "Locomotory circuit in \\textit{C. elegans}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/intro_2/motility.jpg")
```
\newpage
#### Egg laying
Egg-laying is controlled by the contraction of vulvar muscles under the influence of the nervous system (Figure \@ref(fig:egg-laying-label)). The main excitatory neurotransmitter is serotonin [@waggoner1998] released from the Hermaphrodite Specific Neurons (HSNs). There are other neurotransmitters involved, such as excitatory acetylcholine [@trent1983] released from the Ventral C neurons (VCs). In addition, there are four uv1 neuroendicrine cells linking uterus and vulva which release tyramine to inhibit egg laying [@alkema2005].
(ref:Egg-laying-fig) **Neuronal circuitry of *C. elegans* vulva.** Lateral image of the *C. elegans* hermaphrodite (top) and positioning of the vulva (bottom). 16 vulval muscles, out of which vm1 and vm2 are the most important, contract to expel eggs out. HNS and VC neurons synapse onto vm2 muscle. Uv1 neuroendocrine cells link the uterus and vulva and inhibit egg-laying. Image taken from [@collins2016].
```{r egg-laying-label, fig.cap="(ref:Egg-laying-fig)", fig.scap= "Neuronal circuitry of \\textit{C. elegans} vulva.", echo=FALSE, out.width='100%', fig.align='center',}
knitr::include_graphics("fig/intro_2/vulva.png")
```
### Pharmacological evidence for the role of nAChRs in the regulation of *C. elegans* behaviour ###{#pharmacelegans}
Pharmacological experiments in which nAChR agonists, namely levamisole and nicotine, were tested against *C. elegans* behaviours provide evidence for the important role of these receptors in the regulation of locomotion and egg laying.
#### Levamisole
Levamisole is a synthetic compound used in treatment of parasitic worm infestation in both humans and animals [@miller1980]. It is an agonist of a subset of receptors present at a body wall muscle [@richmond1999]. Levamisole causes spastic paralysis of worms [@lewis1980b] and stimulates egg-laying [@trent1983].
#### Nicotine
Nicotine is an alkaloid naturally occuring in the Tobacco plant [@steppuhn2004]. It is an agonist of the second type receptor at a body wall muscle, namely the N-type [@ballivet1996], but based on the nicotine-intoxication worm phenotype, it is likely to target receptors regulating pharyngeal pumping and vulva muscle. Nicotine inhibits locomotion [@kudelska2017] pharyngeal pumping [@kudelska2018], and egg-laying.
#### Neonicotinoids ####{#chapter3effectsofneonics}
<!-- There is a limited literature regarding the effects of neonicotinoids on nematodes. Studies by [@dong2014; @dong2017] revealed antiparasytic potential of neonicotinoids. Thiacloprid kills plant parasite *Meloidogyne incognita* with the LC50 of 24 $\mu$M [@dong2014] -->
<!-- Thiaclopand inhibits its egg hatching with the EC~50~ of 300 $\mu$M [@dong2014; @dong2017]. -->
Neonicotinoids have variable effects on *C. elegans*. @mugova2018 reports an inhibitory effect on motility of imidacloprid at concentration ranging from 120 $\mu$M to 2 mM. Thiacloprid seems to have an opposite effect. At concentrations ranging from 2 to 40 $\mu$M it elevates locomotion in liquid of mixed developmental stage population of *C. elegans* [@hopewell2017].
Variable effects of neonicotinoids on egg-laying are also reported. Low mM concentrations of clothianidin and thiacloprid inhibit egg-laying [@gomez-amaro2015]. In contrast, imidacloprid at a single concentration of 20 nM, elevates the number of egg-laid, but has no effect at 120 $\mu$M - 2 mM, suggesting this effect is not dose-dependent [@ruan2009].
### Two nAChR types are expressed at the body wall muscle of *C. elegans* nAChRs ####{#muscletypenachr}
Acetylcoline exerts its effects by acting on nAChRs. *C. elegans* expresses at least 29 nAChR subunits (Section \@ref(celegansnacheintro)). To date, four receptor assemblies have been identified [@richmond1999; @treinin1998; @touroutine2005]. Two of the *C. elegans* nAChRs are expressed at the post-synaptic membrane of the neuromuscular junction of the body wall muscle [@richmond1999], where they are involved in the regulation of locomotion. The identity and function of these proteins has been studies using a combination of behavioural, pharmacological and electrophysiological approaches.
##### L-type receptors
Behavioural analysis of *C. elegans* mutants identified several strains in which locomotion was disrupted, including unc-29, unc-38 and unc-63 [@lewis1980b]. unc-29, unc-38 and unc-63, as well as lev-1 and lev-8 were also resistant to levamisole [@lewis1980b]. Expression of lev-1, unc-29 and unc-38 in *Xenopus oocytes* generated a protein with nAChR-like properties: in response to acetylcholine and levamisole, depolarising current was elicited [@fleming1997]. @richmond1999 provided evidence that these receptors are expressed at the NMJ of the body wall muscle. Intracellular recordings from the post-synaptic membrane at the NMJ of the body wall muscle showed that in response to acetylcholine and levamisole inward current is elicited. That current was abolished in unc-29 and unc-38 mutants [@richmond1999]. The identity of the levamisole sensitive nAChRs was revealed by @boulin2008, who showed that eight genes are required for the generation of fully functional receptor in *Xenopus oocytes*. Five genes encode for nAChR subunits UNC-29, UNC-38, UNC-63, LEV-1 and LEV-8, two of which, viz. UNC-29 and LEV-1 are non-$\alpha$. In the absence of any one of the 5 subunits, agonist-evoked currents were abolished, suggesting all subunits are essential for the receptor function. The remaining 3 genes encode for the auxiliary subunits RIC-3, UNC-50, AND UNC-74. Their role is described in Section \@ref(cematnachr).
##### N-type receptors
Work of @richmond1999 identified second type of nAChR at the muscular junction of the body wall muscle. This receptor showed high sensitivity to nicotine, thus was named N-type nAChR. N-type receptor is composed of ACR-16 subunits, which form homomeric receptors in Xenopus oocytes [@ballivet1996].
<!-- ### Effects of neonicotinoids on earthworms -->
<!-- Most ecotoxicological studies focused on the effects of neonicotinoids on behaviours governed by the cholinergic neurotransmission and worms mortility. These were conducted on earthworms, Lumbricus terrestris and Eisenia fetida, which reflects the pivotoal ecological role of these “undrgrdound dwellers”. @basley2017 showed that field realistic concentrations of clothianidin have no effects on Lumbricus terrestris mortality, feeding and worm population [@basley2017], but it is toxic to Eisenia fetida with LC50 value of ~1 mM [@wang2012]. -->
<!-- DEET was discovered in 1944 and was originally intendeed for use in agriculture. It is currently used as an insect repellent effective agains flies, mosquitos, ticks and fleas. -->
<!-- Levamisole, discovered in 1960s, has a potent antihelmintic action [@pinnock1988]. It causes contraction of the body wall muscle of the parasitic worm **A.suum** [@martin1991] and nematode **C. elegans** [@lewis1980b], which leads to their paralysis. Body wall muscle of both **A.suum** and **C. elegans** express N- and L-type nAChR types [@qian2006; @richmond1999]. Genetic studies shed light on the receptor type targeted by levamisole. *C. elegans* mutants deficient in several constituents of L-type, and not N-type nAChR, exihibited markedly reduced levamisole-sensitivity [@lewis1987; @lewis1980], suggesting L-type receptor is the principal site of action of this compound. -->
<!-- Several reports of of insect strains resistant to DEET have been identified [@reeder2001; @klun2004]. Understanding the mode of action and identification of the molecular target would open the door of opportunities for the development of novel repellents. DEET has a common mode of action, whereby it impairs the olfactory responses to common olfactory attractants and/or repellents in both *C. elegans* [@dennis2018] and Drosophila [@pellegrino2011], albeit by targeting different proteins. In *C. elegans*, sensitivity to DEET is driven by the **str-217** gene encoding for a predicted G protein-coupled receptor, which is not present in insects [@dennis2018]. -->
<!-- Strains useful - When challenged with M. nematophilum, wild-type worm develops characteristic swelling in the tail region. This phenotype is absent in worms with mutated bus (Bacterially UnSwollen) genes. -->
### Chapter aims
The aim of this chapter is to better understand the effects of neonicotinoids on Nematoda representative *C. elegans*. Their impact on defined and well understood behaviors governed by the cholinergic transmission are tested and compared to the effects elicited by a classical nAChR agonist nicotine. This will be used to inform the potential risk of these environmental neurotoxins against Nematoda and on their mode of action.
\newpage
## Results
### Effects of nicotine on thrashing
Upon immersion of *C. elegans* in liquid, it exhibits rhythmic swimming-like locomotory behaviour driven by the body wall musculature and inputs from the central nervous system (Section \@ref(locomotion)). This locomotory behavior is known as thrashing. It can be easily scored and used as an assessment for the effects of acute exposure to nicotine and neonicotinoid on motility of *C. elegans*. Worms placed in untreated liquid medium retain a constant thrashing rate of ~40-45 repeats per 30s throughout the duration of the experiment (2 hours) (Figure \@ref(fig:thrashing-nicotine)). Addition of nicotine at concentrations ranging from 1 to 100 mM leads to dose-dependent inhibition of motility (Figure \@ref(fig:thrashing-nicotine)). The time course for the effects of nicotine varied dependent on the concentration. At doses eliciting partial paralysis (i.e. 10 and 25 mM) 2 “phases” of inhibition can be seen. The immediate one seen after 10 minutes which recovers slightly, and the second which reaches a steady state inhibition after 60 minutes. Nicotine at 100 mM led to a complete inhibition of thrashing. This effect was visible 10-minutes post exposure and sustained for 2 hours.
The EC~50~ of nicotine on thrashing was 26.2 (95% CI= 17.4 to 38.8) mM, respectively) (Figure \@ref(fig:thrashing-nicotine)b). This low efficacy may be due to reduced bioavailability of nicotine in the worm.
(ref:thrashing-data) **Concentration and time dependence of the effects of nicotine on thrashing of *C. elegans*.** a) Wild type N2 worms were exposed to varying concentrations of nicotine. The number of thrashes were recorded for 30 seconds at the indicated time points. b) Concentration dependence of nicotine inhibition of thrashing on wild-type N2 worms. Dose-response curve were generated by taking the 60 minute time- points; that is when the steady-state inhibition of thrashing was reached, and expressed as % of control thrashing. EC~50~ values (dose at which thrashing was reduced by half) is shown. Data are mean $\pm$ SEM of $\ge$ 14 individual worms collected from experiments done on 3 days.
```{r thrashing-nicotine, fig.cap= "(ref:thrashing-data)", fig.scap = "Concentration and time dependence of the effects of nicotine on thrashing of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/final/pngpdf/thrashing_nic_1.png")
```
\newpage
#### Effects of pH on nicotine induced inhibition of thrashing
Bioavailability of compounds might be impaired by the physicochemical properties of drugs, such as charge. Nicotine is a diprotic base, with pKa of pyridine ring of 3.12 and pKa of pyrrolidine ring of 8.02 [@ciolino1999]. By altering the pH of liquid medium from 7 to 6 and 9, the equilibrium between charged and uncharged nicotine species shifts. One might predict this has an effect on the efficacy of nicotine. Indeed, The EC~50~ of nicotine at pH= 6 and 9 is slightly, but not significantly decreased in comparison to pH=7 (16.7 (95% CI= 11.6 to 23.6), 15.2 (95% CI= 11.0 to 20.5) and 26.2 (95% CI= 17.4 to 38.8) mM, respectively). Since pH of the external buffer does not have a marked effect on efficacy, all following experiments were performed at neutral pH.
(ref:nicotine-ph) **Effects of pH on the concentration dependence for the effects of nicotine on *C. elegans* thrashing.** Dose-response curves for the effects of pH on efficacy of nicotine on thrashing. Wild-type worms ere exposed to varying concentrations of nicotine suspended in a buffer at pH = 7, 6 and 9. The number of thrashes were scored for 30 seconds at 60 minute time-point. Data is expressed as % of control thrashing. EC~50~ values are shown in black for N2 pH=7, red for N2 pH=6 and purple for N2 pH=9. Data are mean $\pm$ SEM of $\ge$ 11 individual worms collected from paired experiments done on 3 separate days.
(ref:mpg-plot) Car engine size versus fuel efficiency. The mpg data contains observations collected by the US Environmental Protection Agency on 38 models of car. ```{r thraahing-ph-label, fig.cap="(ref:nicotine-ph)", fig.scap= "Effects of pH on the concentration dependence for the effects of nicotine on \\textit{C. elegans} thrashing.", fig.align='center', out.width='70%', echo=FALSE}
knitr::include_graphics("fig/results2/final/pngpdf/Nic-DR-thrashing-all-n2.png")
```
\newpage
### Effects of the cuticle on nicotine induced inhibition of thrashing
The second factor limiting drugs’ bioavailability is worm’s cuticle. This idea is supported by the observation that the application of 0.1mM of nicotine on intact worm has no effects on thrashing (Figure \@ref(fig:thrashing-nicotine)), but when applied on the isolated body wall muscle or dissected worm, it induced large inward current and paralysis, respectively [@richmond1999; @matta2007]. This suggests that the cuticle is a major physical barrier for drug entry. To provide a platform for investigation of the importance of the cuticle in drug permeability, *C. elegans* *bus-17* mutant strain was used. *Bus-17* is a GT13 glycosyltransferase mutant [@yook2007] exhibiting defective glycoprotein production resulting in abnormal surface coat and altered cuticular integrity.
Mutation of *bus-17* genes have no significant effect on the thrashing behavior of *C. elegans* frequency. Worms retained a constant thrashing rate of 40-45 thrashes per 30s over the duration of the experiment (Figure \@ref(fig:thrashing-cuticle-label)). Immersion in nicotine led to concentration dependent paralysis, but the potency of nicotine on the mutant vs the wild-type strain is almost 10-fold greater (Figure \@ref(fig:thrashing-cuticle-label)). Moreover, the inhibitory effects of nicotine at 10 and 25 mM on *bus-17* worms lacks 2 phases of inhibition seen previously. This might suggest that nicotine reaches the internal molecular targets more quickly.
(ref:thrashing-cuticle) **The effects of the cuticle on the concentration and time dependence of nicotine inhibition of *C. elegans* thrashing.** N2 wild type (a) and *bus-17* mutant (b) worms were exposed to varying concentrations of nicotine. The number of thrashes were recorded for 30 seconds at the indicated time points. b) Concentration dependence of nicotine dependent inhibition of thrashing on N2 (black) and *bus-17* worms (grey). Dose-response curve were generated by taking the 120-minute time- points; that is when the steady-state of thrashing inhibition was reached, and expressed as % of control thrashing. EC~50~ values are shown on graphs. Data are mean $\pm$ SEM of $\ge$ 15 individual worms collected from paired experiments done on 3 days.
```{r thrashing-cuticle-label, fig.cap= "(ref:thrashing-cuticle)", fig.scap = "The effects of the cuticle on the concentration and time dependence of nicotine inhibition of \\textit{C. elegans} thrashing.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/final/pngpdf/fig2.png")
```
\newpage
### Effects of neonicotinoids on thrashing ###{#effectsofneonicsonthrashing}
To assess the effects of neonicotinoids on motility of worms in liquid, the thrashing experiment was repeated with nitenpyram, thiacloprid and clothianidin. Out of the three compounds tested, only nitenpyram at concentrations ranging from 1 to 100 mM induced concentration-dependent paralysis of N2 wild-type worms. Low water solubility of thiacloprid and clothianidin limited the maximum testable doses to 1.5 and 2.5 mM, respectively. Results in (Figure \@ref(fig:thrashing-tc-comp-label), left panel), show that at these doses neither of the two have an effect on thrashing of wild-type worm.
To determine whether a cuticle also limits the bioavailability of neonicotinoids, experiments were repeated on *bus-17* mutant. Shift in potency of all compounds was noted (Figure \@ref(fig:thrashing-tc-comp-label) and \@ref(fig:DR-neonics-label)). The EC~50~ of nitenpyram on wild-type increased by almost 12-fold on mutant worm (195.8 (95% CI= 133.9 to 313.9) and 16.6 (95% CI= 12.0 to 22.6) mM). Thiacloprid and clothianidin were with no effects on wild-type worms, but induced paralysis of the *bus-17* mutant with the EC~50~ of 377.6 $\mu$M (95% CI= 311.8 to 454.0 $\mu$M) and 3.5 mM (95% CI= 24.1 to 53.5mM), respectively. The time course for both clothianidin and thiacloprid have similar features: gradual increase in inhibition of thrashing with the maximal effect achieved after 1 hour followed by a slow retrieval. The gradual recovery might represent adaptation of the neuronal circuit for locomotion, desensitization of receptors mediating the response or precipitation of a drug (although no visual sigh of this were observed with exception of 1.5 mM thiacloprid after 45 minutes). The breakdown in liquid is unlikely, as both compounds have long half-live in water (Table \@ref(tab:properties)) [@gilbert2010].
(ref:thrashing-tc-comp-capt) **The concentration and time dependence of neonicotinoids inhibition of *C. elegans* thrashing.** Wild type (left panel) and *bus-17* (right panel) worms were acutely exposed to varying concentrations of nitenpyram, thiacloprid, clothianidin or drug vehicle (0, Ctr). The number of thrashed over 30 seconds at indicated time points was scored. Data are mean $\pm$ SEM of $\ge$ 6 individual worms collected from paired experiments done on $\ge$ 2 days.
```{r thrashing-tc-comp-label, fig.cap= "(ref:thrashing-tc-comp-capt)", fig.scap= "The concentration and time dependence of neonicotinoids inhibition of \\textit{C. elegans} thrashing.", fig.width=10, fig.asp=1.1, fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/final/pngpdf/Fig3.png")
```
(ref:DR-neonics) **Dose-response curves for the effects of neonicotinoids on *C. elegans* thrashing.** Concentration-response curves for the effects of nitenpyram (a), thiacloprid (b) and clothianidin (c) on thrashing of wild-type (black) and *bus-17* (grey) *C. elegans*. Dose-response curves were generated by taking 120-minute time-point for nitenpyram and 120-minute time points for thiacloprid and clothianidin; that is when the steady-state inhibition of thrashing was reached, and expressed as % control thrashing. Data and mean $\pm$ SEM. The EC~50~ for clothianidin are approximations, because the highest concentration tested (2.5 mM) inhibited thrashing by 55 % in *bus-17*.
```{r mpg,echo=FALSE,fig.cap ='(ref:mpg-plot)', fig.scap='Car engine size versus fuel efficiency',out.extra='',fig.align='center',cache=TRUE,warning=FALSE,fig.pos="H"} ```{r DR-neonics-label, fig.cap="(ref:DR-neonics)", fig.scap = "Dose-response curves for the effects of neonicotinoids on \\textit{C. elegans} thrashing.", fig.width=10, fig.asp=1.1, fig.align='center', echo=FALSE}
ggplot(data = mpg) + knitr::include_graphics("fig/results2/final/pngpdf/Fig4.png")
geom_point(mapping = aes(x = displ, y = hwy, color = class))
``` ```
\newpage
### Kinetic properties of nicotine- and neonicotinoid- induced inhibition of thrashing
To observe penetration properties of compounds, the thrashing experiment was repeated in the presence of drug doses inducing inhibition of thrashing. The observations at early time points were made to determine how quickly a maximum effect can be observed (Figure \@ref(fig:onset-plot-label)). High doses of nicotine paralysed all N2 wild-type and *bus-17* mutant worms within 6 minutes and time taken to paralyse 50 % of worms (t~1/2~) of less than a minute. Since neonicotinoids did not induce full paralysis of wild-type worms, only the effects of thiacloprid and nitenpyram on *bus-17* mutant were investigated. The action of neonicotinoids was much slower when compared to nicotine. Worms became immobile after 1 hour of incubation, and the t~1/2~ for both compounds was extended to 5 minutes.
(ref:onset-plot-capt) **The onset kinetics of nicotine and neonicotinoid induced inhibition of *C. elegans* thrashing.** Worms were submerged in drug concentrations at which complete paralysis was achieved; that is: a) N2 wild-type in 100mM nicotine, b) *bus-17* mutant in 25mM nicotine, c) *bus-17* mutant in 50 mM nitenpyram and d) *bus-17* mutant in 1mM thiacloprid. The number of thrashes over 30 seconds at the indicated time points were counted. Data are mean $\pm$ SEM of $\ge$ 4 individual worms collected from pared experiments done on 2 days. Note a different time scale in a, b compared to c and d.
```{r onset-plot-label, fig.cap= "(ref:onset-plot-capt)", fig.scap = "The onset kinetics of nicotine and neonicotinoid induced inhibition of \\textit{C. elegans} thrashing.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/final/pngpdf/onset.png")
```
\newpage
Recovery assay gives an indication of how quickly the effects of compounds reverse. This reversal when drug inhibited worms are moved into a larger volume of drug free are thought to be due to a diffusion out of the worm or/and drug metabolism via various detoxifying systems [@lindblom2006]. In this experiment, worms were placed in drug concentration that induced full paralysis for 20 minutes in the case of nicotine and 60 minutes in case of nitenpyram and thiacloprid. Once paralysis was achieved, worms were transferred to drug-free medium and the thrashing rates were monitored over time (Figure \@ref(fig:merged-recovery-title)). Following, the exposure to high concentration of nicotine and 2.5 hours of washing, a proportion of worms remained paralysed: 50% of wild-type and 25% of *bus-17* (data not shown). The remaining wild-type and *bus-17* worms recovered with t~1/2~ of 1.5 hours and 50 minutes respectively.
In contrast, all worms paralysed by nitenpyram or thiacloprid returned to normal basal thrashing within 2 hours of washing. The time taken for half recovery for both compounds was 1 hour.
(ref:recovery-thrashing) **Recovery kinetics of nicotine and neonicotinoid-paralysed *C. elegans*.** N2 wild-type and *bus-17* mutant worms were exposed to indicated concentrations of nicotine (a and b), nitenpyram (c) and thiacloprid (d). Paralysed worms were transformed to drug-free dish and recovery was scored by noting a number of thrashes / 30s. Only worms recovered are included in this analysis. Alongside these, worms were transferred from drug-containing to drug containing dish (+ve ctr ) and from drug-free to drug-free dish (-ve ctr). Data are mean $\pm$ SEM of 8 individual worms collected from experiments done $\ge$ 2 days.
```{r merged-recovery-title, fig.cap= "(ref:recovery-thrashing)", fig.scap= "Recovery kinetics of nicotine and nonicotinoid-induced-paralysed \\textit{C. elegans}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/final/pngpdf/recovery.png")
```
\newpage
#### Effects of nicotine and neonicotinoids on *C. elegans* lenght
During acute and chronic exposure experiments, it was noted that a 4 hour incubation of worms with high nicotine concentrations had marked effect on morphology. Specifically, nicotine at concentrations inducing paralysis led to shrinking of the worm. To investigate this further and determine if neonicotinoids have the same effect, worms were exposed to either drug concentration inducing paralysis, or the highest possible testable concentrations. To maximise the concentration of drugs inside the worm, *bus-17* mutant was used in this experiment. The images of L4 + 1 incubated with nicotine or neonicotinoids for 4 hours were taken and the measurements of the length of the body were made. Exposure to 25 mM nicotine led to reduction in the body lenght. In contrast, neonicotinoids had no effect (Figure \@ref(fig:shrinking-title1)).
<!-- (ref:shrinking-image) **Effects of nicotine on *C. elegans* morphology.** Images of *bus-17* mutant worms exposed for 4 hours to 25 mM nicotine nicotine, or vehicle. -->
<!-- ```{r shrinking-title2, fig.cap="(ref:shrinking-image)", fig.scap = "Effects of nicotine on \\textit{C. elegans} morphology.", fig.align='center',include=TRUE, results="hide", echo=FALSE} -->
<!-- knitr::include_graphics("fig/results2/Shrinking_nicotine_bus17-2.png") -->
<!-- ``` -->
\newpage
(ref:shrinking) **Effects of nicotinic compounds on *C. elegans* body length.** *Bus-17* mutant was submerged for 4 hours in solution containing 25 mM nicotine, 50 mM nitenpyram, 1.5 mM thiacloprid or 2.5 mM clothianidin or vehicle control (Ctr). 4 hours later, the images of worms were taken and the body length measured. Data are mean $\pm$ SEM. Number of determinations $\ge$ 12 collected over 3 observations. One way ANOVA with Bonferonni corrections, $**$ P $\le$ 0.01.
```{r shrinking-title1, fig.cap="(ref:shrinking)", fig.scap = "Effects of nicotinic compounds on \\textit{C. elegans} body lenght.", fig.align='center', echo=FALSE,}
# cbp1 <- c("#999999", "#E69F00", "#56B4E9", "#009E73",
# "#F0E442", "#0072B2", "#D55E00", "#CC79A7")
#
# data19 <- read_csv("Analysis/Data/Transformed/Shrinking.csv")
# shrinking_tidy <- data19 %>%
# drop_na() %>%
# mutate (Conc = factor(Concentration,
# levels = c("Ctr", "Nitcotine_25mM", "Nitenpyram_50mM", "Thiacloprid_1.5mM", "Clothianidin_2.5mM"),
# labels = c("Ctr", "Nicotine 25 mM", "Nitenpyram 50 mM", "Thiacloprid 1.5 mM", "Clothianidin 2.5 mM")))
#
# shrinking_stats <- shrinking_tidy %>%
# group_by(Conc) %>%
# summarise(mean_length=mean(length),
# sd=sd(length),
# se=sd/sqrt(length(length)))
#
# shrinking_plot <- shrinking_stats %>%
# ggplot(aes(x = Conc,
# y = mean_length, fill=Conc)) +
# scale_fill_manual(values = cbp1) +
# geom_bar(stat = "identity", colour="black") +
# geom_errorbar(aes(ymin = mean_length-se, ymax = mean_length+se), width=0.4) +
# ylab("Body length (mm)") +
# labs(fill = "") +
# ylim(0, 1.5) +
# annotate("text", x=2, y=1.5, label= "**") +
# theme(axis.text.x = element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.ticks.x = element_blank(),
# axis.title.x = element_blank()) +
# ggsave("fig/results2/bodylengthploy.pdf")
knitr::include_graphics("fig/results2/final/pngpdf/bodylengthploy.png")
```
\newpage
### Effects of chronic exposure of *C. elegans* to nicotine and neonicotinoids on behaviour
Liquid assays allow for relatively short-term exposure. To test whether protracted exposure of worms provides a better paradigm for sensitivity on-plate assay was employed (Section \@ref(onplateassay)). The concentrations used were ranged 0.5 to 25 mM nicotine, 1 mM nitenpyram, 1 $\mu$M to 1.5 mM thiacloprid and 0.5 to 3.75 mM clothianidin. Worms were exposed to treatment for a period of 24-hours and their effects on locomotion and fertility were measured. This allows for prolonged drug exposure which may lead to accumulation of the drug inside the worm and increased efficacy of compounds on worm behavior.
#### Effects of nicotine on avoidance
During the experimentation, an observation that the proportion of worms disappeared from nicotine containing plates was made. After 24 hour incubation with nicotine at concentrations $\ge$ 25 mM, the number of worms remaining on the plate was significantly reduced in comparison to the control (Figure \@ref(fig:avoid-label). Closer observation revealed that in the presence of nicotine, worms escaped the experimental arena by crawling to the side of the plate. Neither of the three neonicotinoids had such effect (data not shown).
<!-- # ```{r echo=FALSE, include=FALSE, message=FALSE, include=TRUE, results="hide"} -->
<!-- # on_plate_dat_1 <-readRDS("Analysis/Data/Transformed/combined.RSD") -->
<!-- # on_plate_dat_trans_1 <- on_plate_dat_1 %>% -->
<!-- # drop_na() %>% -->
<!-- # mutate(Dose = factor(Conc, -->
<!-- # levels= c(0, 0.001, 0.01, 0.1, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3.75, 5, 10, 25, 50, 100), -->
<!-- # labels = c("0", "0.001", "0.01", "0.1", "0.25", "0.5", "0.75", "1", "1.5", "2", "2.5", "3.75", "5", "10", "25", "50", "100")), -->
<!-- # Exp = factor(Experiment, -->
<!-- # levels= Experiment, -->
<!-- # labels = Experiment)) -->
<!-- # ``` -->
\newpage
(ref:avoid) **The concentration dependence of the effects of nicotine on *C. elegans* avoidance.** 4-10 wild-type worms were placed on agar plate containing indicated nicotine concentrations or drug vehicle (0). 24 hours later, the % of worms remaining on the plate was scored. Data are mean $\pm$ SEM, collected from 2 - 4 individual experiments. One way ANOVA (Kruskal-Wallis test) with Sidak Corrections, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r avoid-label, fig.cap="(ref:avoid)", fig.scap= "The concentration dependence of the effects of nicotine on \\textit{C. elegans} avoidance.", fig.align='center', echo=FALSE}
# ann_text_avoid_1 <- data.frame(Dose = factor(c(25, 50, 100), levels = c(25, 50, 100)),
# mean_readout=100,
# lab_avoid_1 = c("****", "***", "****"),
# Exp = as.factor(42))
#
#
# avoid <- on_plate_dat_trans_1 %>%
# filter(Experiment == 41) %>%
# group_by(Dose) %>%
# summarise(mean_readout= mean(readout),
# n = n(),
# sd=sd(readout),
# se=sd/sqrt(length(readout))) %>%
# ggplot (aes(x = Dose, y = mean_readout, fill = Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# scale_fill_manual(values=c('#000000','#333333', '#666666','#999999', '#CCCCCC', '#D3D3D3', '#DCDCDC')) +
# ylim(0, 100) +
# geom_text(data = ann_text_avoid_1, aes(label = lab_avoid_1)) +
# ylab("% worms on plate") +
# xlab("Nicotine, [mM]") +
# theme(axis.text = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans")) +
# ggsave("fig/results2/final/pngpdf/avoidancegraph.pdf")
knitr::include_graphics("fig/results2/final/pngpdf/avoidancegraph.png")
```
\newpage
#### Effects on body bends ####{#bodybendsneonics}
Whilst on solid medium, *C. elegans* exhibits sinusoidal movement (Section \@ref(locomotionbehaviour)). This can be quantified by counting a number of forward body bends per unit of time and is a measure of the motor function. The presence of food modifies this behavior (Section \@ref(sensoryregulation)), therefore the measurements were made on treatment - soaked solid medium containing no OP50 food patch (Section \@ref(onplateassay)).
Untreated wild-type worms move at a rate of 39 body bends per minute (Figure \@ref(fig:BB-plot-label), left panel). This is reduced to 33 bends per minute in *bus-17* mutant (Figure \@ref(fig:BB-plot-label) right panel), due to a reduced traction of the body on agar medium [@yook2007]. The body bends of wild-type *C. elegans* was altered by nicotine with with the EC~50~ of 3.6 mM (95 % CI= 2.6 to 4.4 mM), whereas nitenpyram, thiacloprid and clothianidin had no effect (Figure \@ref(fig:BB-plot-label) and \@ref(fig:DR-body-bends-label)). In contrast, the body bends rate of *bus-17* mutant was reduced by all compounds, except for up to the 1 mM nitenpyram. The EC~50~ for the effects of nicotine and clothianidin was 1.6 (CI= ) and 3.3 (CI = ) mM, respectively. Thiacloprid was the most potent with the EC~50~ of 721.2 $\mu$M (95 % CL= 502.4 μM to 1.0 mM) (Figure \@ref(fig:DR-body-bends-label)).
<!-- # ```{r load-stats-on-plate-assay-label, include=TRUE, results="hide", echo=FALSE} -->
<!-- # select bb data -->
<!-- # on_plate_dat <- readRDS("Analysis/Data/Transformed/24_hrs_combined.RDS") -->
<!-- # on_plate_dat_trans <- on_plate_dat %>% -->
<!-- # drop_na() %>% -->
<!-- # mutate(Dose = factor(Conc, -->
<!-- # levels= c(0, 0.001, 0.01, 0.1, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3.75, 5, 10, 25, 50, 100), -->
<!-- # labels = c("0", "0.001", "0.01", "0.1", "0.25", "0.5", "0.75", "1", "1.5", "2", "2.5", "3.75", "5", "10", "25", "50", "100")), -->
<!-- # #Col = factor(Color, -->
<!-- # #levels=Color, -->
<!-- # #labels=Color), -->
<!-- # Exp = factor(Experiment, -->
<!-- # levels= Experiment, -->
<!-- # labels = Experiment)) -->
<!-- # levels(on_plate_dat_trans$Dose) -->
<!-- # on_plate_stats <- on_plate_dat_trans %>% -->
<!-- # #filter(exp_set=="on_plate_assay") %>% -->
<!-- # group_by(Assay, Exp, Strain, Comp, Dose) %>% -->
<!-- # summarise(mean_readout=mean(readout), -->
<!-- # n=n(), -->
<!-- # sd=sd(readout), -->
<!-- # se=sd/sqrt(length(readout))) -->
<!-- # ``` -->
(ref:BB-plot-capt) **The concentration-dependence for the effects of nicotine and neonicotinoid on body bends of *C. elegans*.** N2 wild-type (left panel) and *bus-17* mutant (right panel) worms were exposed for 24 hours to varying concentrations of nicotine, nitenpyram, thiacloprid, clothianidin or drug vehicle (O), incorporated into solid medium. Body bends were counted by visual observation. Data are mean $\pm$ SEM of $\ge$ 5 individual worms collected from $\ge$ 3 paired experiments. One way ANOVA (Kruskal-Wallis test) with Dunn’s Corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r BB-plot-label, fig.cap= "(ref:BB-plot-capt)", fig.scap= "The concentration-dependence for the effects of nicotine and neonicotinoid on body bends of \\textit{C. elegans}.", fig.align='center', include=TRUE, echo=FALSE}
#Plot body bends graphs
#make a data frame for facet labels
# labelsBB <- c("9" = "Nicotine N2", "10" = "Nicotine bus17", "11"= "Nitenpyram N2", "12" = "Nitenpyram bus17", "13" = "Thiacloprid N2", "14" = "Thiacloprid bus17", "15" = "Clothianidin N2", "16" = "Clothianidin bus17")
#labels for sagnificance to be ploted on a graph
# ann_text <-
# data.frame(
# Dose = factor (c(1, 10, 25), levels = c("1", "10", "25")),
# mean_readout = 40,
# lab = c("**", "****", "****"),
# Exp = as.factor(9)
# )
#
# ann_text1 <-
# data.frame(
# Dose = factor (c(0.5, 1, 10), levels = c("0.5", "1", "10")),
# mean_readout = 40,
# lab1 = c("*", "***", "****"),
# Exp = as.factor(10)
# )
#
# ann_text2 <-
# data.frame(
# Dose = factor (c(0.25, 0.5, 1, 1.5), levels = c(0.25, 0.5, 1, 1.5)),
# mean_readout = 40,
# lab2 = c("*", "****", "**", "****"),
# Exp = as.factor(14)
# )
#
# ann_text3 <-
# data.frame(
# Dose = factor(1),
# mean_readout = 40,
# lab3 = "*",
# Exp = as.factor(15)
# )
#
# ann_text4 <-
# data.frame(
# Dose = factor(c(0.5, 1, 2, 3.75), levels = c(0.5, 1, 2, 3.75)),
# mean_readout = 40,
# lab4 = c("*", "*", "****", "****"),
# Exp = as.factor(16)
# )
#
# bb_dat_plot_nic <- on_plate_stats %>%
# filter (Exp == "9" | Exp == "10") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill= Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsBB)) +
# scale_fill_manual(values=c('#000000','#333333', '#666666','#999999', '#CCCCCC')) +
# theme (strip.text.x = element_text(size=12)) +
# geom_text(data = ann_text, aes(label = lab)) +
# geom_text(data = ann_text1, aes(label = lab1)) +
# scale_y_continuous(breaks=seq(0,45,10))+
# ylab("Body bends/min") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# strip.text.x = element_text(size=12),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
#
# bb_dat_plot_nit <- on_plate_stats %>%
# filter (Exp == "11" | Exp == "12") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill= Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsBB)) +
# scale_fill_manual(values=c('#000000','#339900')) +
# theme (strip.text.x = element_text(size=12)) +
# scale_y_continuous(breaks=seq(0,45,10))+
# ylab("Body bends/min") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# bb_dat_plot_thia <- on_plate_stats %>%
# filter (Exp == "13" | Exp == "14") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill= Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsBB)) +
# scale_fill_manual(values=c('#000000','#000066', '#0000CC','#0000FF', '#0033FF', '#3366CC')) +
# theme (strip.text.x = element_text(size=12)) +
# geom_text(data = ann_text2, aes(label = lab2)) +
# scale_y_continuous(breaks=seq(0,45,10))+
# ylab("Body bends/min") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# strip.text.x = element_text(size=12),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# bb_dat_plot_clo <- on_plate_stats %>%
# filter (Exp == "15" | Exp == "16") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill= Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsBB)) +
# scale_fill_manual(values=c('#000000','#993300', '#996633','#CC9933', '#FFCC33')) +
# theme (strip.text.x = element_text(size=12)) +
# geom_text(data = ann_text3, aes(label = lab3)) +
# geom_text(data = ann_text4, aes(label = lab4)) +
# scale_y_continuous(breaks=seq(0,45,10))+
# ylab("Body bends/min") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# strip.text.x = element_text(size=12),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# bb_grid <- plot_grid(bb_dat_plot_nic, bb_dat_plot_nit, bb_dat_plot_thia, bb_dat_plot_clo, nrow=4)
# bb_grid = bb_grid + draw_label("Concentration [mM]", x = 0.4, y = 0, hjust = 0, vjust = 0) +
# ggsave("fig/results2/final/pngpdf/bodybendsplot.pdf")
# clo_grid <- plot_grid(pump_on_food_plot_nic, pump_on_food_plot_nit, pump_on_food_plot_thia, pump_on_food_plot_clo, nrow=4)
# clo_grid = clo_grid + draw_label("Concentration [mM]", x = 0.4, y = 0, hjust = 0, vjust = 0)
# clo_grid
knitr::include_graphics("fig/results2/final/pngpdf/bodybendsplot.png")
```
(ref:DR-body-bends) **Concentration-dependence curves for the effects of nicotine and neonicotinoids on *C. elegans* body bends.** Concentration-response curves for the effects of nicotine (a), nitenpyram (b), thiacloprid (c) and clothianidin (d) on body-bend rates of wild-type N2 and *bus-17* mutant *C. elegans*. Body bend rates are expressed as a % of control activity. Data are mean $\pm$ SEM. The EC~50~ of thiacloprid on N2 and clothianidin on *bus-17* is an approximation, as at highest concentrations tested (1.5 mM thiacloprid and 3.75 mM clothianidin) the maximum inhibition observed was 21 and 42 %.
```{r DR-body-bends-label, fig.cap="(ref:DR-body-bends)", fig.scap= "Concentration-dependence curves for the effects of nicotine and neonicotinoids on \\textit{C. elegans} body bends.", fig.width=10, fig.align='center', fig.asp=1.1, echo=FALSE}
knitr::include_graphics("fig/results2/DR-body-bends.png")
```
\newpage
#### Effects on egg laying
On-plate experiments allow to assay for other aspects of *C. elegans* biology such as egg-laying (Section \@ref(egglayingbehaviour)). The number of eggs laid per worm in the presence of nicotine and neonicotinoids over a period of 24 hours was counted and compared to the control (Figure \@ref(fig:EL-plot-label) and \@ref(fig:egg-laying-lbl)). Both N2 wild-type and *bus-17* mutants lay ~ 95 eggs/day/worm. No effects on wild-type worm of either compound was observed. However, egg-laying rate of *bus-17* mutant was reduced by low mM concentrations of thiacloprid and clothianidin.
(ref:EL-plot-capt) **The concentration-dependence for the effects of nicotine and neonicotinoids on egg-laying of *C. elegans*.** Wild type (left panel) and *bus-17* (right panel) worms were exposed for 24 hours to varying concentrations of nicotine, thiacloprid, clothianidin or drug vehicle (0), incorporated into solid medium. Number of eggs laid in 24 hours were counted and expressed as eggs laid per worm. Data are mean $\pm$ SEM collected from $\ge$ 8 individual on $\ge$ 2 days. One way ANOVA (Kruskal-Wallis test) with Dunnett’s Corrections, $*$ P $\le$ 0.05, $**$ P $\le$ 0.01, $***$ P $\le$ 0.001.
```{r EL-plot-label, fig.cap= "(ref:EL-plot-capt)", fig.scap = "The concentration-dependence for the effects of nicotine and neonicotinoids on egg-laying of \\textit{C. elegans}.", fig.align='center', fig.asp=1.2, include=TRUE, results="hide", echo=FALSE}
# labelsEL <- c("17" = "Nicotine N2", "18" = "Nicotine bus17", "19"= "Nitenpyram N2", "20" = "Nitenpyram bus17", "21" = "Thiacloprid N2", "22" = "Thiacloprid bus17", "23" = "Clothianidin N2", "24" = "Clothianidin bus17")
# ann_textEL <- data.frame(Dose = factor (c(0.25,0.5,1.5), levels = c("0.25", "0.5", "1.5")), mean_readout = 105,labEL = c("*","**","**"), Exp = 22)
#
# ann_textEL1 <- data.frame(Dose = factor (3.75), mean_readout = 105,labEL1 = "**", Exp = 24)
#
# el_dat_plot_nic <- on_plate_stats %>%
# filter (Exp == "17" | Exp == "18") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEL))+
# theme (strip.text.x = element_text(size=12)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# scale_y_continuous(breaks=seq(0,125,25))+
# scale_fill_manual(values = c('#000000','#333333')) +
# ylab("Eggs laid/24hrs/worm") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# strip.text.x = element_text(size=12),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
#
# el_dat_plot_nit <- on_plate_stats %>%
# filter (Exp == "19" | Exp == "20") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEL))+
# theme (strip.text.x = element_text(size=12)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# scale_y_continuous(breaks=seq(0,125,25))+
# ylab("Eggs laid/24hrs/worm") +
# scale_fill_manual(values=c('#000000','#339900')) +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
#
# el_dat_plot_thia <- on_plate_stats %>%
# filter (Exp == "21" | Exp == "22") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEL))+
# theme (strip.text.x = element_text(size=12)) +
# geom_text(data = ann_textEL, aes(label = labEL)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# scale_y_continuous(breaks=seq(0,125,25))+
# scale_fill_manual(values=c('#000000','#000066', '#0000CC','#0000FF', '#0033FF', '#3366CC', '#66CCFF')) +
# ylab("Eggs laid/24hrs/worm") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
#
# el_dat_plot_clo <- on_plate_stats %>%
# filter (Exp == "23" | Exp == "24") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEL))+
# theme (strip.text.x = element_text(size=12)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_text(data = ann_textEL1, aes(label = labEL1)) +
# scale_y_continuous(breaks=seq(0,125,25)) +
# scale_fill_manual(values=c('#000000','#993300', '#996633','#CC9933', '#FFCC33')) +
# ylab("Eggs laid/24hrs/worm") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
#
# el_grid <- plot_grid(el_dat_plot_nic, el_dat_plot_nit, el_dat_plot_thia, el_dat_plot_clo, nrow=4)
# el_grid = el_grid + draw_label("Concentration [mM]", x = 0.4, y = 0, hjust = 0, vjust = 0) +
# ggsave("fig/results2/final/pngpdf/egglayingplot.pdf")
knitr::include_graphics("fig/results2/final/pngpdf/egglayingplot.png")
```
(ref:DR-egg-laying) **Dose-response curves for the effects of nicotine and neonicotinoids on egg-laying of *C. elegans*.** Concentration-response curves for the effects of nicotine (a), nitenpyram (b), thiacloprid (c) and clothianidin (d) on egg-laying of N2 wild-type and *bus-17* mutant *C. elegans*. Egg laying is expressed as a % control activity. The EC~50~ for clothianidin is an approximation, as at the highest concentration tested (3.75 mM), the maximum response observed was 44 %. Data are mean $\pm$ SEM.
```{r, egg-laying-lbl, fig.cap="(ref:DR-egg-laying)", fig.scap = "Dose-response curves for the effects of nicotine and neonicotinoids on egg-laying of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/DR-egg-laying.png")
```
\newpage
#### Effects on egg hatching
Eggs laid on the plate hatch after 9 hours of exo-utero development (Figure \@ref(fig:life-cycle-label)). To investigate the effects of nicotine and neonicotinoids on egg-hatching L4 + 1 worms were incubated with nicotine and neonicotinoids. After 24 hours of incubation, they were removed from the experimental plate, leaving the progeny and eggs behind. After a further 24 hours, the number of unchanged eggs and larvae present were counted to derive the % hatching rate. Almost 100 % of eggs laid by N2 and *bus-17* hatched (Figure \@ref(fig:EH-plot-label)). Neither compound had an effect on hatching of N2 worms (Figure \@ref(fig:EH-plot-label), left panel). However, thiacloprid at 1.5 mM and clothianidin at 2 mM reduced the proportion of hatched eggs of *bus-17* worms by 19 and 13 %, respectively (Figure \@ref(fig:EH-plot-label), right panel).
(ref:EH-plot-capt) **The concentration-dependence for the effects of nicotine and neonicotinoids on *C. elegans* egg-hatching.** N2 wild-type (a) and *bus-17* mutant (b) worms laid eggs in the presence of varying concentrations of nicotine, thiacloprid, clothianidin or drug vehicle (0). After 24 hours adult worms were removed and the eggs left behind. Number of unhatched eggs and larvae were counted 24 hours later. Data are mean $\pm$ SEM, of $\ge$ 2 paired experiments performed on $\ge$ days. One way ANOVA (Kruskal-Wallis test) with Dunnett’s Corrections, $*$ P $\le$ 0.05, $**$ P $\le$ 0.01.
```{r EH-plot-label, fig.cap = "(ref:EH-plot-capt)", fig.align='center', fig.cap= "(ref:EH-plot-capt)", fig.scap = "The concentration-dependence for the effects of nicotine and neonicotinoids on \\textit{C. elegans} egg-hatching.", echo=FALSE}
# labelsEH <- c("25" = "Nicotine N2", "26" = "Nicotine bus17", "27"= "Nitenpyram N2", "28" = "Nitenpyram bus17", "29" = "Thiacloprid N2", "30" = "Thiacloprid bus17", "31" = "Clothianidin N2", "32" = "Clothianidin bus17")
# ann_textEH <- data.frame(Dose = factor (c(1, 1.5), levels=c("1", "1.5")), mean_readout = 105,labelEH = c("*","**"), Exp = 30)
#
# ann_textEH1 <- data.frame(Dose= factor(2), mean_readout = 105, labelEH1 = "*", Exp=32)
#
# eh_dat_plot_nic <- on_plate_stats %>%
# filter (Exp == "25" | Exp== "26") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# scale_fill_manual(values = c('#000000','#333333')) +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEH))+
# theme (strip.text.x = element_text(size=12)) +
# ylim(0, 120) +
# ylab("% eggs hatched") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# panel.grid.minor = element_blank(),
# panel.background = element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# eh_dat_plot_nit <- on_plate_stats %>%
# filter (Exp == "27" | Exp== "28") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# scale_fill_manual(values = c('#000000','#339900')) +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEH))+
# theme (strip.text.x = element_text(size=12)) +
# ylim(0, 120) +
# ylab("% eggs hatched") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# eh_dat_plot_thia <- on_plate_stats %>%
# filter (Exp == "29" | Exp== "30") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# geom_text (data = ann_textEH, aes(label = labelEH)) +
# scale_fill_manual(values=c('#000000','#000066', '#0000CC','#0000FF', '#0033FF', '#3366CC')) +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEH))+
# theme (strip.text.x = element_text(size=12)) +
# ylim(0, 120) +
# ylab("% eggs hatched") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# eh_dat_plot_clo <- on_plate_stats %>%
# filter (Exp == "31" | Exp== "32") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# geom_text (data = ann_textEH1, aes(label=labelEH1)) +
# scale_fill_manual(values=c('#000000','#993300', '#996633','#CC9933', '#FFCC33','#FFCC66')) +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labelsEH))+
# theme (strip.text.x = element_text(size=12)) +
# ylim(0, 120) +
# ylab("% eggs hatched") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# eh_grid <- plot_grid(eh_dat_plot_nic, eh_dat_plot_nit, eh_dat_plot_thia, eh_dat_plot_clo, nrow = 4)
# eh_grid = eh_grid + draw_label("Concentration [mM]", x = 0.4, y = 0, hjust = 0, vjust = 0) +
# ggsave("fig/results2/final/pngpdf/egghatchingplot.pdf")
knitr::include_graphics("fig/results2/final/pngpdf/egghatchingplot.png")
```
\newpage
To investigate whether compounds hinder the hatching of larvae, images of unhatched eggs were taken. As seen in (Figure \@ref(fig:unhatched-eggs-labels)), the eggs laid in the presence of thiacloprid and clothianidin are granular in appearance with no worm inside. This suggests thiacloprid and clothianidin interfere with the process of fertilisation or early developmental processes.
(ref:unhatched-eggs) **Effects of thiacloprid and clothianidin on *C. elegans* egg-hatching.** The appearance of unhatched eggs laid by *bus-17 C. elegans* mutant in the presence of 1.5 mM thiacloprid.
```{r unhatched-eggs-labels, fig.cap="(ref:unhatched-eggs)", fig.scap= "Effects of thiacloprid and clothianidin on \\textit{C. elegans} egg-hatching.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/unhatched-egg-2.png")
```
\newpage
#### Effects on development
Eggs that are laid on plate with a food source, hatch and develop into adults in three days. During the on-plate assay an observation was made that there were smaller worms present on the plate containing nicotine and thiacloprid (Figure \@ref(fig:dev-image)). To investigate whether this was an effect of the drugs on the timing of development, larval development of age-synchronized progeny was made.
(ref:development-images-capt) **Effects of nicotine and thiacloprid on larval development of *C. elegans*.** Eggs were laid by N2 wild-type worms on medium containing 1 mM nicotine or 1 mM thiacloprid. 72-hours later, the images of the progeny were taken. Worms developing in the presence of treatment are visibly smaller in comparison to the control.
```{r dev-image, fig.cap= "(ref:development-images-capt)", fig.scap = "Effects of nicotine and thiacloprid on larval development of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results2/Development_images.png")
```
\newpage
A synchronous population of L4 + 1 worms laid eggs on drug-treated plate. 2 hours later, the adults were removed from the plate. The development of the progeny was observed. The number of worms in each developmental stage, namely L1, L2, L3 and L4 was made at days 1, 2, 3 and 6 days post egg laying. Clothianidin or nitenpyram at 1mM showed no effect as the proportion of each developmental stage shifted in parallel with N2 (data not shown). In contrast thiacloprid and nicotine slowed the larval development of worms (Figure \@ref(fig:development-selected-plot)). This difference was most clearly observed at day two. Almost all control worms reached L3 stage in control plate. 50 % of thiacloprid exposed worms were L3 and the rest were still at the L2 stage. Nicotine had a greater effect with almost all the worms being L2. This suggests L2/L3 transition was disturbed. All worms reached adulthood by day 6 of their life.
<!-- # ```{r development-appendix-plot, fig.cap="(ref:development-plot-capt-2)", include="TRUE", results="hide", echo=FALSE} -->
<!-- # # read data in, drop na, transform -->
<!-- # dev_dat <- read_csv("Analysis/Data/Exported/Development.csv", -->
<!-- # col_types = cols()) -->
<!-- # #drop_na(dev_dat) -->
<!-- # #t(dev_dat) -->
<!-- # -->
<!-- # # transform by gatehring, separate columns -->
<!-- # dev_dat_t <- dev_dat %>% -->
<!-- # gather(key = Stage, value = Worms, -Time,-Cond) %>% -->
<!-- # drop_na() %>% -->
<!-- # separate(Cond, into= c("Comp", "Conc"), sep="_") -->
<!-- # -->
<!-- # #muatate charcaters to factors -->
<!-- # dev_dat_t2 <- dev_dat_t %>% -->
<!-- # mutate(Stage = factor(Stage, -->
<!-- # levels = c("L1", "L2", "L3", "L4", "Adult"), -->
<!-- # labels = c("L1", "L2", "L3", "L4", "Adult")), -->
<!-- # Comp = factor(Comp, -->
<!-- # levels = c("Ctr", "Nic","Thia", "Nit", "Clo"), -->
<!-- # labels = c("Ctr", "Nic", "Thia", "Nit", "Clo"))) -->
<!-- # #group and plot graph -->
<!-- # dev_plot <- dev_dat_t2 %>% -->
<!-- # #select(-Comp, -Stage) %>% -->
<!-- # group_by(Time, Comp, Stage) %>% -->
<!-- # ggplot(aes(x= Comp, y= Worms, fill= Stage)) + -->
<!-- # facet_wrap(~Time, ncol = 3) + -->
<!-- # geom_bar(stat = "identity") + -->
<!-- # ylab ("% worms") -->
<!-- # -->
<!-- # #dev_plot -->
<!-- # -->
<!-- # ``` -->
(ref:development-plot-capt) **Effects of nicotine and thiacloprid on the development of *C. elegans*.** N2 wild-type worms laid eggs on plates dosed with 1mM thiacloprid, 1mM nicotine or drug vehicle (Ctr). Larval development in the presence of drugs was monitored over time. Worms were assigned to each one of 5 life-stages, namely L1, L2, L3, L4 and gravid adults. The fraction of worms in each stage as a % of total population at time point: 30, (day 1), 48 hours (day 2), 72 hours (day 3), 144 hours (day 6) was measured. Data are shown as the mean of N $\ge$ 3.
```{r development-selected-plot, fig.cap= "(ref:development-plot-capt)", fig.scap= "Effects of nicotine and thiacloprid on the development of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
#select values
# dev_t3 <- dev_dat_t2 %>%
# filter(Comp == "Nic" | Comp == "Thia" | Comp == "Ctr") %>%
# filter(Time == 30 | Time == 48 | Time == 72 | Time == 144)
#
# cbp1 <- c("#999999", "#E69F00", "#56B4E9", "#009E73",
# "#F0E442", "#0072B2", "#D55E00", "#CC79A7")
#
# sel_dev_plot <- dev_t3 %>%
# group_by (Time, Comp, Stage) %>%
# ggplot(aes(x= Comp, y= Worms, fill= Stage)) +
# facet_wrap(~Time) +
# geom_bar(stat = "identity") +
# scale_fill_manual(values = cbp1) +
# ylab ("% worms") +
# xlab("Treatment") +
# labs(fill = "Developmental stage") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans")) +
# ggsave("fig/results2/final/pngpdf/developmentplot.pdf")
knitr::include_graphics("fig/results2/final/pngpdf/developmentplot.png")
```
\newpage
## Discussion
Investigation of the environmental safety profile of pest controlling compounds is essential to ensure safe use of these substances [@iyaniwura1991]. Neonicotinoids are the most commonly used insecticides worldwide, but their impact on many non-target invertebrates is poorly understood. To determine their potential environmental impact, the effects of neonicotinoids on the Nematoda representative *C. elegans* has been investigated.
Limited number of studies have investigated the effects of neonicotinoids on *C. elegans*. These investigations typically report disruption of behaviors governed by cholinergic neurotransmission [@gomez-eyles2009; @ruan2009; @mugova2018; @hopewell2017]. In this chapter detailed description of the effects of neonicotinoids on various aspects of worm behavior are described and compared to the effects exerted by a classical nicotinic acetylcholine receptor agonist, nicotine.
### Nicotine and neonicotinoids affect locomotion of worms by differential mechanisms
Wild-type animals were exposed acutely to nicotine and neonicotinoids and their effects on thrashing a measure of motility was scored. Neither thiacloprid nor clothianidin impaired motility. In contrast, nitenpyram and nicotine paralysed worms when present at mM concentrations. Increase in exposure time from 2 to 24 hours resulted in increased efficacy of nicotine on wild-type worms in motility assay which now utilized body bends. This was reflected in the shift of EC~50~ from 31 to 3.6 mM. Thiacloprid had no effect on thrashing, but it inhibited body bends by 20 % at 1.5 mM. Clothianidin had no effect on thrashing or body bends.
Despite common effects of nicotine and neonicotinoids on locomotion, the mode of action is likely to be different. Exposure of worms to nicotine for 4 hours led to significant reduction in the size of the worm. This is due to the proposed mode of action of nicotine. Nicotine activates ACR-16 nicotinic acetylcholine receptors present at the body wall muscle [@touroutine2005; @richmond1999], which leads to BWM hypercontraction [@sobkowiak2011]. The BWM is physically attached to the cuticle [@altun2009], therefore prolonged muscle stiffness and hypercontraction can lead to shrinkage of the cuticle [@petzold2011] and the reduction in the body size was observed in this study. In contrast, neonicotinoids did not have the same effect. Thiacloprid and clothianidin treated worms showed uncoordinated, twitchy phenotype and no reduction in the body length. Taken together, this data suggest that nicotine and neonicotinoids can act to inhibit locomotion differently. It is possible that they all act on nAChRs in the worm, as these molecules are the primary targets for nicotine and neonicotinoids in other species, but they are likely to act on different types of *C. elegans* nAChRs. To provide an insight into the mode of action of these compounds, studies on wild-type and nAChR mutant worms should be performed. Behavioral analysis of wild-type and mutant strains exposed to nicotine and neonicotinoids might allow for identification of strains resistant to these compounds and hence discover potential molecular targets.
### Nicotine inhibition of thrashing
The time course for the effects of 10 and 25 mM nicotine on thrashing of wild-type worm revealed two “phases” of inhibition. First, seen after 10 minutes, followed by partial recovery and a second phase seen after 40 minutes. This could suggest nicotine targets multiple sites that alter thrashing. Previous research has shown that nicotine acts at a body wall muscle but also at sensory neurons. Nicotine is an agonist of TRP $\beta$ receptors [@feng2006] which are expressed in nociceptive ASH and ADL neurons [@colbert1997]. These neurons send out processes to the nerve ring where they make connections with a diversity of circuits, including those regulating movement [@rogers2006]. A nicotine-related compound quinine has an effect on locomotion via nociceptive circuit [@hilliard2004]. It is therefore possible that the first and rapid effect of nicotine on thrashing could be due to the action on sensory neurons. Sensory neurons have processes exposed to the external environment [@hall2008], which are easily accessible to nicotine. Indeed, nicotine at high doses inhibits locomotion within 1 minute of incubation (Figure \@ref(fig:onset-plot-label)a). In addition, this effect is equally rapid on wild-type and *bus-17* mutant worms. This suports the notion that nicotine affects locomotion by targeting structures exposed to the surface and not buried within the worm.
The second phase of inhibition could be due to the effects of nicotine on the body wall muscle. It may take longer to reach muscular targets because worms ingest only a little material whilst in liquid [@gomez-amaro2015] and so nicotine must cross the cuticle to reach the BWM. The complex structure and the thickness of the cuticle may slow the kinetics of absorption. This is supported by the lack of two phases of nicotine-induced paralysis in the leaky cuticle *bus-17* mutant. The effects of nicotine on thrashing of a mutant strain equilibrate after 10 minutes of incubation which may suggest improved permeability and hence reflect synergistic sensory and muscular effects of nicotine on locomotion.
### The cuticle limits bioavailability of nicotine and neonicotinoids
This study reports low efficacy of neonicotinoids on the wild-type worm *C. elegans* (Table \@ref(tab:discuss1-summary-table)). This could be due to a low potency of compounds on target receptors, or due to the limited permeability. The increased efficacy of nicotine on wild-type worm motility in terms of body bend vs thrashing assay suggest that nicotine does not equilibrate across the cuticle readily. This suggest that low *C. elegans* sensitivity to nicotine (and potentially neonicotinoids) might be a result of hindered permeability of drugs.
Permeability of drugs across lipidic structures is dependent on the physicochemical properties of compounds [@avdeef2004]. The effects of the pH of the external buffer on the efficacy of nicotine on thrashing were investigated. The changes in pH shifts the ionization state of nicotine, which could affect absorption. A shift of pH from 7 to 6 and 9 moderately decrease EC~50~ from 26.2 mM to 16.7 mM and 15.2 mM, respectively. Therefore the pH of external solution does not markedly alter efficacy of nicotine. This may be due to worms’ capacity to regulate their cuticular surface pH in tunnel-like and water-filled pores. These structure are on the surface of the cuticle and keep constant pH microenvironment of ~5 [@sims1992; @sims1994]. There are other physicochemical factors that could play a role in permeability of nicotine and neonicotinoids, such as lipophilicity. Nicotine and neonicotinoids have moderate lipophilicity [@blaxten1993] which could limit the ability of drugs to enter and diffuse across lipidic structures [@liu2011], limiting bioavailibity and efficacy of compounds. If the primary molecular targets are within and not on the surface of the worm, the low efficacy could be due to the limited diffusion through the cuticular structures.
To investigate the role of surface coat and cuticle in drug permeability *bus-17* mutant with fragile and more permeable cuticle was employed in acute and moderate exposure assays. Exposure of *bus-17* worms increased potency of all compounds. For example, in acute-exposure, thrashing experiments, the EC~50~ for the effects of nicotine and nitenpyram increased by 8- and 5-fold, respectively. Moreover, thiacloprid and clothianidin had no effect on motility of the wild-type worm, but on *bus-17* they induced paralysis with the EC~50~ of 480 $\mu$M and 2.2 mM, respectively. Increased drug sensitivity was also observed in other cuticle-mutant strains for example *bus-8* [@partridge2008], *bus-5* and *bus-16* [@xiong2017]. This increased sensitivity is thought to be due to an increased cuticular permeability in mutant strains [@partridge2008; @xiong2017]. These data highlights the importance of the cuticle in protecting *C. elegans* against the outer environment. The cuticle is a common structural feature of all soil nematodes [@decraemer2003]. It is likely that it limits bioavailability of residual insecticides in all soil nematodes, hindering their potential toxic effects.
#### Nicotine and thiacloprid have a neurodevelopmental effect on *C. elegans*.
Worms growing in the presence of 1 mM nicotine and thiacloprid developed into adults slower than the control worms. Neonicotinoids also disrupt larval development in bees [@souzarosa2016]. In would be interesting to investigate whether there is a common mechanism of neonicotinoid-induced neurodevelopmental defect in worms and bees. In worms, thiacloprid acts by disrupting L2/L3 transition. L2 stage is a stage at which multiple cell divisions and differentiation occurs [@hall2008]. Nicotinic acetylcholine receptors containing UNC-63 subunits seem to be involved in this process [@ruaud2006]. Developmental assays on *unc-63* and other nAChR mutants should be carried out to determine if the action of thiacloprid depends on this protein.
\newpage
------------------------------------------------------
Behavioral Compound Strain EC~50~
assay
-------------- ---------------- --------- ------------
Thrashing Nicotine N2 26.2mM
*bus-17* 3.3mM
Nitenpyram N2 195.8mM
*bus-17* 16.6mM
Thiacloprid N2 > 1.5mM
*bus-17* 377.6$\mu$M
Clothianidin N2 > 2.5mM
*bus-17* 3.3mM
Body bends Nicotine N2 3.6mM
*bus-17* 1.6mM
Nitenpyram N2 > 1mM
*bus-17* > 1 mM
Thiacloprid N2 3.7mM
*bus-17* 721.2$\mu$M
Clothianidin N2 > 3.75mM
*bus-17* 3.3mM
Egg-laying Nicotine N2 > 1mM
*bus-17* > 1mM
Nitenpyram N2 > 1mM
*bus-17* > 1mM
Thiacloprid N2 > 1mM
*bus-17* 1.4mM
Clothianidin N2 > 3.75mM
*bus-17* 6.2mM
Egg-hatching Nicotine N2 > 1mM
*bus-17* > 1mM
Nitenpyram N2 > 1mM
*bus-17* > 1mM
Thiacloprid N2 > 1mM
*bus-17* 1.5mM
Clothianidin N2 > 3.75mM
*bus-17* > 3.75mM
------------------------------------------------------
Table: (\#tab:discuss1-summary-table) Summary table of the effects of nicotine and neonicotinoids on *C. elegans*.
04-results-02.Rmd
View file @ e74fe8cf
# Second Results {#results-2} # The effects of nicotine and neonicotinoids on the pharyngeal pumping of *C. elegans* {#results-2}
Second results chapter. Here's a reference: [@abe2009]. ## Introduction
```{r mpg-table, echo=FALSE, cache=TRUE} Results from the previous results chapter show low susceptibility of *C. elegans* to neonicotinoids and that the cuticle is a limiting factor of the efficacy of these compounds on locomotion. This chapter aims to further characterise the concentration-dependent effects of neonicotinoids on worm and the role of the cuticle in their efficacy, by utilising the pharyngeal pumping assay.
kable(head(mpg[, 1:8], 10), "latex", caption = "A table of the first 10 rows of the mpg data set", booktabs = T) %>%
kable_styling(latex_options = c("hold_position")) The pharynx is responsible for feeding. It functions to capture the bacterial suspension, expel the fluid and trap bacteria inside the pharyngeal lumen [@song2012]. The bacteria is then smashed and passed to the gut for digestion [@avery1987].
These complex pharyngeal functions are performed by two motions: pumping and peristalsis (Figure \@ref(fig:feeding-label) [@avery1989]). Pumping is the contraction and a subsequent relaxation of the corpus, anterior isthmus and the terminal bulb. Peristalsis is the motion of the posterior isthmus that pushes the bacteria to the terminal bulb for grinding. On average, peristalsis occurs every 3.4 pumps [@song2013] and begins after the relaxation of the pharyngeal muscle. Grinding of the food particles is performed by the grinder. The grinder is positioned in the terminal bulb and composed of 3 pairs of muscle cells [@albertson1976]. Contraction of these cells leads to their rotation, resulting in food maceration.
\newpage
(ref:feeding) **Feeding of *C. elegans*.** As the corpus and anterior isthmus contract, bacterial suspension enters the pharynx through the mouth (top). Subsequent relaxation expels water out, trapping bacteria in the corpus-anterior isthmus lumen (middle). This pumping movement is synchronised with the terminal bulb contraction-relaxation cycle leading to movement of the grinder and crashing of food trapped between the muscle segments (not shown). This happens on average 3.4 times to allow food accumulation [@song2012] and passage to the intestine. The peristalsis of the posterior isthmus opens the isthmus-terminal bulb lumen and pushes the next portion of food in [@avery1987] for fragmentation (bottom).
```{r feeding-label, fig.cap="(ref:feeding)", fig.scap='\\textit{C. elegans} feeding.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/feeding.png")
```
<!-- ```{r synapses-celegans-pharynx, echo=FALSE, warning=FALSE, message=FALSE} -->
<!-- library(kableExtra) -->
<!-- library(dplyr) -->
<!-- innervation_pharynx_tbl <- data.frame( -->
<!-- Muscle = c("pm1", "pm2", "pm3", "pm4", "pm5", "pm6", "pm7", "pm8"), -->
<!-- Chemical = c("M1", "M1", "M1", "M2, M3, MC", "M2, M3, M4, I5", "M5 , M4?", "M5", " "), -->
<!-- Gap = c("", "", "", "MC via mc2", " ", "M5 via mc3", "M5 via mc3", "M5 via mc3")) -->
<!-- innervation_pharynx_tbl %>% -->
<!-- mutate_all(linebreak) %>% -->
<!-- kable("latex", booktabs = T, escape = F, -->
<!-- col.names = linebreak(c("Muscle cell", "Chemical synapse", "Gap junction")), -->
<!-- caption = "Connectivity of the pharyngeal neuromuscular system.") %>% -->
<!-- kable_styling(latex_options = "hold_position") -->
<!-- ``` -->
### Anatomy of the *C. elegans* pharynx
Electron micrograph analysis of the *C. elegans* pharyngeal sections [@albertson1976] provides a detailed picture of its anatomy. The pharynx is a tubular feeding organ located in the head of the worm. It is 20 $\mu$M wide and 100 $\mu$M long, encapsulated by the basal membrane which separates the pharyngeal cells from the pseudocoelom. On the apical surface, the basal lamina lies directly below the cuticle. This is in contrast to the body wall muscle, where these two layers are also separated by the hypodermis. The pharynx can be divided into three anatomical features: most anterior corpus, middle isthmus and posterior terminal bulb. There are five different main cell types in the pharynx: muscles, neurons, epithelial, glands and marginal cells (Figure \@ref(fig:pharyngeal-muscle-label)). The main constituents are the 20 muscle cells and 9 marginal cells which wrap around the pharyngeal lumen. Embedded within those cells are 4 glands and 20 neurons.
There are 8 layers of muscle cells encapsulating the pharynx (pm1-pm8). pm1 is the most anterior and constitutes from a single cell surrounding the pharyngeal lumen and six processes running down the pro-corpus. Posterior to pm1 are the three cells of the pm2 muscle cells which also wrap around the lumen of the pharynx. Both pm1 and pm2 are, relative to other muscles of the pharynx, thin. pm3 together with pm1 and pm2 form pro-corpus, pm4 meta-corpus whereas pm5 the isthmus of the pharynx. These three sections are wedge-shaped and formed from three cells. There are three muscular layers forming the terminal bulb: pm6, pm7 and pm8. pm6 and pm7 are composed of three cells, whereas pm is a single cell. pm8 is the most anterior and it is connected to the intestine by the toroidal valve composed of six cells.
<!-- Cells with three fold symmetry : 3 cells in each pm2, pm3, pm4 and pm5 are syncytial. Each contains two nuclei (6 total). -->
<!-- pm1 six nuclei also syncytial, one cell, syncytial -->
<!-- pm6 and pm7 three non syncytial cells each -->
<!-- pm8 is one cell and nonsyncytial cell. -->
There are nine marginal cells in the pharynx: mc1 - mc3 each with three fold symmetry. These cells run along the pharynx from the pm1 to pm8. They receive chemical synapses from M5 and form gap junctions with muscle cells.
\newpage
(ref:pharyngeal-muscle) **The musculature of the *C. elegans* pharynx.** Cartoon representation of the muscle cells constituting each of the three anatomical features: the corpus, isthmus and the terminal bulb (a) A single cell of each layer is pictured. Epifluorescence image of pharyngeal muscle cells from the transgenic worm expressing myofilaments GFP reporter gene (b, left panel) and epifluorescence image of the transgenic worm expressing mitochondrial GFP reporter gene (b, right panel), to highlight the muscle cells of the terminal bulb. Images adapted from @albertson1976 (a) and @altun2009a (b).
```{r pharyngeal-muscle-label, fig.cap="(ref:pharyngeal-muscle)", fig.scap= "The musculature of the \\textit{C. elegans} pharynx.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/general_intro/png/pharynx_muscle.png")
```
\newpage
### Sensory regulation of pumping
There are 302 neurons in a *C. elegans* hermaphrodite, 20 of which are present in the pharynx [@white1986]. The pharyngeal nervous system is connected to the somatic nervous system a single point: a pair of gap junctions between the extrapharyngeal RIP and pharyngeal I1 neurons [@albertson1976]. Laser ablation of RIP has no effect on pumping rates on or off food [@dalliere2015], suggesting that pharyngeal system is sufficient to drive pharyngeal responses. However, there is evidence that pharyngeal pumping can be influenced by the sensory cues. Animals with abolished sensory neurons and not RIP neurons have blunted pharyngeal response to light touch [@riddle1997], light [@bhatla2015], familial food, [@song2013], or attractive and repellent odours [@li2012]. This evidence supports the sensory regulation of the pharyngeal activity. Numerous sensory cues associated with food are detected by the *C. elegans* to modulate pharyngeal pumping including odour [@li2012] and mechanical stimulation [@chalfie1985]. These cues are detected by the sensory neurons. There are 60 sensory neurons in *C. elegans*. There are also pharyngeal neurons which are likely to serve sensory function. This includes NSM and all I neurons with the exception of I4. The activity of the parynx is also under the influence of the humoral transmission. The pharynx expresses receptors activated by neurotransmitters not synthesised by the pharynx, such as dopamine [@sugiura2005]. Mutation of genes not expressed in the pharynx has an effect on the pharyngeal response to food [@calahorro2018].
\newpage
```{r pharynx-neurons, echo=FALSE, warning=FALSE, message=FALSE, warning=FALSE}
library(kableExtra)
library(dplyr)
pharyngeal_nrs <- data.frame(
Type = c(rep("Motorneuron", 5), rep("Interneurons", 6), rep("Other", 3)),
Pharyngeal = c("M1", "M2*", "M3*", "M4", "M5", "I1*", "I2*", "I3", "I4", "I5", "I6", "MI", "NSM", "MC*"),
Neurtras = c("Acetylcholine", "Acetylcholine", "Glutamate", "Acetylcholine", "Acetylcholine", "Acetylcholine", "Glutamate", "Acetylcholine", "?", "Glutamate", "?", "Glutamate", "5-HT", "Acetylcholine"))
pharyngeal_nrs %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("Type", "Pharyngeal\nneuron", "Neurotransmitter\nreleased")),
caption = "Pharyngeal neurons and the neurotransmitters they release.") %>%
kable_styling(latex_options = "hold_position") %>%
collapse_rows(columns = 1, valign = "top") %>%
footnote(general = "Bilateral neurons are marked with *. Most neurons are either motor (M) or inter -neurons (I), but some have additional functions. NSM function as motor and secretory neuron, MI is a motor-interneurons, whereas MC is a motor and sensory neuron. Three neurons are sufficient for feeding: MC, M3 and M4.",
threeparttable = T)
```
\newpage
### Pharyngeal nervous system
There are 20 neurons in the pharynx [@albertson1976] and Table \@ref(tab:pharynx-neurons)). Laser ablation studies combined with behavioural analysis of generated worms provides an explanation of the role of the entire pharyngeal nervous system, and the role of individual neurons in the pharyngeal pumping.
The pharyngeal nervous system is not essential for the function of the pharynx, but it is crucial for the regulation and modulation of the pharyngeal function in response to the environment. In the absence of food, the wild-type worm pumps at a low rate. This increases markedly in the presence of food. The laser ablation of the pharyngeal nervous system does not abolish pumping entirely [@avery1989]. In the absence of food, wild-type worm makes 43 pumps per minute. This is reduced to 16 in worms lacking pharyngeal neurons. A stronger phenotype of neuron-ablated worms can be seen upon introduction of food. In the presence of food, pharyngeal pumping rate drops from 224 to 26 in laser ablated worms. In addition, there are abnormalities in the mechanism of pumping of worms lacking the pharyngeal nervous system: little food passes into the intestine resulting in retarded growth and compromised fertility [@avery1989; @avery1993] showing the essential role of the pharyngeal nervous system in the feeding response.
Three out of 14 pharyngeal neuron types are sufficient to elicit feeding. These neurons are MC, M3 and M4. Laser ablation of MC neuron (MC^-^strain) leads to reduction of pumping rate by 75% on food and 37% off food. Therefore, MC is important in initiation of pumping [@avery1989; @raizen1995]. Laser ablation of M3 or M4 has little effect on the pumping rate [@raizen1995], but it effects the mechanism of pumping. M3^-^ animals have markedly extended latency of a single pump [@avery1993] suggesting M3 governs the timing of pumping. The sensory endings of M3 synapse onto the M4^-^ animals accumulate bacteria in the corpus suggesting M4 initiates peristalsis [@avery1989; @avery1993] by stimulating isthmus opening via mechanism that is not yet fully understood.
\newpage
(ref:pharyngeal-nervous-system) **Pharyngeal nervous system.** Simplified pharyngeal nervous system showing the major neurons, synaptic connection and neurotransmitters. Synapses between I1-RIP connect the extrapharyngeal and pharyngeal nervous system.
```{r pharyngeal-nervous-system-label, fig.cap="(ref:pharyngeal-nervous-system)", fig.scap= "Pharyngeal nervous system.", fig.align= 'center', echo=FALSE}
knitr::include_graphics("fig/results3/pharyngeal_system_2.png")
```
\newpage
### Neurotransmitters of the pharynx
Genetic studies of worm mutant strains provide evidence for a critical role of neurotransmission in the regulation of feeding. UNC-13 protein is involved in the regulation of neurotransmitter release at the synapse, as shown by the biochemical and behavioural analysis of the *unc-13 C. elegans* strain. Mutants deficient in UNC-13 show severe retention of vesicles in the pre-synapse [@richmond1999] and impaired synaptic transmission [@aravamudan1999]. Their feeding is also affected: 70 % reduction of the pharyngeal pumping rate was noted [@richmond2001]. These data highlight the key role of neurotransmitters in the regulation of pumping. The activity of the pharynx is influenced by acetylcholine, glutamate and 5-HT (Table \@ref(tab:pharynx-neurons) and Figure \@ref(fig:pharyngeal-nervous-system-label)), and potential tyramine and octopamine [@alkema2005].
#### 5-HT
5-HT is synthesised in two pharyngeal neurons NSM and I5 [@chase2007]. Mutant deficient in enzyme in the 5-HT biosynthetic pathway has blunted response to food [@sze2000]. Exogenous application of 5-HT induces feeding response in the absence of food whereas competitive 5-HT antagonists inhibit pumping [@horvitz1982; @avery1990]. Collectively, this suggests that serotonergic neurotransmission induce food-evoked feeding response.
In the presence of food, 5-HT can be released from multiple sites, including NSM, ADF and HSN neurons. NSM are neurosecretory neurons in the pharyngeal nervous system. In the presence of food, they release 5-HT into the pseudocoelomic fluid [@horvitz1982] to inhibit locomotion, induce pumping and alter other behaviours [@horvitz1982]. ADF are chemosensory neurons present on the head of the worm. Release of 5-HT selectively from ADF neurons is sufficient to drive the feeding response [@cunningham2012]. Similarly, selective release of 5-HT from extrapharyngeal HSN neurons when NSM and ADF neurotransmission is defective, results in potent pumping response [@lee2017]. Therefore, there are 3 possible routes by which elevated levels of 5-HT in the presence of food can be achieved. It is possible that these routes co-function or operate at different conditions.
Detection of food leads to the elevation of pumping rate via 5-HT acting at multiple G-protein coupled receptors [@avery2012]. 5-HT can regulate feeding response by binding to neuronal SER-4 receptors and SER-1 receptors expressed both in the pharyngeal muscle cells and neurons [@tsalik2003]. It also binds to SER-5 receptors expressed on extrapharyngeal interneurons [@cunningham2012]. However, the main driver of the 5-HT driven pharyngeal response it the activation of SER-7 receptors expressed on cholinergic MC and M4 neurons and and on glutametergic M3 neurons [@hobson2003; @song2013]. Acetylcholine released from MC and M4 neurons increases contraction frequency and induce isthmus peristalsis, respectively [@avery1987; @raizen1994]. This leads to an increase in the activity of the pharynx to ~260 pumps/min. Glutamate released from M3 shortens pump duration to <200ms.
#### Glutamate
Glutamate is produced in at least 4 neurons (Table \@ref(tab:pharynx-neurons)), but its function in M3 is the best studied. Laser ablated M3^-^ animals have reduced pumping rate on food [@raizen1995]. Similar phenotype is observed in animals deficient in glutametergic neurotransmission. EAT-4 encodes for vesicular glutamate transporter [@lee1999]. Mutation of this gene in *C. elegans*, leads to reduction of the pharyngeal pumping rate of food [@lee2008].
In response to food, released 5-HT activates M3 [@niacaris2003], leading to release of glutamate which in turn contributes to the potent pharyngeal response. Specifically, it leads to shortening of the duration of the pump. M3-released glutamate acts via glutamate-gated chloride channel expressed on pm4 and pm5 pharyngeal muscles [@dent1997]. Activation of these channels during depolarisation phase of the pharyngeal muscle action potential leads to the generation of post-synaptic inhibitory potentials, which bring about the repolarisation and hence relaxation of the muscle. This in turn shortens the pump duration [@avery1993], allowing another muscle depolarisation to occur.
<!-- The critical role of glutamate in pharyngeal pumping was demonstrated in behavioural studies of *C. elegans* mutants. Laser ablated M3^-^ animals have reduced pumping rate on food [@raizen1995]. Similar phenotype is observed in animals deficient in glutametergic neurotransmission. EAT-4 encodes for vesicular glutamate transporter [@lee1999]. Mutation of this gene leads to reduction of the pharyngeal pumping rate of food [@lee2008]. -->
<!-- Glutamate may play other roles in the pharynx. @dillon2015 investigated an involvement in another glutamate receptor in pharyngeal response upon acute food removal. MGL-1 is a G-protein coupled receptor widely expressed in the pharynx, including the pharyngeal nervous system. *Mgl-1 C. elegans* mutant shows reduced pumping rate on food upon acute food removal. -->
<!-- Note that the food activated and 5-HT activated pathways are different. Check out the figure 6 in @lee2017 -->
<!-- There are also other 5-HT receptors, such as MOD-1 (for modulation of locomotion defective). MOD-1 is a 5HT-gated chloride channel [@ranganathan2000] with topology similar to the Cys-loop receptor superfamily. Phenotypical analysis of worms deficient in MOD-1 showed that starved mutant worms move faster in comparison to the wil-type strain upon entry onto the food patch, suggesting MOD-1 is involved in the regulation of locomotion in response to food in food-deprived animals. -->
<!-- https://www.pnas.org/content/116/14/7107 -->
#### ACetylcholine ##{#achpumping}
The role of acetylcholine in the regulation of feeding was investigated in mutants deficient in proteins essential for the cholinergic neurotransmission (Section \@ref(cholinergicneurotransmissioninworms)). Null mutants die soon after birth due to starvation [@rand1989; @alfonso1993], whereas polymorphic mutants show reduced pharyngeal pumping both in the presence and absence of food [@dalliere2015]. Hindered feeding was also observed in animals in which one of the 6 cholinergic neuron, namely MC neurons, were ablated [@avery1989; @raizen1995].
Pharmacological and genetic studies suggest that acetylcholine stimulates pharynx by acting on nAChRs. Application of nAChR agonists, acetylcholine and nicotine, resulted in the stimulation of the pharyngeal pumping in the absence of food [@raizen1995]. In contrast, nAChR antagonist d-tubacurarine inhibited pharyngeal pumping in the presence of food [@raizen1995].
Although there are at least 29 nAChRs expressed in *C. elegans* (Figure \@ref(fig:seqidentityecd-label)), only one, namely EAT-2 has been identified as essential in mediation of the feeding response [@mckay2004]. EAT-2 is expressed in pm4 and pm5 muscle cells [@mckay2004], which make synaptic connections with the MC [@albertson1976]. *C. elegans eat-2* mutant shows significantly reduced pumping in the presence of food [@raizen1995; @mckay2004]. A similar phenotype was noted in the *eat-18* mutants. EAT-18 however is not a nAChR subunit. Instead, it is predicted to be a single transmembrane protein. Based on the localisation and behavioural phenotype, EAT-18 and EAT-2 are believed to co-assembly to form a functional receptor [@mckay2004].
ACR-7 is also expressed at the pharyngeal muscle [@saur2013], as was shown with a reporter construct, however its function in pharyngeal pumping is unclear as *acr-7* mutant pump normally in the presence of food [@saur2013]. Besides nAChRs, there are other acetylcholine - sensitive receptors in the pharynx.
<!-- nAChR are likely to be expressed not only at the neuromuscular junction, as suggested by the EAT-18 expression pattern. Expression of GFP-tagged eat-18 gene under the native promoter leads to fluorescence in all types of pharyngeal muscle cells and in M5 neuron [@mckay2004]. The identity of other subunits remains to be elucidated. -->
GAR-3 is a ACh-sensitive GPCR receptor [@hwang1999] expressed in metacorpus, isthmus, terminal bulb of the pharyngeal muscle and in the I3 pharyngeal neuron [@steger2004]. Its role may involve regulation of the membrane electrical potential [@steger2004] and control of feeding during starvation [@you2006].
Acetylcholine-gated chloride channels (ACC) are ionotropic channels and like nAChRs, members of Cys-loop receptor family. There are at least 8 members isoforms: ACC-1 to ACC-4, LGC-46 to LGC-49 [@takayanagi-kiya2016], which form homo- and hetero-pentamers [@putrenko2005]. They are generally expressed in a distinct subset of cholinergic and glutametergic neurons (including acc-1 in pharyngeal M1 and M3) [@pereira2015; @takayanagi-kiya2016]. Interestingly, *acc-4* is expressed in almost all cholinergic neurons. Electrophysiological data suggest ACC channels are inhibitory but they may be playing multiple functions. ACC-4 may be acting as autoinhibitory, as most neurons predicted to express it do not receive direct synaptic input from other neurons [@albertson1976]. LGC-49 are expressed in presynaptic specialisations of cholinergic motor neurons where they regulate synaptic vesicle release [@takayanagi-kiya2016]. Based on pharmacologically characterised ACC-1 and ACC-2 *in vivo*, ACC receptors are also pharmacologically distinct from other ACh receptors. Some of the nAChR and GPCR receptor compounds were potent at modulating the activity of ACC channels, but not others. For example, ACC channels are insensitive to nAChR compounds nicotine, cytisine and antagonist $\alpha$-bgtx but are sensitivity to tubocurarine. This mixed pharmacological profile suggest ligand binding site is distinct from the binding site of nAChRs and cholinergic GPCRs.
### Assays for scoring the effects of compounds on pharyngeal pumping
Pharyngeal pumping can be scored in two distinct animal preparations. One is the intact worm preparation, and the other is the cut-head preparation in which the cuticular barrier is removed by cutting the head away from the body, enabling easy drug access to pharyngeal binding sites. The pharyngeal pumping of the worm can be scored by visual observation. This is performed by counting the number of grinder movements in a period of time. Grinder activity is coupled to the contraction and relaxation cycles of the pharynx, therefore is a good indication of the pharyngeal function.
### Chapter aims
This chapter describes the effects of 5-HT, nicotine and neonicotinoids on the pharyngeal pumping. The effects of compounds are scored on intact and cut-head worm in which access to the pharyngeal binding sites is increased. The aim of these investigations is to inform on the sensitivity of the pharyngeal system to 5-HT, nicotine and neonicotinoids and to provide an insight into the cholinergic regulation of the pharyngeal system. Additionally, effects of compounds on the pharyngeal pumping of mutants deficient in nAChR expression is investigated to elucidate the molecular basis of drug-induced pharyngeal alterations.
\newpage
## Results
```{r echo=FALSE, results="hide", include=FALSE}
library(grid)
library(cowplot)
library(tidyverse)
library(ggpubr)
library(readr)
library(ggplot2)
library(scales)
library(curl)
library(devtools)
library(extrafont)
library(magick)
```
### Effects on pharyngeal pumping of intact worms on food
Pharyngeal pumping is a feeding behaviour of the intact worm mediated by the pharynx. In the presence of food, the pharynx pumps at an approximate rate of 4 pumps/s (4Hz) to ingest food particles Figure \@ref(fig:pump-on-food-plot-label). A typical way of assessing the effects of compounds on feeding is to place *C. elegans* on agar plate soaked with drug solution and laced with *E. coli* OP50 food patch. A drug present on the plate comes in direct contact with foraging worm, but also can enters the worm via ingestion and/or diffusion cross the cuticle. To assess the effects of nicotine and neonicotinoids, wild-type worms were exposed to nicotine, nitenpyram, thiacloprid and clothianidin for 24-hours before scoring their effects on pharyngeal pumping (Figure \@ref(fig:pump-on-food-plot-label) left panel). Nicotine at concentrations $\ge$ 1 mM inhibited pumping in a dose - dependent manner. Nitenpyram and thiacloprid at 1 mM as well as clothianidin at 3.75 mM had no effect.
Analysis of responses to compounds in *bus-17* mutants show that the worm's cuticle can hinder the efficacy of drugs (Chapter 3). To determine whether the cuticle affects the efficacy of nicotine and neonicotinoids on the feeding behaviour, pharyngeal pumping experiments were repeated on the *bus-17*, cuticle-disrupted mutant of *C. elegans* (Figure \@ref(fig:pump-on-food-plot-label) right panel)). As in the wild-type, the pharyngeal pumping of the *bus-17* mutant was inhibited by nicotine at 1 and 10mM, whereas nitenpyram had no effect. In contrast, the dose of thiacloprid and clothianidin was ineffective on wild-type, inhibited pumping of the mutant at low mM concentrations.
To compare the efficacy of compounds on wild-type versus mutant strain, dose-response curves for the effects of treatment on pharyngeal pumping were generated (Figure \@ref(fig:dr-pumping-on-food-label)). Almost one fold difference in the potency of nicotine was observed. The EC~50~ on wild-type worm was 4.3 mM. This decreased to 2.3 mM in a mutant strain. Nicotine was also the most efficacious out of all compounds tested at inhibiting pumping. The estimated EC~50~ of thiacloprid and clothianidin on a mutant strain were 2.6 and 6.2 mM, respectively. Since they had no effect on wild-type it is not possible to estimate the fold-potency change between the wild-type and mutant strain.
<!-- # ```{r echo=FALSE, include=FALSE, message=FALSE, results="hide"} -->
<!-- # on_plate_dat_1 <-readRDS("Analysis/Data/Transformed/combined.RSD") -->
<!-- # ``` -->
(ref:pump-of-food) **The concentration-dependence for the effects of nicotine and neonicotinoids on feeding of *C. elegans*.** Wild-type (left panel) and *bus-17* (right panel) worms were exposed for 24 hours to nicotine, nitenpyram, thiacloprid, clothianidin or vehicle control (O), incorporated into solid medium. Pharyngeal pumps of worms present on food were counted by visual observation for 1 minute and expressed in Hz. Data are mean $\pm$ SEM, collected from 8 - 32 individual worms on $\ge$ 3 days. One way ANOVA (Kruskal-Wallis test) with Dunn’s Corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r pump-on-food-plot-label, fig.cap="(ref:pump-of-food)", include=TRUE, echo=FALSE, fig.scap="The concentration-dependence for the effects of nicotine and neonicotinoids on feeding of \\textit{C. elegans}.", fig.align='center'}
# on_plate_dat_trans_1 <- on_plate_dat_1 %>%
# drop_na() %>%
# mutate(Dose = factor(Conc,
# levels= c(0, 0.001, 0.01, 0.1, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3.75, 5, 10, 25, 50, 100),
# labels = c("0", "0.001", "0.01", "0.1", "0.25", "0.5", "0.75", "1", "1.5", "2", "2.5", "3.75", "5", "10", "25", "50", "100")),
# Exp = factor(Experiment,
# levels= Experiment,
# labels = Experiment))
#
# on_plate_pump_selected <- on_plate_dat_trans_1 %>%
# filter(Assay == "Pump")
#
# on_plate_pump_selected$Hz <- on_plate_pump_selected$readout/60
#
# on_plate_pump_stats <- on_plate_pump_selected %>%
# group_by(Assay, Exp, Strain, Comp, Dose) %>%
# summarise(mean_Hz=mean(Hz),
# n=n(),
# sd=sd(Hz),
# se=sd/sqrt(length(Hz)))
#
# labels_pump_on_food <- c("1" = "Nicotine N2", "2" = "Nicotine bus17", "3"= "Nitenpyram N2", "4" = "Nitenpyram bus17", "5" = "Thiacloprid N2", "6" = "Thiacloprid bus17", "7" = "Clothianidin N2", "8" = "Clothianidin bus17")
#
# ann_text_pump_on_food <-data.frame(Dose = factor(c(1, 10, 25), levels = c(1, 10, 25)),
# mean_Hz = 4.5,
# lab_pump_on_food = c("****", "****", "****"),
# Exp = as.factor(1))
#
# ann_text_pump_on_food_1 <-data.frame(Dose = factor(c(1, 10), levels = c(1, 10)),
# mean_Hz = 4.5,
# lab_pump_on_food_1 = c("****", "****"),
# Exp = as.factor(2))
#
# ann_text_pump_on_food_2 <-data.frame(Dose = factor(c(0.5, 1, 1.5), levels = c(0.5, 1, 1.5)),
# mean_Hz = 4.5,
# lab_pump_on_food_2 = c("****", "****", "****"),
# Exp = as.factor(6))
#
# ann_text_pump_on_food_3 <-data.frame(Dose = factor(c(1, 2, 3.75), levels = c(1, 2, 3.75)),
# mean_Hz = 4.5,
# lab_pump_on_food_3 = c("****", "**", "****"),
# Exp = as.factor(8))
#
# pump_on_food_plot_nic <- on_plate_pump_stats %>%
# filter(Exp=="1" | Exp == "2") %>%
# drop_na() %>%
# ggplot(aes(x = Dose, y= mean_Hz, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_Hz-se, ymax = mean_Hz+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_on_food)) +
# geom_text(data = ann_text_pump_on_food, aes(label = lab_pump_on_food)) +
# geom_text(data = ann_text_pump_on_food_1, aes(label = lab_pump_on_food_1)) +
# scale_fill_manual(values=c('#000000','#333333', '#666666','#999999', '#CCCCCC')) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# strip.text.x = element_text(size=12),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# pump_on_food_plot_nit <- on_plate_pump_stats %>%
# filter(Exp=="3" | Exp == "4") %>%
# drop_na() %>%
# ggplot(aes(x = Dose, y= mean_Hz, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_Hz-se, ymax = mean_Hz+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_on_food)) +
# theme(legend.position="none") +
# scale_fill_manual(values=c('#000000','#339900')) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# pump_on_food_plot_thia <- on_plate_pump_stats %>%
# filter(Exp=="5" | Exp == "6") %>%
# drop_na() %>%
# ggplot(aes(x = Dose, y= mean_Hz, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_Hz-se, ymax = mean_Hz+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_on_food)) +
# scale_fill_manual(values=c('#000000','#000066', '#0000CC','#0000FF', '#0033FF','#3366CC', '#66CCFF')) +
# geom_text(data = ann_text_pump_on_food_2, aes(label = lab_pump_on_food_2)) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# strip.text.x = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# pump_on_food_plot_clo <- on_plate_pump_stats %>%
# filter(Exp=="7" | Exp == "8") %>%
# drop_na() %>%
# ggplot(aes(x = Dose, y= mean_Hz, fill=Dose)) +
# geom_errorbar(aes(ymin = mean_Hz-se, ymax = mean_Hz+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_on_food)) +
# scale_fill_manual(values=c('#000000','#993300', '#996633','#CC9933', '#FFCC33')) +
# geom_text(data = ann_text_pump_on_food_3, aes(label = lab_pump_on_food_3)) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# clo_grid <- plot_grid(pump_on_food_plot_nic, pump_on_food_plot_nit, pump_on_food_plot_thia, pump_on_food_plot_clo, nrow=4)
# clo_grid = clo_grid + draw_label("Concentration [mM]", x = 0.4, y = 0, hjust = 0, vjust = 0) +
# ggsave("fig/results3/pumping_on_food_graph.pdf")
knitr::include_graphics("fig/results3/pumping_on_food_graph.png")
```
(ref:DR-Pumping-on-food) **Dose-response curves for the effects of nicotine and neonicotinoids on feeding of *C. elegans*.** Concentration-dependence curves for the effects of nicotine (a), nitenpyram (b), thiacloprid (c) and clothianidin (d) on feeding of wild-type and *bus-17* *C. elegans*. Dose-response curves were generated by taking data points from Figure \@ref(fig:pump-on-food-plot-label), and expressed as % control pumping. Data and mean $\pm$ SEM. The EC~50~ for thiacloprid and clothianidin are approximations, because at the highest concentration tested (1.5 and 3.75 mM) they inhibited *bus-17* pumping by 45 and 50 %, respectively.
```{r dr-pumping-on-food-label, fig.cap="(ref:DR-Pumping-on-food)", fig.asp=1.2, echo=FALSE, fig.scap = "Dose-response curves for the effects of nicotine and neonicotinoids on feeding of \\textit{C. elegans}.", fig.align='center', warning=FALSE}
knitr::include_graphics("fig/results3/DR-pumping_on_food.png")
```
\newpage
#### Effects on pharyngeal pumping in liquid
During the course of the investigation, it was noted that high concentrations of nicotine had an antimicrobial effect on *C. elegans* food source - the OP50 *E. coli*. This raised a concern that the observed effects of nicotine on feeding could be partially due to the effects of this compound on the density of bacteria. To circumvent this issue, an alternative assay was developed in which the need for bacteria is removed. This alternative assay is performed in liquid, in the presence of 10 mM 5-HT. 5-HT has dual effect: it makes the worms immobile and stimulates their pumping (Figure \@ref(fig:5HT-pumping-label) a). After a 5 minute incubation with 10 mM 5-HT, 45 % of worms were paralysed. This increased to 65 % after 1 hour of incubation. The paralysing effect of 5-HT enabled measurements of the pharyngeal pumping activity of worms. Whilst in the liquid, worms display negligible food intake [@gomez-amaro2015]. 10 mM 5-HT stimulated pumping to 4 Hz - an effect seen after 5-minute exposure and sustained for 1 hour (Figure \@ref(fig:5HT-pumping-label) b).
\newpage
(ref:10mM-5HT-pumping-in-liquid) **The effects of 5-HT on *C. elegans* behaviour in liquid.** Worms were exposed to 10mM 5-HT or vehicle control (0). The effects on locomotion over time was scored by counting the number of immobile worms pre- (time point zero) and post-exposure to treatment or vehicle control. Data are expressed as % of worms paralysed (a). Additionally, the effects of 5-HT on pumping of immobile worms was scored. The measurements were made immediately after addition of 5-HT or vehicle control (time point 0) and post-exposure at the indicated time points. Pumping was scored by visual observation by counting the number of pumps over the period of 30 seconds and expressed in Hz. Data are mean $\pm$ SEM of 3 independent repeats. Motility of 10 worms per condition was scored during each experiment.
```{r 5HT-pumping-label, echo=FALSE, fig.cap="(ref:10mM-5HT-pumping-in-liquid)", fig.scap = "The effects of 5-HT on \\textit{C. elegans} behaviour in liquid.", fig.align='center', message=FALSE, echo=FALSE, warning=FALSE}
# ht_pump_in_liq <- read_csv("Analysis/Data/Transformed/intact_worm/5ht_pumping_in_liquid.csv")
# ht_paralysis <- read_csv("Analysis/Data/Transformed/intact_worm/5ht_paralysis")
# ht_paralysis_transf <- ht_paralysis %>%
# mutate (Dose = factor(Dose,
# levels = Dose,
# labels = Dose))
# ht_paralysis_plot <- ht_paralysis_transf %>%
# group_by(Time, Dose) %>%
# na.omit() %>%
# summarise(mean_paralysed = mean(paralysed),
# sd=sd(paralysed),
# se = sd/sqrt(length(paralysed))) %>%
# ggplot(aes(Time, mean_paralysed, colour = Dose)) +
# scale_color_manual(values=c("grey","black"))+
# geom_line(size=1) +
# geom_point(size=1) +
# geom_errorbar(aes(ymin = mean_paralysed-se, ymax = mean_paralysed+se)) +
# theme(legend.position="none") +
# xlab("Time (mins)") +
# ylab("% Paralysed") +
# theme(panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# text=element_text(size=12, family="sans"))
#
# ht_pump_in_liq$Pump <- ht_pump_in_liq$Pump/60
# ht_pump_liq_stats <- ht_pump_in_liq %>%
# group_by(Time, Dose) %>%
# na.omit() %>%
# summarise(mean_pump=mean(Pump),
# sd=sd(Pump),
# se = sd/sqrt(length(Pump)),
# n())
# ht_pump_liq_plot <- ht_pump_liq_stats %>%
# ggplot(aes(Time, mean_pump)) +
# geom_line(size=1) +
# geom_point(size=1) +
# geom_errorbar(aes(ymin = mean_pump-se, ymax = mean_pump+se)) +
# xlab("Time (mins)") +
# ylab("Pumping (Hz)") +
# ylim(0,5) +
# theme(panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# text=element_text(size=12, family="sans"))
# #+ guides(col = guide_legend(title = "Dose [mM]"))
# plot_grid(ht_paralysis_plot, ht_pump_liq_plot) +
# ggsave("fig/results3/5htparalysis.pdf")
knitr::include_graphics("fig/results3/5htparalysis.png")
```
\newpage
To score the effects of compounds on 5-HT induced pumping, wild-type worms were exposed to 10 mM 5-HT. 30 minutes after, nicotine, nitenpyram, thiacloprid or clothianidin was added at the indicated concentrations, so that the worm was bathed in a solution containing both 5-HT and the drug of interest. The effect of nicotine and neonicotinoids on 5-HT stimulated pumping of paralysed worms was scored 30 minutes after the addition of nicotine or one of the neonicotinoids (Figure \@ref(fig:pumpining-liquid-label) and \@ref(fig:DR-pumping-liq-label)). Nicotine at concentrations ranging from 0.1 to 50 mM inhibited pumping with the EC~50~ of 1.7 mM. Concentration dependent inhibition was also caused by the incubation with nitenpyram. The estimated EC~50~ was 72.9 mM. Neither thiacloprid nor nitenpyram had an effect.
Incubation of *bus-17* mutant resulted in a decrease of EC~50~ of nicotine from 1.7 to 3.6 mM. A greater shift in potency of nitenpyram was noted. The EC~50~ increased from 72.9 in wild-type to 41.2 mM in a mutant strain. Estimated EC~50~ of thiacloprid was 4 mM whereas clothianidin at 2.5 mM did not significantly alter pumping.
\newpage
(ref:pumping-liquid) **The effects of nicotine and neonicotinoids on 5-HT stimulated pharyngeal pumping.** Pharyngeal pumping was stimulated by incubation of worms in 10 mM 5-HT for 30 minutes. Following, indicated concentrations of nicotine, nitenpyram, thiacloprid or clothianidin were added. The effect of nicotine and neonicotinoids on 5-HT induced pumping on N2 wild-type (left panel) and *bus-17* (right panel) was scored. Pharyngeal pumping was measured by visual observation for a period of 30 seconds and expressed in Hz. Data are mean $\pm$ SEM of 3-17 individual worms collected on $\ge$ 2 separate days. One way ANOVA (Kruskal-Wallis test) with Sidak Corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r pumpining-liquid-label, fig.cap="(ref:pumping-liquid)", fig.scap = "The effects of nicotine and neonicotinoids on 5-HT stimulated pharyngeal pumping.",fig.align='center', echo=FALSE}
# pump_liq_stat <- on_plate_dat_trans_1 %>%
# filter(exp_set=="intact")
#
# pump_liq_stat$readout <- pump_liq_stat$readout/60
#
# pump_liq_stats <- pump_liq_stat %>%
# group_by(Assay, Exp, Strain, Comp, Dose) %>%
# summarise(mean_readout=mean(readout),
# n=n(),
# sd=sd(readout),
# se=sd/sqrt(length(readout)))
#
# labels_pump_liq <- c("33" = "Nicotine N2", "34" = "Nicotine bus17", "35"= "Nitenpyram N2", "36" = "Nitenpyram bus17", "37" = "Thiacloprid N2", "38" = "Thiacloprid bus17", "39" = "Clothianidin N2", "40" = "Clothianidin bus17")
#
# ann_text_pump_liq <- data.frame(Dose = factor (c(5, 10,25, 50), levels=c("5", "10", "25", "50")), mean_readout = 4,label_pump_liq = c("****","****", "****", "****"), Exp = as.factor(33))
#
# ann_text_pump_liq_1 <- data.frame(Dose = factor (c(5, 10,25, 50), levels=c("5", "10", "25", "50")), mean_readout = 4,label_pump_liq_1 = c("**", "**", "****", "****"), Exp = as.factor(34))
#
# ann_text_pump_liq_2 <- data.frame(Dose = factor (c(25, 100), levels=c("25", "100")), mean_readout = 4,label_pump_liq_2 = c("***","****"), Exp = as.factor(35))
#
# ann_text_pump_liq_3 <- data.frame(Dose = factor (c(25, 50, 100), levels=c("25", "50", "100")), mean_readout = 4,label_pump_liq_3 = c("***","***", "****"), Exp = 36)
#
# ann_text_pump_liq_4 <- data.frame(Dose = factor (1.5), mean_readout = 4,label_pump_liq_4 = "*", Exp = 38)
#
# pump_liq__plot_nic <- pump_liq_stats %>%
# drop_na() %>%
# filter (Exp== "33" | Exp== "34") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill = Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_liq )) +
# geom_text (data = ann_text_pump_liq, aes(label = label_pump_liq)) +
# scale_fill_manual(values=c('#000000','#333333', '#666666','#999999', '#CCCCCC', '#D3D3D3', '#DCDCDC')) +
# geom_text (data = ann_text_pump_liq_1, aes(label = label_pump_liq_1)) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.title.x = element_blank()) +
# theme(axis.text = element_text(size=12),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# pump_liq__plot_nit <- pump_liq_stats %>%
# drop_na() %>%
# filter (Exp== "35" | Exp== "36") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill = Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_liq )) +
# scale_fill_manual(values=c('#000000','#003300', '#006600','#009900', '#00FF33', '#CCFF33')) +
# geom_text (data = ann_text_pump_liq_2, aes(label = label_pump_liq_2)) +
# geom_text (data = ann_text_pump_liq_3, aes(label = label_pump_liq_3)) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x = element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# pump_liq__plot_thia <- pump_liq_stats %>%
# drop_na() %>%
# filter (Exp== "37" | Exp== "38") %>%
# filter(Dose == "1.5" | Dose == "0") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill = Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# geom_text (data = ann_text_pump_liq_4, aes(label = label_pump_liq_4)) +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_liq )) +
# scale_fill_manual(values=c('#000000','#000066')) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# pump_liq__plot_clo <- pump_liq_stats %>%
# filter (Exp== "39" | Exp== "40") %>%
# filter(Dose == "2.5" | Dose == "0") %>%
# ggplot(aes(x = Dose, y= mean_readout, fill = Dose)) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# geom_bar(stat = "identity") +
# theme(legend.position="none") +
# facet_wrap(~ Exp, scale = "free", ncol = 2, labeller = labeller(Exp = labels_pump_liq )) +
# scale_fill_manual(values=c('#000000','#993300')) +
# ylim(0, 5) +
# ylab("Pumping (Hz)") +
# theme(axis.text = element_text(size=12),
# axis.title.x=element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black"),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size=12),
# text = element_text(size=12, family="sans"),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"))
# p <- plot_grid(pump_liq__plot_nic, pump_liq__plot_nit, pump_liq__plot_thia, pump_liq__plot_clo, nrow=4)
# p = p + draw_label("Concentration [mM]", x = 0.4, y = 0, hjust = 0, vjust = 0) +
# ggsave("fig/results3/nicandneonics-intact-pumping.pdf")
knitr::include_graphics("fig/results3/nicandneonics-intact-pumping.png")
```
(ref:DR-Pumping-in-liquid) **The concentration dependence for the effects of nicotine and neonicotinoids on 5-HT stimulated pharyngeal pumping.** Concentration-dependence curves for the effects of nicotine (a), nitenpyram (b), thiacloprid (c) or clothianidin (d) on 5-HT stimulated pharyngeal pumping of N2 wild-type and *bus-17* mutant *C. elegans*. Data are expressed as % control pumping and are mean $\pm$ SEM. The EC~50~ for thiacloprid is an approximation, because at the highest concentration tested (2.5 mM) it inhibited pumping by 25 % in *bus-17*.
```{r DR-pumping-liq-label, fig.cap="(ref:DR-Pumping-in-liquid)", fig.asp=1, fig.scap = "The concentration dependence for the effects of nicotine and neonicotinoids on 5-HT stimulated pharyngeal pumping.",fig.align='center', echo=FALSE, warning=FALSE}
knitr::include_graphics("fig/results3/DR-pump-intact.png")
```
<!-- ```{r N2_5HT_cuthead_timecourse_label, fig.cap="(ref:N2_5HT_timecourse)", results = "hide", echo=FALSE, message=FALSE, warning=FALSE} -->
<!-- #plot data -->
<!-- cut_head <- readRDS("Analysis/Data/Transformed/cut_head/summary_data") -->
<!-- N2_5HT_plot <- cut_head %>% -->
<!-- filter(Experiment==1) %>% -->
<!-- group_by(Time,Conc) %>% #Group data by multiple variables -->
<!-- ggplot(aes(Time, mean_readout, colour = factor(Conc, labels = c("0", "10nM ns", "100nM ***","500nM ****", "1uM ****", "10uM ****","50uM ****", "100uM ****")), group=Conc)) + #plot graph using mean -->
<!-- geom_line(size=1) + #Modify graph -->
<!-- geom_point(size=1) + -->
<!-- scale_color_manual(values=c('#000000','#330033', '#660066', '#660033', '#990099', '#CC0099', '#FF66CC', '#FF99FF')) + -->
<!-- geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) + -->
<!-- xlab("Time (mins)") + -->
<!-- ylab("Pumping (Hz)") + -->
<!-- guides(col = guide_legend(title = "[5-HT]")) + -->
<!-- ylim(0, 5) + -->
<!-- scale_x_continuous(breaks=seq(0,90,15)) + -->
<!-- geom_segment((aes(x = 1, y = 4.5, xend = 60, yend = 4.5))) + -->
<!-- theme(axis.text = element_text(size=12), -->
<!-- axis.title = element_text(size=12), -->
<!-- text = element_text(size=12)) + -->
<!-- ggsave("fig/results3/cuthead_5HT.pdf", width = 15, height = 8, units = "cm") -->
<!-- ``` -->
\newpage
### Effects on pharyngeal pumping of dissected animal
#### 5-HT
These data show that nicotine and neonicotinoids have an effect on *C. elegans* feeding at mM concentrations and that the potency of compounds on pumping slightly increases in cuticle compromised *bus-17* mutant. This supports the idea that the cuticle presents a barrier for drug entry, limiting bioavailability and hindering the exerted effect. *Bus-17* mutant presents an attractive platform for studying the effects of the cuticle on drug's potency. An important caveat is that *bus-17* cuticle, although more permeable than the wild-type, could still hinder drug entry. To circumvent this, a liquid cut-head assay was performed. In this assay, the effects of nicotine and neonicotinoids on pharyngeal pumping of dissected, rather than the intact worm was performed.
#### Nicotine and neonicotinoids ####{#dissectedanimalnicotineandneonics}
To score the effects of nicotine and neonicotinoids on the pharynx, their effects on 5-HT stimulated pharyngeal pumping was determined. First, the effects of 5-HT were investigated (Figure \@ref(fig:DR-5HT-cuthead-label) a and b). Exposure of cut-heads to 5-HT concentrations ranging from 10 nM to 100 $\mu$M resulted in dose-dependent stimulation of pharyngeal pumping. The maximal effect of effective doses was observed after 10 minutes of incubation and it typically gradually decreased for the next 50 minutes. 1 $\mu$M was the most effective and elicited a maximum average pumping response of 3.35 Hz. The EC~50~ for the effects of 5-HT on pharyngeal pumping of cut-heads was of 169 nM.
To determine whether the effects of 5-HT treatment were reversible, heads were washed for 15 minutes after indicated 5-HT treatment (Figure \@ref(fig:DR-5HT-cuthead-label) a). Full recovery of all cut heads was noted, with the exception of those exposed to the highest concentration of 5-HT. Following treatment with 100 $\mu$M, only partial recovery of pumping was observed.
\newpage
(ref:DR-5HT-cuthead) **Concentration and time dependence of the effects of 5-HT on pharyngeal pumping of dissected *C. elegans*.** a) Cut heads were exposed to varying concentrations of 5-HT, or vehicle control (0). The effects on pharyngeal pumping over time was scored by visual observation by counting the number of pharyngeal pumps in 30 seconds and the data was expressed in Hz. Data are mean $\pm$ SEM of 8 - 23 individual worms collected from experiments done on $\ge$ 3 days. Significance levels between the control and treatment are given in a figure legend and refer to 30 minute time points. One way ANOVA (Kruskal-Wallis test) with Sidak corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001. b) Dose-response curve for the effects of 5-HT on pharyngeal pumping of dissected *C. elegans*. The graph was generated by taking 30-minute time points and fitted into nonlinear regression sigmoidal dose-response (three parameter logistic) equation. Data are mean $\pm$ SEM, normalised to control and a maximum response, and expressed as % maximum pumping.
```{r DR-5HT-cuthead-label, fig.cap="(ref:DR-5HT-cuthead)", fig.asp=1, fig.scap= "Concentration and time dependence of the effects of 5-HT on pharyngeal pumping of dissected \\textit{C. elegans}", fig.align= 'center', echo=FALSE, message=FALSE, warning=FALSE}
knitr::include_graphics("fig/results3/cuthead-5ht-combined.png")
```
\newpage
To examine the effects of nicotine and neonicotinoids on pharyngeal pumping, cut heads were placed in 1 $\mu$M 5-HT for 10 minutes. 1 $\mu$M concentration was chosen because it elicits maximal pharyngeal response, whereas 10 minutes is sufficient for the response to equilibrate. Following 5-HT incubation, cut heads were transferred to a dish containing 1 $\mu$M 5-HT and an indicated concentration of nicotine, nitenpyram, thiacloprid or clothianidin and the effects of nicotine or neonicotinoids on 5-HT induced pumping was measured at multiple time point over 50 minutes. To determine if the response was reversible, cut heads were then transferred to 1 $\mu$M 5-HT and recovery scored over the period of 15 minutes (Figure \@ref(fig:N2-antagonist-timecourse-label)).
Nicotine at concentration ranging from 1 - 20 $\mu$M inhibited 5-HT induced pumping partially, whereas 100 $\mu$M incubation resulted in a complete seizure of pumping activity (Figure \@ref(fig:N2-antagonist-timecourse-label) a). The maximal effects were typically observed after 10 minutes of incubation. For some concentrations i.e. 10, 20 and 50 $\mu$M, these effects weakened with time. Generally, the inhibitory effects of nicotine were reversible. Cut heads recovered from treatment with nicotine concentrations ranging from 1 - 50 $\mu$M after 15 minutes of washing. Cut heads previously incubated with 100 $\mu$M nicotine, pumped at half a rate of the control.
5-HT stimulated pharynges were inhibited by mM concentrations of nitenpyram (Figure \@ref(fig:N2-antagonist-timecourse-label) b). The effects were observed after 10 minutes and sustained throughout the course of the experimentation. Cut heads recovered well from nitenpyram-induced inhibition and returned to control pumping rate within 15 minutes of washing.
Thiacloprid at high $\mu$M concentrations had moderate, but not significant inhibitory effect, whereas clothianidin at a single dose of 500 $\mu$M significantly inhibited 5-HT stimulated pumping (Figure \@ref(fig:N2-antagonist-timecourse-label) c and d).
To compare the relative potencies, dose-response curves for the effects of nicotine and the three neonicotinoids were plotted (Figure \@ref(fig:cuthead-dr-label)). The order of potency is: nicotine > thiacloprid > clothianidin = nitenpyram. Nicotine is almost a magnitude more potent that neonicotinoids. It inhibits pumping with the EC~50~ of 10 $\mu$M, whereas neonicotinoids act at mM low range (2-3).
<!-- ```{r N2_5HT-Nic-timecourse-label, fig.cap="(ref:N2-5HT-timecourse)",fig.align='center', echo=FALSE, results="hide", message=FALSE, warning=FALSE} -->
<!-- Nic_5HT_plot <- cut_head %>% -->
<!-- filter(Experiment == "3") %>% -->
<!-- group_by(Time, Conc) %>% #Group data by multiple variables -->
<!-- ggplot(aes(Time, mean_readout, colour = factor(Conc, labels = c("1 uM 5-HT", "Nic 100nM", "Nic 1uM *", "Nic 10uM ***", "Nic 20uM ****", "Nic 50uM ****", "Nic 100uM ****"))), group= Conc) + #plot graph using mean -->
<!-- geom_line(size=1) + #Modify graph -->
<!-- geom_point(size=1) + -->
<!-- scale_color_manual(values=c('#cc0099','#333333', '#666666','#999999', '#CCCCCC', '#D3D3D3', '#DCDCDC')) + -->
<!-- geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) + -->
<!-- ylab("Pumping (Hz)") + -->
<!-- guides(col = guide_legend(title = " ")) + -->
<!-- ylim(0, 5) + -->
<!-- geom_segment((aes(x = 1, y = 4.5, xend = 50, yend = 4.5))) + -->
<!-- theme(axis.text = element_text(size=12), -->
<!-- axis.title.x = element_blank(), -->
<!-- axis.title = element_text(size=12), -->
<!-- text = element_text(size=12, family="sans"), -->
<!-- legend.text=element_text(size=12)) -->
<!-- #plot nitenpyram data -->
<!-- Nit_5HT_plot <- cut_head %>% -->
<!-- filter(Experiment == "4") %>% -->
<!-- group_by(Time, Conc) %>% #Group data by multiple variables -->
<!-- ggplot(aes(Time, mean_readout, colour = factor(Conc, labels = c("5-HT 1uM", "Nit 100uM", "Nit 1mM", "Nit 25mM ****")), group= Conc)) + # plot graph using mean -->
<!-- geom_line(size=1) + #Modify graph -->
<!-- geom_point(size=1) + -->
<!-- scale_color_manual(values=c('#CC0099','#003300', '#006600','#009900')) + -->
<!-- geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) + -->
<!-- ylab("Pumping (Hz)") + -->
<!-- guides(col = guide_legend(title = " ")) + -->
<!-- ylim(0, 5) + -->
<!-- geom_segment((aes(x = 1, y = 4.5, xend = 50, yend = 4.5))) + -->
<!-- theme(axis.text = element_text(size=12), -->
<!-- axis.title.x = element_blank(), -->
<!-- axis.title = element_text(size=12), -->
<!-- text = element_text(size=12, family="sans"), -->
<!-- legend.text=element_text(size=12)) -->
<!-- Thia_5HT_plot <- cut_head %>% -->
<!-- filter(Experiment == "5") %>% -->
<!-- group_by(Time, Conc) %>% #Group data by multiple variables -->
<!-- ggplot(aes(Time, mean_readout, colour = factor(Conc, labels=c("5-HT ", "Thia 100uM", "Thia 250uM", "Thia 500uM")), group= Conc)) + # plot graph using mean -->
<!-- geom_line(size=1) + #Modify graph -->
<!-- geom_point(size=1) + -->
<!-- scale_color_manual(values=c('#CC0099','#000066', '#0000CC','#0000FF')) + -->
<!-- geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) + -->
<!-- ylab("Pumping (Hz)") + -->
<!-- guides(col = guide_legend(title = " ")) + -->
<!-- ylim(0, 5) + -->
<!-- geom_segment((aes(x = 1, y = 4.5, xend = 50, yend = 4.5))) + -->
<!-- theme(axis.text = element_text(size=12), -->
<!-- axis.title.x = element_blank(), -->
<!-- axis.title = element_text(size=12), -->
<!-- text = element_text(size=12, family="sans"), -->
<!-- legend.text=element_text(size=12)) -->
<!-- Clo_5HT_plot <- cut_head %>% -->
<!-- filter(Experiment == "6", Conc != 0.000001) %>% ##exclude conc = 0.000001 from the graph -->
<!-- group_by(Time, Conc) %>% -->
<!-- ggplot(aes(Time, mean_readout, colour = factor(Conc, labels = c("5-HT 1uM ", "Clo 50uM ", "Clo 500uM *", "Clo 750uM")), group= Conc)) + -->
<!-- geom_line(size=1) + -->
<!-- geom_point(size=1) + -->
<!-- scale_color_manual(values=c('#CC0099','#993300', '#996633','#CC9933')) + -->
<!-- geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) + -->
<!-- ylab("Pumping (Hz)") + -->
<!-- guides(col = guide_legend(title = " ")) + -->
<!-- ylim(0, 5) + -->
<!-- geom_segment((aes(x = 1, y = 4.5, xend = 50, yend = 4.5))) + -->
<!-- theme(axis.text = element_text(size=12), -->
<!-- axis.title.x = element_blank(), -->
<!-- text = element_text(size=12, family="sans"), -->
<!-- plot.margin = unit(c(5.5,5.5,12,5.5), "pt"), -->
<!-- legend.text=element_text(size=12)) -->
<!-- ``` -->
\newpage
(ref:N2-antagonist-timecourse) **The concentration and time dependence of the effects of nicotine and neonicotinoid on 5-HT stimulated pharyngeal pumping of dissected worm.** Pharyngeal pumping of cut heads pre- and post-exposed to 5-HT + nicotine (a), nitenpyram (b), thiacloprid (c) and clothianidin (d) or vehicle control (dashed purple line). Pharyngeal pumps were counted by visual observation for 30 seconds and expressed in Hz. Data are mean $\pm$ SEM from 3 - 34 individual worms collected on $\ge$ 3 days. Statistic analysis shown in legend refers to the 30 minute time points between 5-HT control and 5-HT + treatment. One way ANOVA (Kruskal-Wallis test) with Sidak corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r N2-antagonist-timecourse-label, fig.cap="(ref:N2-antagonist-timecourse)", echo=FALSE, fig.scap= "The concentration and time dependence of the effects of nicotine and neonicotinoid on 5-HT stimulated pharyngeal pumping of dissected worm.", fig.align='center'}
# cut_head_grid <- plot_grid(Nic_5HT_plot, Nit_5HT_plot, Thia_5HT_plot, Clo_5HT_plot, labels = c("a", "b", "c", "d"), nrow = 4)
# cut_head_grid = cut_head_grid + draw_label("Time (mins)", x=0.4, y=0, hjust=0, vjust=0) +
# ggsave("fig/results3/cuthead_antagonistic_effect.pdf")
knitr::include_graphics("fig/results3/cuthead_antagonistic_effect_modified.png")
```
\newpage
(ref:cuthead-dr1) **Dose-response curves for the effects of nicotine and neonicotinoids on 5-HT stimulated pharyngeal pumping of dissected *C. elegans*.** Concentration-dependence curves for the effects of varying concentrations of nicotine, nitenpyram, thiacloprid or clothianidin on 5-HT stimulated pharyngeal pumping of cut heads. 30 minute time-points were taken (Figure \@ref(fig:N2-antagonist-timecourse-label)) and expressed as % control (5-HT) pumping.
```{r cuthead-dr-label, fig.cap="(ref:cuthead-dr1)", fig.scap="Dose-response curves for the effects of nicotine and neonicotinoids on 5-HT stimulated pharyngeal pumping of dissected \\textit{C. elegans}", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/DR-cut-head1.png")
```
\newpage
Cut head assays provide an opportunity to determine the effects of compounds on un-stimulated pharynx. Cut heads are not mobile, hence scoring of pharyngeal activity is possible.
To score the effects of compounds on a pharynx of dissected animal, cut heads were incubated in buffer + solvent to record basal activity. Immediately after, cut heads were transferred to a dish containing an indicated concentration of nicotine, nitenpyram, thiacloprid, clothianidin or drug vehicle. The effects of treatment was scored for 1 hour and compared to the effects of 5-HT at 1 $\mu$M (Figure \@ref(fig:cuthead-agonist-label)).
Unstimulated pharynxes pump at an average rate of 0.1 Hz. Nicotine was tested at concentrations ranging from 100 nm to 100 $\mu$M (Figure \@ref(fig:cuthead-agonist-label) a). It had a dual action on the pharynx - stimulation at lower and inhibition at higher concentrations. At 10 $\mu$M it can be seen that a transient stimulation of pumping at 2 minute time point was seen. Incubation in 10 $\mu$M and 20 $\mu$M of nicotine led to weak but sustained stimulation of pumping - an effect seen at 20, 30 and 60 minute time points. 50 and 100 $\mu$M nicotine inhibited pumping completely. At these higher concentrations the muscle exhibited a visible twitching that can be described as fibrillation (data not shown). Neither nitenpyram nor thiacloprid had an effect on pharyngeal pumping of cut heads (Figure \@ref(fig:cuthead-agonist-label) b and c). In contrast, clothianidin stimulated pharynx (Figure \@ref(fig:cuthead-agonist-label) d). In response to 50 $\mu$M, an elevated pharyngeal pumping after 20 minutes was seen. whereas 500 and 750 $\mu$M of clothianidin elicited potent but short lived response. This response peaked after 2 minutes and returned to the basal rate after 10 minutes of incubation.
(ref:cuthead-agonist) **Concentration and time dependence for the effects of nicotine and neonicotinoids on pharyngeal pumping of dissected *C. elegans*.** Cut heads were exposed to varying concentrations of (a) nicotine (Nic), (b) nitenpyram (Nit), (c) thiacloprid (Thia), (d) clothianidin (Clo), 1 $\mu$M 5-HT + vehicle control or vehicle control only (Ctr). The effects of treatment on pumping were scored over time by counting the number of pharyngeal pumps in 30 seconds time windows and expressed in Hz. Data are $\pm$ SEM of 5 - 24 worms collected on $\ge$ 3 days. Significance levels between the vehicle control and treatment are given in a figure legend and refer to 30 minute time points. One way ANOVA (Kruskal-Wallis test) with Sidak corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r cuthead-agonist-label, fig.cap= "(ref:cuthead-agonist)", fig.scap = "Concentration and time dependence for the effects of nicotine and neonicotinoids on pharyngeal pumping of dissected \\textit{C. elegans}.",fig.align='center', echo=FALSE}
# Nic_plot <- cut_head %>%
# filter(Experiment == "7") %>%
# group_by(Time, Conc) %>%
# filter(Time <= 60) %>% #Group data by multiple variables
# ggplot(aes(Time, mean_readout, colour = factor(Conc, label = c("5-HT 1uM", "Ctr", "Nic 1um", "Nic 10uM", "Nic 20uM", "Nic 50uM", "Nic 100uM")), group= Conc)) + #plot graph using mean
# geom_line(size=1) + #Modify graph
# geom_point(size=1) +
# scale_color_manual(values=c('#CC0099', '#000000','#333333', '#666666','#999999', '#CCCCCC', '#D3D3D3')) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) +
# ylab("Pumping (Hz)") +
# guides(col = guide_legend(title = " ")) +
# ylim(0, 5) +
# scale_x_continuous(breaks = seq(0, 60, by=10)) +
# theme(axis.text = element_text(size=12),
# axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# Nit_plot <- cut_head %>%
# filter(Experiment == "8") %>%
# group_by(Time, Conc) %>%
# filter(Time <=60) %>% #Group data by multiple variables
# ggplot(aes(Time, mean_readout, colour = factor(Conc, label = c("5-HT 1uM", "Ctr", "Nit 100uM", "Nit 1mM", "Nit 25mM")), group= Conc)) + # plot graph using mean
# geom_line(size=1) + #Modify graph
# geom_point(size=1) +
# scale_color_manual(values=c('#CC0099', '#000000','#003300', '#006600','#009900')) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) +
# ylab("Pumping (Hz)") +
# guides(col = guide_legend(title = " ")) +
# ylim(0, 5) +
# scale_x_continuous(breaks = seq(0, 60, by=10)) +
# theme(axis.text = element_text(size=12),
# axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# Thia_plot <- cut_head %>%
# filter(Experiment == "9") %>%
# group_by(Time, Conc) %>%
# filter(Time <= 60) %>% #Group data by multiple variables
# ggplot(aes(Time, mean_readout, colour = factor(Conc, label = c("5-HT 1uM", "Ctr", "Thia 100uM", "Thia 250uM", "Thia 500uM")), group= Conc)) + # plot graph using mean
# geom_line(size=1) + #Modify graph
# geom_point(size=1) +
# scale_color_manual(values=c('#CC0099', '#000000','#000066', '#0000CC','#0000FF')) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) +
# ylab("Pumping (Hz)") +
# guides(col = guide_legend(title = " ")) +
# ylim(0, 5) +
# scale_x_continuous(breaks = seq(0, 60, by=10)) +
# theme(axis.text = element_text(size=12),
# axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans"))
#
# Clo_plot <- cut_head %>%
# filter(Experiment == "10", Conc != 0.000001) %>%
# group_by(Time, Conc) %>%
# filter(Time <= 60) %>% #Group data by multiple variables
# ggplot(aes(Time, mean_readout, colour = factor(Conc, labels = c("5-HT 1uM", "Ctr", "Clo 50uM", "Clo 500uM", "Clo 750 uM")), group= Conc)) +
# geom_line(size=1) + #Modify graph
# geom_point(size=1) +
# scale_color_manual(values=c('#CC0099', '#000000','#993300', '#996633','#CC9933')) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) +
# ylab("Pumping (Hz)") +
# guides(col = guide_legend(title = " ")) +
# ylim(0, 5) +
# scale_x_continuous(breaks = seq(0, 60, by=10)) +
# theme(axis.text = element_text(size=12),
# axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# plot.margin = unit(c(5.5,5.5,12,5.5), "pt"),
# text = element_text(size=12, family="sans"))
#
# cut_head_grid2 <- plot_grid(Nic_plot, Nit_plot, Thia_plot, Clo_plot, labels=c("a ", "b ", "c ", "d"), nrow=4)
# cut_head_grid2 = cut_head_grid2 + draw_label("Time (mins)",x=0.4, y=0, hjust=0, vjust=0) +
# ggsave("fig/results3/cuthead_agonistic_effect.pdf")
knitr::include_graphics("fig/results3/cuthead_agonistic_effect_modified.png")
```
\newpage
To determine the onset of clothianidin induced stimulation of pumping, the experiment was repeated but the measurements were taken every minute for the first 5 minutes and at 10- minute time points (Figure \@ref(fig:clo-opt-cuthead-label)). 500 and 750 $\mu$M clothianidin stimulated pumping with the onset of action at 1 minute. After 1 minute these effects began to gradually weaken.
\newpage
(ref:clo-opt-cuthead) **The onset kinetics of clothianidin induced stimulation of pharyngeal pumping of dissected *C. elegans*.** Cut heads were exposed to varying concentrations of clothianidin (Clo), 1 $\mu$M 5-HT + solvent or solvent (Ctr). The effects on pumping were scored over time by counting the number of pharyngeal pumps over a 30 second time window. Data are expressed in Hz and are mean $\pm$ SEM of 7-13 individual worms collected on $\ge$ 3 days. Significance levels between the solvent control and treatment are given in a figure legend and refer to 2 minute time points. One way ANOVA (Kruskal-Wallis test) with Sidak corrections, $**$P $\le$ 0.01, $****$P $\le$ 0.0001.
```{r clo-opt-cuthead-label, fig.cap="(ref:clo-opt-cuthead)", fig.scap = "The onset kinetics of clothianidin induced stimulation of pharyngeal pumping of dissected \\textit{C. elegans}.",fig.align='center', echo=FALSE}
# Clo_opt_plot <- cut_head %>%
# filter(Experiment == "11", Time <= 10) %>%
# group_by(Time, Conc) %>% #Group data by multiple variables
# ggplot(aes(Time, mean_readout, colour = factor(Conc, labels = c("5-HT 1uM **", "Ctr", "Clo 1uM", "Clo 50uM", "Clo 500uM", "Clo 750 uM ****")), group= Conc)) +
# geom_line(size=1) + #Modify graph
# geom_point(size=2) +
# scale_color_manual(values=c('#CC0099', '#000000', '#993300', '#996633','#CC9933', '#FFCC33')) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) +
# xlab("Time (mins)") +
# ylab("Pumping (Hz)") +
# guides(col = guide_legend(title = " ")) +
# ylim(0, 5) +
# scale_x_continuous(breaks = seq(0, 10, by = 2)) +
# theme(text=element_text(size=12, family="sans"),
# panel.grid.major = element_blank(),
# panel.grid.minor = element_blank(),
# panel.background = element_blank(),
# axis.line = element_line(colour = "black")) +
# ggsave("fig/results3/raw-images/clo_opt_image.pdf")
knitr::include_graphics("fig/results3/clo_opt_image.png")
```
\newpage
### Effects of 5-HT, nicotine and neonicotinoids on pharyngeal pumping in animals deficient in nAChR subunits ###{#nachrutantfeeding}
An investigation into the potential targets of action of 5-HT, nicotine and neonicotinoids on the pharynx were made. *C. elegans* *eat-2* and *acr-7* nAChR mutants were investigated. Both genes are expressed in the pharynx and have been implicated in the pharyngeal function. Wild-type and mutant worms were placed on agar plate containing a food patch and the pharyngeal pumping rate of those present on food was scored (Figure \@ref(fig:mutant-pumping-label)). Pumping of the *acr-7* mutant was comparable to that of the wild-type strain. In contrast, pumping of the *eat-2* mutant was 70% lower than that of the wild-type.
(ref:mutant-pumping) **Pharyngeal pumping of *C. elegans* nicotinic acetylcholine receptor mutants.** Pharyngeal pumping on food of N2 wild-type, eat-2 and acr-7 mutants. Pharyngeal pumps of worms present on food were counted by visual observation by counting the number of pharyngeal pumps in 30 seconds and expressed in Hz. Data are mean $\pm$ SEM, collected from $\ge$ 11 individual worms on $\ge$ 3 days. One way ANOVA (Kruskal-Wallis test) with Sidak Corrections, $****$ P $\le$ 0.0001.
```{r mutant-pumping-label, fig.cap="(ref:mutant-pumping) ", fig.scap = "Pharyngeal pumping of \\textit{C. elegans} nicotinic acetylcholine receptor mutants.",fig.align='center', echo=FALSE, warning=FALSE, message=FALSE}
mutant_pumping <- read_csv("Analysis/Data/Transformed/pumping_on_food")
trans_mutant_pumping <- mutant_pumping %>%
mutate(Strain = factor(Strain,
levels= c("N2", "eat-2", "acr-7", "N2::pmyo3::GFP", "N2::pmyo3::GFP_pmyo2::CHRNA7", "eat2-2::pmyo3::GFP", "eat-2::pmyo3::GFP_pmyo2::CHRNA7", "eat-2::pmyo3::GFP_pmyo2::CHRNA7_2", "eat-2::pmyo3::GFP_pmyo2::CHRNA7_3")))
trans_mutant_pumping$Pumpsmin <- trans_mutant_pumping$Pumpsmin/30
mutant_pumping_stats <- trans_mutant_pumping %>%
group_by(Strain) %>%
summarise(mean_pumping = mean(Pumpsmin),
sd = sd (Pumpsmin),
se = sd/sqrt(length(Pumpsmin))) #select all columns from rows 1 to 3
ann_text_mutant_pump <-data.frame(Strain = factor("eat-2"), levels = ("eat-2"),
mean_pumping = 4.5,
lab_mutant_pump = ("****"))
mutant_pumping_plot <- mutant_pumping_stats %>%
"["(., 1:3,) %>%
ggplot(aes(x=Strain, y=mean_pumping)) +
geom_bar(stat = "identity", fill= "grey" ) +
geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) +
geom_text(data = ann_text_mutant_pump, aes(label = lab_mutant_pump)) +
ylab("Pumping (HZ)") +
ylim(0, 5) +
theme(axis.title.x = element_blank(),
panel.background = element_blank(),
axis.line = element_line(colour = "black"),
axis.title = element_text(size=12),
axis.text = element_text(size=12)) +
ggsave("fig/results3/pumpingmutant.pdf")
knitr::include_graphics("fig/results3/pumpingmutant.png")
```
Further experiments were carried out to determine whether pharyngeal responses induced by 5-HT, nicotine and neonicotinoids are dependent on the expression of the EAT-2 nAChR. Cut heads of wild-type and *eat-2* mutant worms were exposed to 5-HT, nicotine, nitenpyram, thiacloprid and clothianidin. The effects of treatment on pharyngeal pumping of mutant strain was scored and compared to the wild-type.
The effects of 5-HT concentrations ranging from 10 nM to 100 $\mu$M elicited dose-dependent stimulatory response in wild-type worm (Figure \@ref(fig:DR-5HT-cuthead-2-label) a). The maximum rate of 3.5 Hz was achieved by 1 $\mu$M 5-HT after 10 minutes of incubation. 5-HT also stimulated pumping of *eat-2* mutant, but the responses were much weaker (Figure \@ref(fig:DR-5HT-cuthead-2-label) b). The maximum rate of 0.78 Hz was achieved by 50 $\mu$M 5-HT after 60 minutes of incubation. To compare the effects of 5-HT on mutant to the effects elicited on the wild-type cut heads, data were plotted on dose-response curve (Figure \@ref(fig:DR-5HT-cuthead-3-label)). The efficacy of 5-HT on the pharyngeal pumping of *eat-2* mutant was markedly reduced. The maximum response achieved by 5-HT was 55 % lower in comparison to the wild-type. The potency was also reduced as reflected in the shift of the EC~50~ from 155 nM in wild-type to 104 $\mu$M in a mutant strain.
(ref:DR-5HT-cuthead-2) **Concentration and time dependence of the effects of 5-HT on pharyngeal pumping of dissected wild-type and *eat-2 C. elegans*.** a) Wild-type (N2) and mutant *eat-2* cut heads were exposed to varying concentrations of 5-HT, or vehicle control (0). The effects on pharyngeal pumping over time was scored by visual observation by counting the number of pharyngeal pumps in 30 seconds and expressed in Hz. Data are mean $\pm$ SEM of 8 - 23 individual worms collected from paired experiments done on $\ge$ 3 days. Significance levels between the control and treatment are given in a figure legend and refer to 30 minute time points. One way ANOVA (Kruskal-Wallis test) with Sidak corrections, $*$P $\le$ 0.05, $**$P $\le$ 0.01, $***$P $\le$ 0.001, $****$P $\le$ 0.0001.
```{r DR-5HT-cuthead-2-label, fig.cap="(ref:DR-5HT-cuthead-2)", fig.scap = "Concentration and time dependence of the effects of 5-HT on pharyngeal pumping of dissected wild-type and \\textit{eat-2 C. elegans}.", fig.align='center', echo=FALSE}
# eat2_cuthead <- cut_head %>%
# filter(Experiment ==2) %>%
# group_by(Time, Conc) %>%
# ggplot(aes(x= Time, y= mean_readout, colour = factor(Conc, labels = c("0", "10nM", "100nM ","500nM", "1uM", "10uM","50uM", "100uM")), group=Conc)) +
# geom_line(size=1) +
# geom_point(size=1) +
# scale_color_manual(values=c('#000000','#330033', '#660066', '#660033', '#990099', '#CC0099', '#FF66CC', '#FF99FF')) +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se)) +
# ylab("Pumping (Hz)") +
# guides(col = guide_legend(title = " ")) +
# ylim(0, 5) +
# scale_x_continuous(breaks=seq(0,90,15)) +
# geom_segment((aes(x = 1, y = 4.5, xend = 60, yend = 4.5))) +
# theme(axis.text = element_text(size=12),
# axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# text = element_text(size=12, family="sans"),
# legend.text=element_text(size=12)) +
# ggsave("fig/results3/cuthead_5HT_eat2.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results3/eat2-5ht.png")
```
(ref:DR-5HT-cuthead-3) **Dose-response curves for the effects of 5-HT on pharyngeal pumping of N2 and *eat-2* cut heads.** The graphs were generated by taking 30-minute time points (Figure \@ref(fig:DR-5HT-cuthead-2-label)). Data are mean $\pm$ SEM, normalised to control and a maximum response elicited on N2 strain, expressed as a % maximum pumping.
```{r DR-5HT-cuthead-3-label, fig.cap="(ref:DR-5HT-cuthead-3)", fig.scap = "Dose-response curves for the effects of 5-HT on pharyngeal pumping of N2 and \\textit{eat-2} cut heads.", fig.align='center', echo=FALSE, warning=FALSE, message=FALSE}
knitr::include_graphics("fig/results3/DR-5HT-cuthead-n2+EAT-2.png")
```
\newpage
The investigations into the direct effects of nicotine, nitenpyram, thiacloprid and clothianidin on *eat-2* cut-head pumping were carried out in visual observation experiments. These data were compared to the effects induced on the cut heads of wild-type animals (Figure \@ref(fig:cuthead-eat2-dr-label)).
Nicotine stimulated wild-type pharynx at 10 and 20 $\mu$M. At 50, 100 $\mu$M and 1 mM it inhibited pumping. Nicotine stimulated pumping of *eat-2* mutant at concentrations ranging from 10 - 100 $\mu$M. A dose of 1 mM was required to observe pumping inhibition. Nitenpyram at 100 $\mu$M to 100 mM was with no effect on either of the strains (Figure \@ref(fig:cuthead-eat2-dr-label) b).
Thiacloprid at 250 and 500 $\mu$M stimulated pumping of both wild-type and *eat-2* strains (Figure \@ref(fig:cuthead-eat2-dr-label) c). However, a greater stimulation of *eat-2* by thiacloprid at 250 $\mu$M was observed in comparison to the wild-type. Clothianidin had a stimulatory effects on the wild-type worm. This was also observed in the mutant (Figure \@ref(fig:cuthead-eat2-dr-label) c).
(ref:cuthead-eat2-dr) **The effects of the *eat-2* mutation on the concentration dependence of nicotine and neonicotinoid-induced pharyngeal pumping responses.** N2 wild-type and *eat-2* mutant cut heads were exposed to varying concentrations of a) nicotine, b) nitenpyram, c) thiacloprid and d) clothianidin. The number of pharyngeal pumps over 30 s at 60 minute for nicotine, nitenpyram and thiacloprid or 2 minute time-points for clothianidin were taken (Figure \@ref(fig:N2-antagonist-timecourse-label)) and expressed in Hz. Data are mean $\pm$ SEM of 5-25 individual worms collected from paired experiments done on $\ge$ 3 days. For comparison, the maximum pumping achieved by 5-HT is shown in dashed line.
```{r cuthead-eat2-dr-label, fig.cap="(ref:cuthead-eat2-dr)", fig.scap = "The effects of the \\textit{eat-2} mutation on the concentration dependence of nicotine and neonicotinoid-induced pharygeal pumping responses.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/cuthead_DR_eat2.png")
```
<!-- (ref:cuthead-dr1) Concentration dependence for the effects of nicotine and neonicotinoids on pharyngeal pumping of dissected *C. elegans*. The effects of varying concentrations of a) nicotine, b) nitenpyram, c) thiacloprid or d) clothianidin on pumping of cut heads. 60 minute for nicotine, nitenpyram and thiacloprid or 2 minute time-points were taken (Figure \@ref(fig:N2-antagonist-timecourse-label)) and expressed as % control (5-HT) pumping, with the exception of graph in a. For nicotine, the response was normalised to the 5-HT pumping and the minimal pumping response achieved by nicotine. Data are mean $\pm$ SEM. -->
<!-- ```{r (ref:cuthead-dr1)-label, fig.cap="(ref:cuthead-dr1)", echo=FALSE} -->
<!-- knitr::include_graphics("fig/results3/cuthead-n2-agonist-dr.png") -->
<!-- ``` -->
\newpage
## Discussion
In this chapter, the effects of nicotine and neonicotinoids on pharyngeal pumping of intact and dissected, cut-head *C. elegans* are described. Pharyngeal pumping was assayed by visually scoring the frequency of pharyngeal pumps. These investigations were carried out to further investigate the toxicity of nicotine and neonicotinoids on worms, and to explore the role of the worm's cuticle on drug susceptibility.
## 5-HT induces fast pumping in *C.elegans* by the activation of EAT-2 containing nAChRs
Application of 5-HT on cut-head preparation elevated pumping from 0.17 Hz to 3.34 Hz with the EC~50~ of 169 nM (Table \@ref(tab:pharynx-summary)).These data suggest that 5-HT drives a feeding response in worms. The maximum pumping frequency achieved by the exogenous 5-HT is comparable to the pharyngeal pumping rate of the worm in the presence of food (3.34 Hz and 4.33 Hz, respectively). Pumping rate on food of a mutant with defective 5-HT biosynthesis pathway is markedly reduced [@sze2000]. Endogenous 5-HT is released from NSM and ADF neurons in response to the presence of food. It then acts on MC and M4 neurons [@raizen1995; @niacaris2003] to increase pumping frequency and on M3 neurons [@song2013; @niacaris2003] to reduce the pumping latency. Application of 5-HT bypasses the sensory pathway to activate MC, M4 and M3 neurons directly by acting on GPCRs [@hobson2003; @song2013].
To provide an insight into the mechanism of 5-HT induced *C. elegans* responses, the effects of 5-HT on pharyngeal pumping of cut head *eat-2* nAChR mutant were performed and compared to the wild-type. The maximum response achieved by a 5-HT was reduced by 70 %, whereas the EC~50~ increased from 169 nM in wild-type to 150 $\mu$M in a mutant (Table \@ref(tab:pharynx-summary)). This relative 5-HT insensitivity of *eat-2* strain suggests 5-HT induces pumping by eliciting cholinergic neurotranmission via EAT-2 containing nAChRs. 5-HT acts on cholinergic MC and M4 motorneurons to stimulate ACh release. ACh binds to EAT-2 nAChRs expressed at the MC NMJ to stimulate pumping [@mckay2004]. Hence 5-HT evokes pharyngeal activity by indirectly activating EAT-2 containing nAChRs.
## Cuticle limits efficacy of nicotine and neonicotinoids on *C. elegans* pharynx
To investigate the role of the cuticle in susceptibility of worms to neonicotinoids, experiments were carried out on intact worm of two strains: wild-type and *bus-17* mutant. *Bus-17* strain has altered surface coat [@gravato-nobre2005] and reduced cuticle integrity [@yook2007]. The pharynx was stimulated with 5-HT and the effects of nicotine and neonicotinoids on 5-HT induced pumping were examined (Figure \@ref(fig:cuticle-pumping-label)). Nicotine and nitenpyram inhibited 5-HT evoked pharyngeal pumping at mM concentrations. The efficacy of nicotine as measured by EC~50~ was comparable on both strains: 2 and 3 mM on wild-type and mutant strain, respectively. In contrast, the EC~50~ of nitenpyram increased from 73 in wild-type to 42 mM in a mutant strain. Further experiments were performed in which the cuticular barrier was removed and the effects of compounds on 5-HT stimulated pumping of dissected, cut-head wild-type *C. elegans* were investigated (Figure \@ref(fig:cuticle-pumping-label)). Nicotine inhibited pumping with the EC~50~ of 10 $\mu$M, whereas the EC~50~ of nitenpyram was 3 mM. By comparing this to the intact worm data, it can be seen that the removal of the cuticle resulted in a 300 and 24-fold increase in efficacy of nicotine and nitenpyram on the 5-HT evoked pumping of wild-type worm, respectively. Due to poor solubility, testable concentrations of clothianidin and thiacloprid were limited. In the presence of high $\mu$M - low mM concentrations of thiacloprid or clothianidin, the 5-HT evoked pumping of intact and cut head worm was slightly reduced. No full dose-response curves were obtained, however, there is a trend towards left shift of partial dose-response curves (Figure \@ref(fig:cuticle-pumping-label)) for both compounds. Taken together this suggested that the cuticular structures are limiting the access of nicotine and nitenpyram to the receptors of the pharyngeal system of *C. elegans*. The greater decrease of EC~50~ for nicotine versus nitenpyram might suggest better permeability of the latter, possibly due to its higher hydrophobicity (Table \@ref(tab:properties)).
(ref:cuticle-pumping) **The effects of the cuticle on nicotine and neonicotinoid - induced inhibition of 5-HT induced pumping.**
```{r cuticle-pumping-label, fig.cap="(ref:cuticle-pumping)", fig.scap = "The effects of the cuticle on nicotine and neoncotinoid- induced inhibition of 5-HT induced pumping.", fig.align='center', echo = FALSE}
knitr::include_graphics("fig/results3/DR of inhibition of 5-HT stimulated pumping.png")
``` ```
## Differential effects of nicotine and neonicotinoids on the pharynx
To further characterise the effects of compounds on the pharyngeal pumping, nicotine and neonicotinoids were applied on unstimulated wild-type *C. elegans* cut-head (Table \@ref(tab:pharynx-summary)). Differential effects of nicotine and neonicotinoids are noted.
Nicotine had a concentration dependent effect: a moderate stimulation by 10 and 20 $\mu$M and an inhibition of pumping activity by 50 and 100 $\mu$M.
Scoring the effects of clothianidin on pharyngeal pumping revealed potent but transient effect at high $\mu$M concentrations. The maximum stimulatory effect was observed after 2 minutes of incubation and declined progressively to the basal pumping rate within 10 minutes.
Thiacloprid at high $\mu$M concentrations moderately stimulated pumping. This effect was sustained throughout the duration of the assay (1 hour). Nitenpyram at doses up to 100 mM had no effect on pharyngeal activity.
The differences in the pharyngeal effect achieved by nicotine and neonicotinoids could be due to targeting different receptors proteins. To investigate this further, the effects of nicotine and neonicotinoids on pharyngeal pumping of nAChR subunit mutant were investigated. Compounds were applied on cut heads of *eat-2* *C. elegans* mutant and wild-type. Pharyngeal pumping was scored visually after 30 minutes of exposure (Table \@ref(tab:pharynx-summary)). Different responses at 50 and 100 $\mu$M nicotine were noted. A stimulation of pumping occurred in the mutant, whereas pumping was inhibited in wild-type worms. Clothianidin at 250, 500 and 750 $\mu$M stimulated pumping of both strains. A difference at a single concentrations of thiacloprid was noted. At 250 $\mu$M thiacloprid moderately elevated pumping of *eat-2*, but it had no effect on the wild-type. However, there was no difference at 100 and 500 $\mu$M. Nitenpyram was with no effect on either strain. Taken together, these data suggests that EAT-2 may be involved in the pharyngeal responses to nicotine, but there are likely other receptors involved too, whereas neonicotinoids act on receptors other than EAT-2.
Differential pharyngeal responses to nicotine and neonicotinoids suggest they have different mode of action in the *C. elegans* pharynx.
This suggests the existence of multiple types of nAChRs with distinct pharmacology with regards to neonicotinoids.
## Neonicotinoids may target different receptor protein in *C. elegans* pharynx
Neonicotinoids may have a differential mode of action on *C. elegans* pharynx. Clothianidin and thiacloprid have distinct stimulatory effects on pumping. Clothianidin induced transient, whereas thiacloprid induced sustained stimulation. In contrast, nitenpyram has no effect. Differential effects of neonicotinoids on animal behaviour was also observed in bumblebee [@moffat2016], honey and wild-bee [@woodcock2017] and could be underpinned by the differences in targeted receptors. Indeed, imidacloprid and clothianidin target distinct nAChRs in the honey bee mushroom body [@moffat2016] and in cochroach neuronal preparation [@thany2009].
## Alternative sites for the action of nicotine and neonicotinoids
What are the alternative molecular sites for nicotine and neonicotinoids in worms? The response to nicotine does not depend on pharyngeal neurons [@raizen1995] suggesting nicotine acts directly on the muscle and/or on somatic nervous system. Behavioural and genetic analysis suggests nicotine can act on nAChRs other than EAT-2. The response to food in *lev-8* [@towers2005] mutant is reduced, making LEV-8 a potential target. Nicotine could also act on somatic nervous system, for example on IL1 and/or IL2 labial sensory neurons. IL2 are cholinergic [@pereira2015] and express nAChR DES-2 subunit [@treinin1998]. IL1 neurons are involved in mechanosensation, they express ACR-2 nAChR subunits [@Nurrish1999; @Hallam2000]. Both IL1 and IL2 output onto pharyngeal RIP neurons [@albertson1976; @serrano-saiz2013] which are a point where extrapharyngeal and pharyngeal nervous system connect [@albertson1976].
Nicotine can also bind to receptors other than nAChRs, such as TRPV channels [@Liu2004; @Talavera2009; @feng2006]. TRPV channels are expressed on IL1 neurons [@Kindt2007], however effective nicotine doses are higher than those used in this study (i.e. typically $\ge$ 100 $\mu$M [@Liu2004; @Talavera2009].
## Relative insensitivity of *C. elegans* to neonicotinoids
Concentrations of neonicotinoids effective against *C. elegans* feeding, are at least several fold higher than those effective against the feeding of insects. Clothianidin and thiacloprid stimulated pharyngeal pumping at high $\mu$M concentrations. In insects, they impair on feeding at sub $\mu$M concentrations. Imidacloprid inhibits feeding of mayflies [@alexander2007], thiamethoxam impairs on the feeding of bumble bees and some species of wild-bees [@baron2017]. This supports results from the previous chapter that at field realistic concentrations, neonicotinoids have no impact on tested *C. elegans* behaviours.
## Pharyngeal nAChRs have low sensitivity to neonicotinoids
The low potency of neonicotinoids on the pharynx in cut-head preparation suggest pharyngeal *C. elegans* nAChRs have low sensitivity to neonicotinoids relative to insects. Electrophysiological recordings from insect neuronal preparations show the effects of neonicotinoids at sub $\mu$M doses [@thany2009; @moffat2016; @tan2008; @buckingham1997]. In this study, a dose of at least 250 $\mu$M was required to observe an effect. Therefore, there is at least several fold difference in the susceptibility to neonicotinoids between the worm and insects. This suggests *C. elegans* nAChRs are pharmacologically distinct from those found in insects.
<!-- Divergency of insect and worm nAChRs is supported by the low homology of amino-acid sequence similarities. The highest between the worm and bee is less than 40 %. -->
Table: (\#tab:pharynx-summary) Summary of the effects of compound on the pharyngeal pumping of *C. elegans* wild-type (N2) and nAChR mutant *eat-2*.
+------------+--------------------------------+-----------------------------------+
| |N2 |eat-2 |
+============+================================+===================================+
|5-HT |1. Dose dependent and sustained |1. Dose dependent and sustained |
| |stimulation |stimulation |
| |2. Maximum pumping 3.34 Hz |2. Maximum pumping 0.87 Hz |
| |3. EC~50~=169nM |3. EC~50~=150 $\mu$M |
+------------+--------------------------------+-----------------------------------+
|Nicotine |1. Sustained stimulation by |1. Sustained stimulation by |
| |10 and 20 $\mu$M |concentrations ranging from 10 |
| | |100 $\mu$M |
| |2. Inhibition by concentrations |2. Inhibition by 1 mM |
| |from 50 $\mu$M to 1 mM | |
+------------+--------------------------------+-----------------------------------+
|Nitenpyram |1. No effects at 0.1-100mM |As N2 |
+------------+--------------------------------+-----------------------------------+
|Thiacloprid |1. Weak stimulation |1. Weak stimulation by 250 |
| |by 500 $\mu$M |and 500 $\mu$M |
+------------+--------------------------------+-----------------------------------+
|Clothianidin|1. Weak and sustained | As N2 |
| |stimulation by 50 $\mu$M | |
| |2. Potent, dose-dependent | |
| |and transient stimulation by | |
| |500 and 750 $\mu$M | |
| |3. Onset at 2 minutes | |
+------------+--------------------------------+-----------------------------------+
<!-- --------------------------------------------------------------------------------- -->
<!-- Pump frequency -->
<!-- ------------- -------------- ---------------- --------------- ------ ------------- -->
<!-- Visual observation EPG EPG waveform -->
<!-- ------------- -------------- ---------------- --------------- ------ ------------- -->
<!-- Compound N2 eat-2 N2 eat-2 N2 -->
<!-- ------------- -------------- ---------------- --------------- ------ ------------- -->
<!-- 5-HT Dose dependent Dose dependent Dose dependent NA Reduced -->
<!-- stimulation stimulation stimulation pump -->
<!-- EC~50~=169nM EC~50~=150$\mu$ EC~50~=255$\mu$ duration -->
<!-- Nicotine Sustained Sustained Sustained As N2 - -->
<!-- stimulation stimulation stimulation by -->
<!-- by 10 by 10-100 $\mu$M 1 $\mu$M -->
<!-- and 20 $\mu$M Inhibition by Potent -->
<!-- Inhibition at 1mM stimulation -->
<!-- $\ge$ 50$\mu$M followed by -->
<!-- inhibition by -->
<!-- $\ge$ 10$\mu$M -->
<!-- Nitenpyram No effects at As N2 No effects at NA No effect -->
<!-- 0.1-100mM 0.1mM NA at 0.1mM -->
<!-- Thiacloprid Moderate Moderate No effect at NA No effect -->
<!-- stimulation by stimulation by 50$\mu$M at -->
<!-- 500$\mu$M 250 50$\mu$M -->
<!-- and 500$\mu$M -->
<!-- Clothianidin Moderate As N2 Moderate NA Reduced -->
<!-- and sustained and sustained pump -->
<!-- elevation by elevation by duration -->
<!-- 50$\mu$ 75$\mu$ Decresed -->
<!-- Potent and E/R ratio -->
<!-- brief -->
<!-- stimulation by -->
<!-- 500 -->
<!-- and 750$\mu$M -->
<!-- ---------------------------------------------------------------------------------- -->
05-discussion.Rmd deleted 100644 → 0
View file @ d2dbc0ac
# Discussion {#discussion}
Discussion chapter.
\ No newline at end of file
05-results-03.Rmd 0 → 100644
View file @ e74fe8cf
# Pharmacological characterisation of the *C. elegans* pharynx {#results-3}
## Introduction
The previous chapter (Chapter 4) describes the effects of nicotine, 5-HT and neonicotinoids on pharyngeal pumping of the "cut-head worm". An alternative pharyngeal assay is an extracellular recording of the electrical action of the pharynx. This is a electropharyngeogram (EPG). Unlike scoring pharyngeal pumping by visual observation, EPG recordings allow for more detailed temporal resolution. Additionally, investigations into drug-induced changes of the EPG waveform may inform on the potential mode of action of compounds.
In an EPG assay, a worm's head is placed in a recording chamber. A tight seal between the electrode and the tip of the *C. elegans* nose is made. Contracting pharyngeal muscle produces currents which flows out of the worm's mouth; this is detected by the electrode. Each cycle of contraction and relaxation gives rise to a characteristic waveform. There are several different phases constituting an individual EPG (Figure \@ref(fig:example-epg-label)). The beginning of the EPG signal marks excitatory phase. This phase mirrors depolarisation and contraction of the corpus and the terminal bulb and constitutes from 2 spikes. Excitatory e spike arises due to the release of ACh from MC neurons and an activation of of nAChRs [@raizen1995]. Excitatory E peak is due to a subsequent calcium channels activation [@lee1997; @shtonda2005]. e is often unseen on the EPG trace due to merging with the larger E. I or inhibitory spikes are diverse in number and amplitude and arise as a result of the inhibitory currents. These currents are produced by ligand-gated chloride channels in response to glutamate release from M3 neurons [@dent1997; @li1997]. Lastly, R and r reflect relaxation of the corpus and the terminal bulb, due to a repolarisation of the terminal bulb muscle cells caused by the flow of potassium through the potassium ion channel [@shtonda2005]. r spikes are frequently merged with larger in amplitude R.
<!-- Simultaneous video and EPG recording of the pharynx revealed that the electrical transients correspond with the motion of a particular section of the pharynx. E phase corresponds to the contraction, whereas the R phase to the relaxation of the pharynx [@raizen1994]. p and I no visual consequences, whereas R mirrors corpus relaxation and r terminal bulb relaxation [@raizen1994]. -->
The shape and amplitude of a single EPG varies between worms even of the same genetic make-up. Therefore caution should be taken when the effects of drugs on EPG characteristics are made. Typically, three parameters are quantified: the frequency of EPGs (in Hz), the duration of a a single pump (measured by a time distance between E and R spike) and E/R ratio. E and R spikes are present on each EPG waveform, therefore they can be used to quantify mentioned parameters [@dillon2009].
(ref:example-epg) **Electropharyngeogram (EPG) of *C. elegans* pharynx.** A single pharyngeal activity recorded extracellularly from the wild-type cut head of *C. elegans*. E peaks arise due to contraction, whereas I and R peaks due to relaxation of the pharynx [@dillon2009].
```{r example-epg-label, fig.cap="(ref:example-epg)", fig.scap = "Electropharyngeogram (EPG) of \\textit{C. elegans} pharynx.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/basa-epg-individual.png")
```
## Chapter aims
In this chapter, the effects of 5-HT and the cholinergic compounds on EPG are investigated. These results are compared to the effects elicited by nicotine and neonicotinoids to further inform on what is their mode of action.
## Results
```{r echo=FALSE, results="hide", include=FALSE}
library(grid)
library(cowplot)
library(tidyverse)
library(ggpubr)
library(readr)
library(ggplot2)
library(scales)
library(curl)
library(devtools)
library(extrafont)
library(magick)
```
To assess the effects of exogenous drug application on the pharynx an EPG - an extracellular recordings - from the *C. elegans* pharynx in cut head preparation were made. The pharynx was perfused for 5 minutes in Dent's saline to record basal pumping rate, for 5 minutes in the drug treatment to record changes in the spontaneous pharyngeal activity due to drug application and again for 5 minutes in Dent's saline to determine if the pharynx recovers from drug-induced changes in pumping.
<!-- ```{r echo=FALSE, fig.width=10, include=FALSE} -->
<!-- EPG_5ht <- magick::image_read("fig/results3/5ht_epg.png") -->
<!-- EPG_5ht1 <- ggdraw() + draw_image("fig/results3/5ht_epg.png") -->
<!-- ``` -->
<!-- ```{r include=FALSE, echo=FALSE} -->
<!-- #read in EPG data -->
<!-- EPG_data <- readRDS("Analysis/Data/Transformed/EPG/summarydata") -->
<!-- EPG_5HT <- EPG_data %>% -->
<!-- filter(Experiment==1) -->
<!-- #create new variable dose which will contain doses as character -->
<!-- EPG_5HT_1 <- EPG_5HT %>% -->
<!-- mutate (Dose = factor(Conc, -->
<!-- levels = c("1e-11", "1e-09", "1e-08", "1e-07", "5e-07", "1e-06", "1e-05"), -->
<!-- labels = c("Ctr", "1nM", "10nM", "100nM", "500nM", "1uM", "10uM"))) -->
<!-- #plot 5HT data -->
<!-- EPG_5HT_plot <- EPG_5HT_1 %>% -->
<!-- group_by(Dose) %>% -->
<!-- ggplot(aes(x = Dose, -->
<!-- y = mean_readout, fill = Dose)) + -->
<!-- geom_bar(stat = "identity") + -->
<!-- geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) + -->
<!-- scale_fill_manual(values=c('#000000','#330033', '#660066', '#660033', '#990099', '#CC0099', '#FF66CC')) + -->
<!-- ylab("peak response") + -->
<!-- ylim(0, 5) + -->
<!-- theme(text=element_text(size=12, family="sans"), -->
<!-- legend.position = "none") + -->
<!-- ggsave("fig/results3/figure-test.pdf", width = 9, height = 10, units = "cm") -->
<!-- ``` -->
### Effects of 5-HT
Application of 5-HT concentrations ranging from 1 nM to 10 $\mu$M led to dose dependent stimulation of the pharyngeal pumping, sustained throughout the 5-minute perfusion (Figure \@ref(fig:epg-5ht-label)). The maximum response achieved was 4.4 Hz by 10 $\mu$M. The EC~50~ was 255 nM. Washing the pharynx for 5 minutes was sufficient to observe recovery from the 5-HT induced stimulation of pumping.
To determine whether 5-HT had an effect on the shape of an EPG, individual EPG waveforms were examined closely (Figure \@ref(fig:5ht-epg-ind-label)a). A visible decrease in duration of the pump in response to 5-HT was noted. To quantify this, the pump duration of EPGs during the basal and treatment recording as well as after 5 minute wash were measured (Figure \@ref(fig:5ht-epg-ind-label)). The direct measurements were made by quantifying the time taken from E to R peak. 1 $\mu$M 5-HT reduced the latency by 27 %. This effect was reversible and returned to basal duration after 5 minutes of washing.
(ref:epg-5ht) **The concentration dependence for the effects of 5-HT on the EPG frequency.** *C. elegans* cut heads were perfused with Dent's saline and 5-HT at indicated concentrations. The effects of varying concentrations of 5-HT on pharyngeal pumping was scored by extracting peak response in a 10 second window. Data are mean $\pm$ SEM from 3-6 individual worms collected on $\ge$ 2 days. b) Dose-response curve for the effects of 5-HT on the pharynx. Responses are normalised to basal pumping rate and expressed as a % maximum response. c) Example EPG recording showing basal activity, stimulated activity upon perfusion with 1 $\mu$M of 5-HT and recovery post 5-HT exposure. The response to 1 $\mu$M 5-HT represents the sustained excitatory effects of 5-HT on the pharynx.
```{r epg-5ht-label, fig.cap="(ref:epg-5ht)", fig.scap = "The concentration dependence for the effects of 5-HT on the EPG frequency.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/5HT_EPG-all.png")
```
(ref:5ht-epg-ind) **Effects of 5-HT on the pump duration of *C. elegans*.** Basal and 5-HT exposed EPG waveforms were taken from the time window where maximum pumping activity was noted, whereas the wash EPG waveform was taken from the last minute of wash. Representative EPGs are shown in (a). Pump duration was derived by measuring the average time from E to R peaks (red arrow in a) of all EPGs over the peak response period (if there were less than 10 EPG in 10s window, 10 consecutive peaks were taken) (b). Data are mean $\pm$ SEM from 4 individual worms collected on 3 days. Two-tailed paired t-test with Welch correction. $***$P $\le$ 0.001.
```{r 5ht-epg-ind-label, fig.cap="(ref:5ht-epg-ind)", fig.scap = "Effects of 5-HT on the pump duration of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
# HT_epg_duration <- EPG_data %>%
# filter(Experiment == 7) %>%
# group_by("Cond") %>%
# ggplot(aes(x = Cond, y = mean_readout, fill = Cond)) +
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4))+
# scale_fill_manual(values=c('#000000', '#990099', '#000000')) +
# ylab("pump duration (ms)")+
# ylim(0,120) +
# xlab("") +
# theme(text=element_text(size=12, family="sans"),
# legend.position = "none") +
# ggsave("fig/results3/epg-HT-dur.pdf", width = 13, height = 10, units = "cm")
knitr::include_graphics("fig/results3/5HT_ind_EPG.png")
```
### Effects of Acetylcholine
Acetylcholine was applied at concentrations ranging from 1 to 100 $\mu$M. This led to concentration and time dependent effects on pumping (Figure \@ref(fig:ach-epg-traces-label)). 10 $\mu$M acetylcholine stimulated pumping. This stimulation was sustained for 5 minute perfusion and reversed to basal activity upon washing (Figure \@ref(fig:ach-epg-traces-label) a). Exposure of the pharynx to 15, 25, 50 or 100 $\mu$M acetylcholine led to potent stimulation of the pharyngeal activity before blocking its activity completely. Following, two types of activities were recorded: the pharynxes remained blocked even after 5 minutes of washing (Figure \@ref(fig:ach-epg-traces-label) b), or began pumping again whilst being perfused with acetylcholine (Figure \@ref(fig:ach-epg-traces-label) c). The ratio of pharynxes exhibiting the first or the second type of response to acetylcholine concentrations $\ge$ 15 $\mu$M was 1 : 1 and this was not concentration dependent (data not shown).
A closer look at the primary response of the pharynx to acetylcholine at 25 $\mu$M was taken (Figure \@ref(fig:ach-train-label)). The observed stimulation was characterised by a train of EPG spikes, progressively increasing in frequency and deceasing in amplitude (Figure \@ref(fig:ach-train-label) b and c) until the pharyngeal activity was completely inhibited. To determine the potency of acetylcholine on the spike frequency, the stimulatory effect of acetylcholine was scored. The EC~50~ was 22 $\mu$M.
<!-- # ```{r include=FALSE} -->
<!-- # EPG_ach <- EPG_data %>% -->
<!-- # filter(Experiment==9) -->
<!-- # #create new variable dose which will contain doses as character -->
<!-- # EPG_Ach_trans <- EPG_ach %>% -->
<!-- # mutate (Dose = factor(Conc, -->
<!-- # levels = c("1e-08", "1e-06", "1e-05", "2.5e-05", "5e-05", "1e-04"), -->
<!-- # labels = c("Ctr", "1uM", "10uM", "25uM", "50uM", "100uM"))) -->
<!-- # #plot 5HT data -->
<!-- # EPG_Ach_trans %>% -->
<!-- # group_by(Dose) %>% -->
<!-- # ggplot(aes(x = Dose, -->
<!-- # y = mean_readout)) + -->
<!-- # geom_bar(stat="identity",colour = "black", fill = "grey", size=0.5) + -->
<!-- # geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) + -->
<!-- # ylab("peak pumping (Hz)") + -->
<!-- # ylim(0, 5) + -->
<!-- # theme(text=element_text(size=12, family="sans"), -->
<!-- # legend.position = "none") + -->
<!-- # ggsave("fig/results3/epg_ach.pdf", width = 9, height = 10, units = "cm") -->
<!-- # ``` -->
(ref:ach-epg-traces) **Effects of acetylcholine on EPG.** Cut heads of *C. elegans* were perfused for 5 minutes in each Dent’s saline (basal), acetylcholine and again in Dent’s saline for recovery. Example EPG traces from the pharynx exposed to 10 $\mu$M (a), 25 (b), and 100 $\mu$M acetylcholine (c). Traces from 25 and 100 $\mu$M exposure represent variable responses of the pharynx to acetylcholine concentrations ranging from 15 to 100 $\mu$M. Each vertical line represents a single EPG.
```{r ach-epg-traces-label, fig.cap="(ref:ach-epg-traces)", fig.scap= "Effects of acetylcholine on EPG.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/ach-epg-traces_3.png")
```
(ref:ach-train) **Effects of acetylcholine on EPG frequency and waveform.** Example EPG recordings from the pharynx exposed to 25 $\mu$M acetylcholine representing effects of acetylcholine at $\ge$ 25 $\mu$M. Exposure of the pharynx to acetylcholine results in stimulation of pharyngeal activity (a) characterised by a train of spikes, (b), of decreasing amplitude (c). The stimulatory period shown in a represents trace boxed in (a). Example EPG waveforms from the basal pharyngeal activity (1), and activity at the beginning (2), in the middle (3) and at the end (1) of train of EPG spikes elicited by acetylcholine.
```{r ach-train-label, fig.cap="(ref:ach-train)", fig.scap = "Effects of acetylcholine on EPG frequency and waveform.", fig.align='center', echo = FALSE}
knitr::include_graphics("fig/results3/ach_train_properties.png")
```
(ref:ach-epg) **The concentration dependence for the effects of acetylcholine on EPG frequency.** Cut-heads were perfused for 5 minutes in each Dent's saline and indicated acetylcholine concentrations. Pumping rates were derived by taking maximum pumping rate in each condition over the 10s time window, (or the entire stimulatory period, if the response to nicotine was under 10s). Data are mean $\ge$ SEM for 2-8 individual worms done on ≥ 2 days. b) Dose-response curve for the effects of nicotine on the pharynx. Data are mean $\ge$ SEM, normalised to the basal activity and expressed as a % maximum response.
```{r ach-epg-label, fig.cap="(ref:ach-epg)", fig.scap = "The concentration dependence for the effects of acetylcholine on EPG frequency.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/epg_ach_graph.png")
```
### Effects of nicotine
Similarly to ACh, nicotine elicited concentration and time dependent changes to the EPG. At 1 $\mu$M it led to moderate but sustained stimulation of the pharyngeal activity. At higher doses (i.e. 5, 10, 25 and 50 $\mu$M) it caused a potent but transient elevation of pumping frequency followed by an inhibition of the pharyngeal activity (Figure \@ref(fig:epg-nicotine-2-label)). The stimulation by nicotine concentrations ranging from 5 to 50 $\mu$M consisted of a train of EPG spikes which decreased in amplitude with time (Figure \@ref(fig:epg-nicotine-2-label)).
To better understand the nicotine-induced pharyngeal events, a video recording and photos of pharynxes perfused with nicotine at 10 $\mu$M was taken (Supplementary video 3, Figure \@ref(fig:nicotine-photo-label)). In agreement with EPG data, nicotine induced a short-lived train of pharyngeal contractions. Cycles of simultaneous contraction-relaxation of the corpus and the grinder in the terminal bulb can be seen. This suddenly ceases. Following, asynchronous contraction of the isthmus and the grinder began which led to contraction and hence opening of the grinder and isthmus. In addition, twitching of the terminal bulb muscle could be observed throughout.
To score for the stimulatory effects of nicotine of pumping, the peak pumping rates pre and post-application of nicotine were derived and the dose-response curves was plotted (Figure \@ref(fig:epg-nic-graphs-label)). The EC~50~ for the effects of nicotine on the pharyngeal activity was 2.7 $\mu$M.
Investigations into the recovery from nicotine-induced pharynx stimulation were made. Following stimulation by 1 $\mu$M nicotine, pharynxes returned to the basal pumping rate within 5 minute wash, those exposed to higher nicotine concentrations remained inhibited (Figure \@ref(fig:nic-epg-traces-label)). To see if pharynxes begin to pump after longer wash, experiment were repeated. Cut heads were exposed to nicotine for 5 minutes, but after this time the washing period was extended until the pharyngeal activity was restored. To score for recovery, the time taken from the beginning of wash to the first EPG spike was taken (Figure \@ref(fig:epg-nicotine-3-label)). It takes 8 minutes or longer to recover from the effects induced by 5 and 10 $\mu$M nicotine. The time needed to recover from 50 $\mu$M perfusion was 18 minutes, suggesting longer washing is required to remove residual nicotine after exposure to higher drug concentrations.
(ref:epg-nic-traces) **Concentration dependent effects of nicotine on EPG frequency.** Cut heads were perfused for 5 minutes in each Dent's saline (basal), nicotine and again in Dent's saline for recovery. Example EPG traces from pharynxes exposed to 1 $\mu$M (a) and 25 $\mu$M nicotine (b). Response to 25 $\pm$M represent responses to nicotine concentrations ranging from 5 to 50 $mu$M.
```{r nic-epg-traces-label, fig.cap="(ref:epg-nic-traces)", fig.scap = "Concentration dependent effects of nicotine on EPG frequency.", fig.align= 'center', echo=FALSE}
knitr::include_graphics("fig/results3/epg-nicotine-traces.png")
```
(ref:epg-nicotine-2) **Effects of nicotine on EPG frequency and waveform.** Example EPG recordings from the pharynx exposed to 50 $\mu$M nicotine representing effects of nicotine at $\ge$ 5 $\mu$M. Exposure of the pharynx to nicotine results in stimulation of pharyngeal activity (a) characterised by a train of spikes, (b), of decreasing amplitude (c). The stimulatory period shown in a represents trace boxed in (a). Example EPG waveforms from the basal pharyngeal activity (1), and activity at the beginning (2), in the middle (3) and at the end (1) of train of EPG spikes elicited by nicotine.
```{r epg-nicotine-2-label, fig.cap="(ref:epg-nicotine-2)", fig.scap = "Effects of nicotine on EPG frequency and waveform.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/50um-nic-epg-properties.png")
```
(ref:nicotine-photo) **The effects of nicotine on the pharynx morphology.** Appearance of the pharynx pre- and post exposure to nicotine at 10 $\mu$M. Images were taken immediately prior to nicotine exposure and post nicotine-induced inhibition of pumping.
```{r nicotine-photo-label, fig.cap="(ref:nicotine-photo)", fig.scap="The effects of nicotine on the pharynx morphology.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/nicotine-exposure-photo.png")
```
(ref:epg-nic-graphs) **The concentration dependence for the effects of nicotine on EPG frequency.** Cut-heads were perfused for 5 minutes in each Dent's saline and indicated nicotine concentrations. Pumping rates were derived by taking maximum pumping rate in each condition over the 10s time window, (or the entire stimulatory period, if the response to nicotine was under 10s). Data are mean $\pm$ SEM for 2-13 individual worms done on ≥ 2 days. b) Dose-response curve for the effects of nicotine on the pharynx. Data are mean $\ge$ SEM, normalised to the basal activity and expressed as a % maximum response.
```{r epg-nic-graphs-label, fig.cap="(ref:epg-nic-graphs)", fig.scap="The concentration dependence for the effects of nicotine on EPG frequency.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/epg-nic-graphs.png")
```
<!-- # ```{r include=FALSE, echo=FALSE} -->
<!-- # EPG_nic <- EPG_data %>% -->
<!-- # filter(Experiment == 2) %>% -->
<!-- # mutate(Dose=factor(Conc, -->
<!-- # levels = c(1.0e-09, 1.0e-07, 1.0e-06, 5.0e-06, 1.0e-05, 2.5e-05, 5.0e-05), -->
<!-- # labels = c("Ctr", "100nM", "1uM", "5uM", "10uM","25uM", "50uM"))) -->
<!-- # -->
<!-- # EPG_nic_plot <- EPG_nic %>% -->
<!-- # group_by(Dose) %>% -->
<!-- # ggplot(aes(x = Dose, -->
<!-- # y = mean_readout, fill = Dose)) + -->
<!-- # geom_bar(stat = "identity") + -->
<!-- # geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) + -->
<!-- # scale_fill_manual(values=c('#000000', '#333333', '#666666','#999999', '#CCCCCC', '#D3D3D3', '#DCDCDC')) + -->
<!-- # ylab("peak response") + -->
<!-- # ylim(0, 5) + -->
<!-- # theme(text=element_text(size=12, family="sans"), -->
<!-- # legend.position = "none") -->
<!-- # ggsave("fig/results3/epg-nic.pdf", width = 9, height = 10, units = "cm") -->
<!-- # ``` -->
(ref:epg-nicotine-3) **Recovery from nicotine-induced inhibition of EPG of dissected *C. elegans*.** Example trace showing recovery from the effects of 50 $\mu$M nicotine on EPG of cut head (a). pharynxes were perfused with nicotine for 5 minutes before being flushed with Dent's saline. The time taken to recovery 5, 10 and 50 $\mu$M nicotine was derived (b) by measuring the time period from the beginning of wash to the first EPG. Data are mean $\pm$ SEM from 2 - 3 individual worms collected from 2 paired experiments.
```{r epg-nicotine-3-label, fig.cap="(ref:epg-nicotine-3)", fig.scap= "Recovery from nicotine-induced inhibition of EPG of dissected \\textit{C. elegans}.", fig.align='center', echo=FALSE}
# EPG_nic_des <- EPG_data %>%
# filter(Experiment == 6) %>%
# mutate(Dose=factor(Conc,
# levels = c(5, 10, 50),
# labels = c("5uM", "10uM", "50uM")))
#
# EPG_nic_des_plot <- EPG_nic_des %>%
# group_by(Dose) %>%
# ggplot(aes(x = Dose,
# y = mean_readout, fill = Dose)) +
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) +
# scale_fill_manual(values=c('#666666','#999999', '#CCCCCC', '#DCDCDC')) +
# ylab("time to recover (mins)") +
# ylim(0, 30) +
# theme(text=element_text(size=12, family="sans"),
# legend.position = "none") +
# ggsave("fig/results3/epg-nic-des.pdf", width = 9, height = 10, units = "cm")
knitr::include_graphics("fig/results3/NIC-RECOVERY.png")
```
Comparing the effects of nicotine on the pharynx as revealed by EPG and by visual scoring revealed a discrepancy in the effects seen when pharynxes were exposed to 10 and 20 $\mu$M. In EPGs, perfusion of the pharynx for 5 minutes with either 10 or 20 $\mu$M elicited potent stimulation followed by a blockage of the pharyngeal activity (Figure \@ref(fig:nic-epg-traces-label) b). In contrast, no potent stimulation of the pharynx by these doses was observed when the pharyngeal pumping scored visually. Instead, a moderate stimulation of the pharynx was seen after ~20 minutes of incubation which increased in frequency over time (Figure \@ref(fig:cuthead-agonist-label). To determine if this effect can be replicated in the EPG experiments, pharynxes were perfused with 10 $\mu$M nicotine for 1 hour (Figure \@ref(fig:prolonged-exp-nic-label)). After 10 minutes of perfusion, little EPG spikes began to emerge which increased in amplitude over time.
(ref:prolonged-exp-nic) **Effects of prolonged nicotine exposure on EPG.** a) Example EPG recording from the *C. elegans* cut head showing the period of basal activity (Dent's), and the activity in response to 25 $\mu$M nicotine over the 1 hour perfusion period. The effects of nicotine on EPG waveform (b) showing the differences between the basal EPG (1), EPG at the beginning (1) and after 10 (2) and 20 minute (3) perfusion with nicotine.
```{r prolonged-exp-nic-label, fig.cap="(ref:prolonged-exp-nic)", fig.scap = "Effects of prolonged nicotine exposure on EPG.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/nic-epg-trace-long-exposure-comb.png")
```
\newpage
### Effects of cytisine
The effects of cytisine, an agonist of nAChR was tested. Cytisine was applied at concentrations ranging from 1 to 100 $\mu$M. As in case of acetylcholine and nicotine, two types of responses were observed. Moderate but sustained stimulation of the pharyngeal activity was elicited by 5 $\mu$M, whereas at concentrations $\ge$ 10 $\mu$M, the pharynx was stimulated and subsequently inhibited (Figure \@ref(fig:cyt-epg-label)). The EC~50~ of cytisine on EPG was 3 $\mu$M (Figure \@ref(fig:cyt-epg-graph-label)).
<!-- # ```{r include=FALSE} -->
<!-- # EPG_cyt <- EPG_data %>% -->
<!-- # filter(Experiment==10) %>% -->
<!-- # mutate (Dose = factor(Conc, -->
<!-- # levels = c("1e-08", "1e-06", "5e-06", "1e-05", "5e-05", "1e-04"), -->
<!-- # labels = c("Ctr", "1uM", "5uM", "10uM", "50uM", "100uM"))) -->
<!-- # #plot 5HT data -->
<!-- # EPG_cyt %>% -->
<!-- # group_by(Dose) %>% -->
<!-- # ggplot(aes(x = Dose, -->
<!-- # y = mean_readout)) + -->
<!-- # geom_bar(stat="identity",colour = "black", fill = "grey", size=0.5) + -->
<!-- # geom_errorbar(aes(ymin = mean_readout-se, ymax = mean_readout+se), width=0.4) + -->
<!-- # ylab("peak pumping (Hz)") + -->
<!-- # ylim(0, 5) + -->
<!-- # theme(text=element_text(size=12, family="sans"), -->
<!-- # legend.position = "none") + -->
<!-- # ggsave("fig/results3/epg_cyt.pdf", width = 9, height = 10, units = "cm") -->
<!-- # ``` -->
(ref:cyt-epg) **Effects of cytisine on EPG.** Cut heads of *C. elegans* were perfused for 5 minutes in each Dent’s saline (basal), cytisine and again in Dent’s saline for recovery. Example EPG traces from the pharynx exposed to 5 $\mu$M (a) and 10 $\mu$M cytisine (b). Trace from 10 $\mu$M exposure represent response of the pharynx to cytisine concentrations ranging from 10 to 100 $\mu$M.
```{r cyt-epg-label, fig.cap="(ref:cyt-epg)", fig.scap= "Effects of cytisine on EPG.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/cyt-traces.png")
```
(ref:cyt-epg-graph) **The concentration dependence for the effects of cytisine on EPG frequency.** Cut-heads were perfused for 5 minutes in each Dent's saline and indicated cytisine concentrations. Pumping rates were derived by taking maximum pumping rate in each condition over the 10s time window, (or the entire stimulatory period, if the response to nicotine was under 10s). Data are mean $\ge$ SEM for 2-5 individual worms done on ≥ 2 days. b) Dose-response curve for the effects of cytisine on the pharynx. Data are mean $\ge$ SEM, normalised to the basal activity and expressed as a % maximum response.
```{r, cyt-epg-graph-label, fig.cap="(ref:cyt-epg-graph)", fig.scap = "The concentration dependence for the effects of cytisine on EPG frequency.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/epg-cyt.png")
```
\newpage
### Effects of neonicotinoids
The effects of neonicotinoids on EPG were also examined. Pharynxes were exposed to 100 $\mu$M nitenpyram, 50 $\mu$M thiacloprid and 75 $\mu$M clothianidin. Neither nitenpyram (Figure \@ref(fig:Nit-EPG-label)), nor thiacloprid had an effect on the frequency of pharyngeal activity (Figure \@ref(fig:epg-thia-label)). In contract, clothianidin stimulated pharyngeal activity. The frequency increased from 0.6 to 1.1 Hz and returned to basal following a 5 minute wash (Figure \@ref(fig:clo-epg-label)). EPGs from clothianidin-perfused pharynxes were examined and a reduction of R peak in relation to E peak was noted. Clothianidin significantly increased the E/R ratio from 1.3 to 1.8 (Figure \@ref(fig:clo-er-ratio-label) a and b). 5-minute wash did not reverse this effect. A change in duration of pumping activity was also observed. The latency of EPG decreased from 130 ms to 110 ms when pharynxes exposed to clothianidin (Figure \@ref(fig:clo-er-ratio-label) a and c). This effect was not reversed upon 5 minute wash.
(ref:Nit-EPG) **The effects of nitenpyram on EPG.** Cut heads were perfused for 5 minutes with solvent (Dent's) and 100 $\mu$M nitenpyram. Peak pharyngeal response over 10-second window pre- and post exposure period were derived. Data are mean $\pm$ SEM from eight individual worms collected from 3 experiments. For comparison, the maximum pumping achieved by 5-HT is shown in dashed line. b) Example EPG recording showing basal, treatment with 100 $\mu$M nitenpyram and wash periods.
```{r Nit-EPG-label, fig.cap="(ref:Nit-EPG)", fig.scap = "The effects of nitenpyram on EPG.", fig.align='center', echo=FALSE}
# Nit_EPG <- EPG_data %>%
# filter(Experiment == 3)
# Nit_EPG_1 <- Nit_EPG %>%
# mutate(Cond2 = factor(Cond, levels=c("Pre", "Niten", "Wash"),
# labels = c("Basal", "Nitenpyram", "Wash")))
#
# Nit_EPG_plot <- Nit_EPG_1 %>%
# group_by("Cond2")%>%
# filter(Cond2 == "Basal" | Cond2 == "Nitenpyram") %>%
# ggplot(aes(x = Cond2, y = mean_readout, fill = Cond2))+
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4)) +
# scale_fill_manual(values=c('#000000','#339900')) +
# ylab("peak pumping (Hz)")+
# ylim(0, 5) +
# xlab("") +
# theme(text=element_text(size=12,family="sans"),
# legend.position = "none") +
# ggsave("fig/results3/epg-niten.pdf", width = 13, height = 10, units = "cm")
knitr::include_graphics("fig/results3/Niten-EPG-comb.png")
```
(ref:epg-thia) **The effects of thiacloprid on EPG.** Cut heads were perfused for 5 minutes with solvent (Dent's + 0.01% DMSO) and 50 $\mu$ thiacloprid. Peak pharyngeal response over 10-second window pre- and post drug treatment were derived. Data are mean $\pm$ SEM from 8 individual worms collected from 3 experiments. For comparison, the maximum pumping achieved by 5-HT is shown in dashed line. (b) Example EPG recording showing basal, treatment with 50 $\mu$M thiacloprid and wash periods.
```{r epg-thia-label, fig.cap="(ref:epg-thia)", fig.scap = "The effects of thiacloprid on EPG.", fig.align='center', echo=FALSE}
# Thia_EPG <- EPG_data %>%
# filter(Experiment == 4) %>%
# group_by("Cond") %>%
# filter(Cond== "Pre"| Cond == "Thiacloprid") %>%
# ggplot(aes(x = Cond, y = mean_readout, fill = Cond)) +
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4))+
# scale_fill_manual(values=c('#000000','#000066')) +
# ylab("peak pumping (Hz)")+
# ylim(0, 5) +
# xlab("") +
# theme(axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# text= element_text(size=12, family="sans"),
# legend.position ="none") +
# ggsave("fig/results3/epg-thia.pdf", width = 13, height = 10, units = "cm")
knitr::include_graphics("fig/results3/Thia-epg-combined.png")
```
(ref:clo-epg) **The effects of clothianidin on EPG.** Cut heads were perfused for 5 minutes with solvent (Dent's + 0.01% DMSO) and 75 $\mu$M clothianidin (a). Peak pharyngeal response over a 10-second pre- and post drug treatment were derived. Data are mean $\pm$ SEM from 9 individual worms collected from 3 experiments. For comparison, the maximum pumping achieved by 5-HT is shown in dashed line. (b) Example EPG recording showing basal, treatment with 75 $\mu$M clothianidin and wash periods.
```{r clo-epg-label, fig.cap="(ref:clo-epg)", fig.scap ="The effects of clothianidin on EPG.", fig.align='center', echo=FALSE}
# Clo_EPG <- EPG_data %>%
# filter(Experiment == 5) %>%
# group_by("Cond") %>%
# ggplot(aes(x = Cond, y = mean_readout, fill = Cond)) +
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4)) +
# scale_fill_manual(values=c('#000000','#993300', '#000000')) +
# ylab("peak pumping (Hz)")+
# ylim(0, 5) +
# xlab("") +
# theme(axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# text= element_text(size=12, family="sans"),
# legend.position ="none") +
# ggsave("fig/results3/epg-clo.pdf", width = 13, height = 10, units = "cm")
knitr::include_graphics("fig/results3/Clo-epg-comb.png")
```
<!-- # ```{r, echo=FALSE, include=FALSE} -->
<!-- # clo_er_plot <- EPG_data %>% -->
<!-- # filter(Experiment == 8) %>% -->
<!-- # group_by("Cond") %>% -->
<!-- # ggplot(aes(x = Cond, y = mean_readout, fill = Cond)) + -->
<!-- # geom_bar(stat = "identity") + -->
<!-- # geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4))+ -->
<!-- # scale_fill_manual(values=c('#000000','#993300', '#000000')) + -->
<!-- # ylab("E/R ratio")+ -->
<!-- # xlab("") + -->
<!-- # theme(axis.text = element_text(size=12), -->
<!-- # axis.title = element_text(size=12), -->
<!-- # text= element_text(size=12, family="sans"), -->
<!-- # legend.position ="none") + -->
<!-- # ggsave("fig/results3/clo-er-ratio.pdf", width = 8, height = 10, units = "cm") -->
<!-- # -->
<!-- # clo_er_plot <- EPG_data %>% -->
<!-- # filter(Experiment == 11) %>% -->
<!-- # group_by("Cond") %>% -->
<!-- # ggplot(aes(x = Cond, y = mean_readout, fill = Cond)) + -->
<!-- # geom_bar(stat = "identity") + -->
<!-- # geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4))+ -->
<!-- # scale_fill_manual(values=c('#000000','#993300', '#000000')) + -->
<!-- # ylab("pump duration (ms)")+ -->
<!-- # xlab("") + -->
<!-- # ylim(0,150) + -->
<!-- # theme(axis.text = element_text(size=12), -->
<!-- # axis.title = element_text(size=12), -->
<!-- # text= element_text(size=12, family="sans"), -->
<!-- # legend.position ="none") + -->
<!-- # ggsave("fig/results3/clo-duration.pdf", width = 8, height = 10, units = "cm") -->
<!-- # ``` -->
(ref:clo-er-ratio) **The effects of clothianidin on EPG waveform.** Example individual basal (left), clothianidin stimulated (middle) and recovery EPG (right) (a). The effects of 75 $\mu$M clothianidin on E/R ratio (b) and pump duration (c). The amplitude of E relative to R was measured to derive E/R ration, and the time taken from E to R to derive pump latency. The values are the average pump duration / E/R ratio all EPGs in the period of the maximum pumping. If there were less then 10 EPGs, 10 consecutive peaks were taken. Data are mean $\pm$ SEM of 9 individual worms collected from 3 experiments. Two-tailed t-test, $*$P $\le$ 0.05. $**$P $\le$ 0.01.
```{r clo-er-ratio-label, fig.cap="(ref:clo-er-ratio)", fig.scap = "The effects of clothianidin on EPG waveform.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/clo-ind-epg.png")
```
### Effects of acetylcholine in the presence of nitenpyram and thiacloprid
Neither nitenpyram at 100 $\mu$M nor thiacloprid at 50 $\mu$M impaired on EPG frequency. To determine whether they inhibit the stimulatory effect of acetylcholine on EPG frequency, pharynxes were pre-incubated with nitenpyram or thiacloprid and then exposed to both thiacloprid or nitenpyram and acetylcholine (Figure \@ref(fig:ach-nit-label) and Figure \@ref(fig:ach-thia-label)). Acetylcholine at 10 $\mu$M was tested, because this dose is close to the EC~50~ on EPG frequency. The response of the pharynx to acetylcholine in the presence or absence of neonicotinoids was compared. Pre-exposure of the pharynx to either neonicotinoid did not influence the EPG spike frequency elicited by acetylcholine. In both cases, upon application of acetylcholine, the pumping frequency increased from 0.2 to ~ 1 Hz.
(ref:ach-nit) **Effects of acetylcholine on the EPG frequency in the presence and absence of nitenpyram.** Pharynxes were pre- exposed to 100 $\mu$M nitenpyram. 5 minutes later, 100 $\mu$M nitenpyram and 10$\mu$M acetylcholine were applied. Responses to acetylcholine in the presence of nitenpyram were compared to responses elicited by acetylcholine. Pharyngeal pumping rates were derived by extracting peak response in a 10 second window. Data are mean $\pm$ SEM from 3-8 individual worms collected from paired experiments done on $\ge$ 2 days. Example EPG traces of the pharyngeal responses in the presence or absence of nitenpyram (b and c respectively).
```{r ach-nit-label, fig.cap="(ref:ach-nit)", fig.scap = "Effects of acetylcholine on the EPG frequency in the presence and absence of nitenpyram.", fig.align='center', echo=FALSE}
# Nit_ach_EPG <- EPG_data %>%
# filter(Experiment == 12)
# Nit_ach_EPG_1 <- Nit_ach_EPG %>%
# mutate(Cond2 = factor(Cond, levels=c("Basal", "ACh+Nit", "ACh"),
# labels = c("Basal", "ACh+Nit", "ACh")))
#
# Nit_ach_EPG_plot <- Nit_ach_EPG_1 %>%
# group_by("Cond2")%>%
# ggplot(aes(x = Cond2, y = mean_readout, fill = Cond2))+
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4)) +
# scale_fill_manual(values=c('#000000', '#339900', 'grey')) +
# ylab("peak pumping (Hz)")+
# ylim(0, 5) +
# xlab("") +
# theme(text=element_text(size=12,family="sans"),
# legend.position = "none") +
# ggsave("fig/results3/epg-nit+ach.pdf", width = 13, height = 10, units = "cm")
knitr::include_graphics("fig/results3/nit+ACH+combined.png")
```
(ref:ach-thia) **Effects of acetylcholine on the EPG frequency in the presence and absence of clothianidin.** pharynxes were pre- exposed to 75 $\mu$M thiacloprid. 5 minutes later, 75 $\mu$M thiacloprid and 10$\mu$M acetylcholine were applied. Responses to acetylcholine in the presence of thiacloprid were compared to responses elicited by acetylcholine. Pharyngeal pumping rates were derived by extracting peak response in a 10 second window. Data are mean $\pm$ SEM from 3-6 individual worms collected from paired experiments done on $\ge$ 2 days. Example EPG traces of the pharyngeal responses in the presence or absence of thiacloprid (b and c respectively).
```{r ach-thia-label, fig.cap="(ref:ach-thia)", fig.scap = "Effects of acetylcholine on the EPG frequency in the presence and absence of clothianidin.", fig.align='center', echo=FALSE}
# thia_ach_EPG <- EPG_data %>%
# filter(Experiment == 13)
#
# thia_ach_EPG <- thia_ach_EPG[!thia_ach_EPG$Cond=="Wash" ,]
#
# thia_ach_EPG_1 <- thia_ach_EPG %>%
# mutate(Cond2 = factor(Cond, levels=c("Basal", "Thia + ACh", "ACh"),
# labels = c("Basal", "Thia + ACh", "ACh")))
#
# thia_ach_EPG__plot <- thia_ach_EPG_1 %>%
# group_by("Cond2")%>%
# ggplot(aes(x = Cond2, y = mean_readout, fill = Cond2))+
# geom_bar(stat = "identity") +
# geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se, width = 0.4)) +
# scale_fill_manual(values=c('#000000', '#000066', 'grey')) +
# ylab("peak pumping (Hz)")+
# ylim(0, 5) +
# xlab("") +
# theme(text=element_text(size=12,family="sans"),
# legend.position = "none") +
# ggsave("fig/results3/epg-thia+ach.pdf", width = 13, height = 10, units = "cm")
knitr::include_graphics("fig/results3/thia+ACH+combined.png")
```
### Effects of nicotine on worms deficient in nAChR
EPG analysis of the effects of nicotine on the pharynx revealed a nicotinic effect not seen in the visual observation experiments. To determine whether the effects of nicotine on EPG on nAChR *eat-2* mutant differs from wild-type, EPG recordings from both strains were obtained. The stimulatory effect of nicotine concentrations ranging from 100 nM to 50 $\mu$M was scored (Figure \@ref(fig:nicotine-epg-eat2-label)). No marked differences in nicotine-sensitivity of *eat-2* mutant vs wild-type worms were noted. The EC~50~ on wild-type was 3 $\mu$M, in comparison to 5 $\mu$M in *eat-2* mutant.
(ref:nicotine-epg-eat2) **Effects of nicotine on EPG frequency of *eat-2* nAChR *C. elegans* mutant.** Cut heads were perfused for 5 minutes in Dent's and nicotine at indicated concentrations. Peak response in 10s window was derived and normalised to the basal pumping (a). Data are mean SEM of paired experiments done on $\ge$ 2 worms on a single day. Example EPG recording showing response of the wild-type and *eat-2* mutant to 25 $\mu$M nicotine (b).
```{r nicotine-epg-eat2-label, fig.cap="(ref:nicotine-epg-eat2)", fig.scap = "Effects of nicotine on EPG frequency of \\textit{eat-2} nAChR \\textit{C. elegans} mutant.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results3/DR+TRACENic_N2+eat2.png")
```
## Discussion
*C. elegans* expresses at least 29 different nAChRs. Only a few of these subunits have been linked to the function of the pharynx [@mckay2004]. Cholinergic compounds were applied to the cut-head *C. elegans* and EPG recording were made to characterise the pharmacological profile of the pharynx, and in order to determine the expressed nAChRs. Results are summarised in Table \@ref(tab:pharynx-summary2).
### Nicotine inhibits pumping by contracting pharyngeal muscle
EPG analysis revealed complex responses of the pharynx to nicotine. 1 and 10 $\mu$M induced sustained stimulatory effect. At concentrations ranging from 25 to 100 $\mu$M a dual response was observed: a potent stimulation characterised by a train of EPGs. The amplitude of spikes progressively decreased with time until a complete inhibition of pharyngeal activity occurred (Figure \@ref(fig:nic-epg-traces-label)). This inhibition of pharyngeal activity coincided with a sustained contraction of grinder and isthmus of the pharynx. This suggests that nicotine induces potent contraction of the pharyngeal muscle and that a sustained stimulation leads to pumping inhibition.
### *Eat-2* is not involved in the nicotine-induced pharyngeal responses
The EPG responses elicited by nicotine are reminiscent of the responses achieved by the cholinergic compounds such as acetylcholine, cytisine and choline. This suggests nicotine acts at the pharynx in a similar way to classical nAChR agonist and exogenously applied neurotransmitter targeting nAChRs. In the preence of food, acetylcholine acts on *eat-2* containing nAChRs to induce pumping [@mckay2004]. EPG recordings from wild-type and *eat-2* nAChR mutant worms show no difference in nicotine-induced responses, suggesting nicotine does not act on *eat-2* containing nAChRs.
### Distinct effects of neonicotinoids on the pharyngeal system
The electrophysiological effects achieved by neonicotinoids on insect neuronal preparation and *C. elegans* pharynx differ. In *C. elegans*, clothianidin transiently stimulated pharynx for 5 minutes. EPG analysis revealed the effects of clothianidin on the shape of an EPG waveform. In the presence of 50 $\mu$M clothianidinsax, the amplitude of E spikes relative to R spike decreased leading to an increase of ER ratio. E spikes arise due to simultaneous contraction of the pharyngeal muscle syncytium [@franks2006]. Therefore, a reduction in E spike amplitude could be due to reduced synchronisation of the muscle syncytium depolarisation. 50 $\mu$M clothianidin also reduced a latency of pump duration. In contrast, thiacloprid and nitenpyram had no effect. In insects, neonicotinoids typically achieve biphasic effects on post-synaptic neurons: excitation followed by an inhibition (Section \@ref(electrophysevidence)). Such effects was not observed in *C. elegans*. This supports the divergent nature of insect and pharyngeal *C. elegans* nAChR families.
### *C. elegans* pharyngeal nAChRs are more closely related to human than insect nAChRs.
Investigation of the effects of nicotine and neonicotinoids on *C. elegans* pharyngeal system revealed high efficacy of nicotine, and low efficacy of neonicotinoids, which is also seen in mammals [@tomizawa2003]. In contrast, neonicotinoids are more efficacious on insects in comparison to nicotine [@tomizawa2003]. This suggests that mammalian and *C. elegans* nAChRs are more closely related than insect and *C. elegans* receptors. This is supported by the similarities in the effective doses of cholinergic compounds on the *C. elegans* pharynx and on the mammalian nAChRs. Acetylcholine, nicotine and cytisine all stimulated the pharynx with the EC~50~ of low $\mu$M. These concentrations are also effective against mammalian neuronal preparations and isolated nAChRs. Based on the $\alpha7$ receptors expressed in Xenopus oocytes, the EC50 of acetylcholine, nicotine and cytisine is 21 $\mu$M, 12.6 $\mu$M and 5.6 $\mu$M, respectively [@ballivet1996; @papke2002]. This suggests there are similarities in the pharmacophore of pharyngeal nAChR and mammalian $\alpha7$ receptors.
Table: (\#tab:pharynx-summary2) Summary of the effects of compounds on the pharyngeal activity of *C. elegans*.
+--------------+--------------------------------+-----------------------------------+
| | Pump frequency | EPG waveform |
+==============+================================+===================================+
|5-HT |1. Dose-dependent, sustained | 1. Reduced pump duration |
| |stimulation | |
| |2. EC~50~=255 $\mu$M | |
+--------------+--------------------------------+-----------------------------------+
|Acetylcholine |1. Sustained stimulation |1. The train of spikes elicited |
| |by 10 $\mu$M |by by $\ge$ 10$\mu$M characterised |
| |2. Potent stimulation followed |EPG spikes decreasing in amplitude |
| |by inhibition by $\ge$ 25 $\mu$M| |
| |3. EC~50~=22 $\mu$M | |
+--------------+--------------------------------+-----------------------------------+
|Cytisine |1. Sustained stimulation |1. The train of spikes elicited |
| |by 5 $\mu$M |by by $\ge$ 10 $\mu$M characterised|
| |2. Potent stimulation followed |EPG spikes decreasing in amplitude |
| |by inhibition by $\ge$ 10 $\mu$M| |
| |3. EC~50~=3 $\mu$M | |
+--------------+--------------------------------+-----------------------------------+
|Nicotine |1. Sustained stimulation |1. The train of spikes elicited |
| |by 1 $\mu$M |by by $\ge$ 10 $\mu$M characterised|
| |2. Potent stimulation followed |EPG spikes decreasing in amplitude |
| |by inhibition by $\ge$ 10 $\mu$M| |
| |3. EC~50~=2.7 $\mu$M | |
+--------------+--------------------------------+-----------------------------------+
|Nitenpyram |1. No effect at 0.1 mM |1. No effect at 0.1 mM |
+--------------+--------------------------------+-----------------------------------+
|Thiacloprid |1. No effect at 50 $\mu$M |1. No effects at 50 $\mu$M |
+--------------+--------------------------------+-----------------------------------+
|Clothianidin |1. Weak and sustained |1. Increased E/R ratio |
| |stimulation by 75 $\mu$M |2. Decrease in pump duration |
+--------------+--------------------------------+-----------------------------------+
|Alpha-bgtx |1. No effects on ACh-evoked |NA |
| |pharyngeal response | |
+--------------+--------------------------------+-----------------------------------+
|Clothianidin |1. No effects on ACh-evoked |NA |
| |pharyngeal response | |
+--------------+--------------------------------+-----------------------------------+
|Thiacloprid |1. No effects on ACh-evoked |NA |
| |pharyngeal response | |
+--------------+--------------------------------+-----------------------------------+
06-results-04.Rmd 0 → 100644
View file @ e74fe8cf
# *C. elegans* pharynx as a platform for heterologous nAChR expression {#results-4}
## Introduction
nAChRs are the major site of action of neonicotinoids. Several lines of evidence suggest that even within the same species, different neonicotinoid-compounds target distinct nAChRs. They also have a distinct modes of action; some neonicotinoid are true-, partial- or super- agonist whilst other are antagonists of nAChRs (Section \@ref(moaneonicsinsects)). The pharmacological characterisation of insect nAChRs is needed to better understand the interactions between the nAChRs and neonicotinids and to identify subunits sensitive to different members of this class of insecticides.
### Biological systems for heterologous protein expression ###{#biologicalsystemfornachrexpression}
To pharmacologically characterise the receptor ion channel, a recombinant protein can be heterologously expressed in a number of different systems (reviewed in @millar2009a). The two most commonly used are mammalian cells, insect cells or *Xenopus* oocytes. Each presents advantages but also disadvantages (summarised in Table \@ref(tab:heterologous-expression-systems)). These systems have been extensively used to characterise mammalian and *C. elegans* nAChRs [@millar2009a].
```{r heterologous-expression-systems, echo=FALSE, warning=FALSE, message=FALSE}
library(kableExtra)
library(dplyr)
exp_sstms <- data.frame(
System = c(rep("Xenopus oocytes", 5), rep("Cell lines", 3)),
Advantages = c("Cheap and easy to maintain", "Easy to inject", "Express a low number \nof endogenous membrane proteins", "Can be transfected with muliple \nmRNA species simultaneously", "Amendable to electrophysiological techniques", "Temporal control of expression", "Favourable cellular environment \nfor many proteins", "Amendable to electrophysiological \nand biochemical \ntechniques"),
Disadvantages = c("Functional properties \nmay be altered", "Preparation short lived", "Single-cell technique", " ", " ", "High cost", " ", " "))
exp_sstms %>%
mutate_all(linebreak) %>%
kable("latex", booktabs = T, escape = F,
col.names = linebreak(c("System", "Advantages", "Disadvantages")),
caption = "Advantages and disadvantages of heterologous expression systems.") %>%
collapse_rows(columns = 1, valign = "top", latex_hline = "major") %>%
kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position")
```
### Properties of vertebrate $\alpha7$ nAChR
One of the well-studied nAChR subunit is the vertebrate homomeric $\alpha7$. Heterologous expression of these receptors in *Xenopus* occytes and mammalian cell lines.
#### $\alpha7$ nAChR is rapidly desensitising
Acetylcholine and nicotine are classical nAChR agonists that activate vertebrate $\alpha7$ and many other nAChR types. In addition, there are selective compounds that bind to $\alpha7$ receptors, such as cytisine and choline. The rank order of potency of these agonists is: cytisine > nicotine > ACh > choline [@papke2000]. The EC50 values vary depending on the method of measure and the expression system [@papke2002]. Nicotine is generally at least 5 times more potent than ACh [@couturier1990], whereas the potency of choline is at least 10 times lower than that of ACh [@papke2002]. The EC50 of the most potent compound cytisine is between 5.6 and 7.1 $\mu$M [@wonnacott2007].
The kinetics of agonist-evoked nAChR responses are reminiscent to those of other nAChR types. Briefly, in the presence of agonist, receptor channels open rapidly allowing flux of ions, which gradually declines [@corrie2011] until a full depolarisation and desentisation occurs.
Extremely rapid desensitising kinetics is the unique feature of the $\alpha7$ receptor. In 1990, @couturier1990 heterologously expressed $\alpha7$ in *Xenopus* oocyte and recorded the macroscopic current in response to acetylcholine. In the presence of acetylcholine, receptors desensitised in under a millisecond [@couturier1990; @papke2002]. A more precise temporal characterisation of this response was obtained in 2008. Using patch-clamp, a single channel recording transfected human cell lines was obtained [@bouzat2008]. In the presence of 1 $\mu$M acetylcholine, $\alpha7$ receptor opens and desensitises in 0.4 ms. This is much faster than other receptor channels. For example, $\alpha8$ typically desensitises in hundreds of millisecond [@gerzanich1994], whereas *C. elegans* L-type and N-type nAChRs in tens of seconds [@boulin2008; @touroutine2005].
Single channel recordings revealed another striking difference between $\alpha7$ and other nAChRs. In response to agonist, nAChR channel typically display several bursts of channel opening flanked by period of inactivity [@mishina1986; @weltzin2019]. In contrast, $\alpha7$ typically opens once before entering the inactive form [@bouzat2008]. This feature combined with rapid desensitising kinetics suggest that $\alpha7$ receptors are primarily involved in the phasic and not tonic responses to ACh in the physiological conditions.
<!-- This paper also explains why Xenopus and voltage clamp may not be the best for measuring EC50 for these receptors. tis paper also lists EC50 from many papers! note that choline at 15 uM could activate native receptor (predicted to be alpha7 based on characteristics) in human monocyte-derived macrophages [@baez-pagan2015]. -->
Heterologous expression of $\alpha7$ also allowed for a detailed analysis of the recovery kinetics for receptor channels. Following desensitisation and removal of the agonist by washing, receptor returns to the resting state, allowing for the subsequent activation upon agonist application. Although the activation and desensitisation kinetics of $\alpha7$ evoked by many agonists are almost identical, the recovery kinetics are compound, time and concentration -dependent [@mike2000]. After acetylcholine-evoked desensitisation and a 5-minute wash, the subsequent response of $\alpha7$ receptors to ACh seemed unaffected [@briggs1998]. In contrast, subsequent response to ACh following nicotine desensitisation was reduced [@briggs1998]. Thus, recovery kinetics following acetylcholine application are faster. Recovery time is also more rapid for choline than for acetylcholine [@mike2000].
#### Sensitive to $\alpha$-Bungarotoxin ($\alpha$-Bgtx)
A distinct pharmacological feature of $\alpha7$ receptors is their high sensitivity to $\alpha$-Bgtx. Interaction between $\alpha$-Bgtx and $\alpha7$ receptors was first revealed by biochemical techniques. $\alpha7$ receptor was isolated from membrane fraction of transformed bacterial cells with $\alpha$-Bgtx-affinity chromatography [@schoepfer1990]. Whereas, radiolabeled $\alpha$-Bgtx bound to $\alpha7$ receptors immunoprecipitated from the chick retina [@keyser1993]. Binding to mammalian brain receptors was also revealed by radiography of mammalian brain slices incubated with labelled $\alpha$-Bgtx [@clarke1985; @segal1978]. The signal was consistent with the expression profile of $\alpha7$ receptor, as shown by immunocytochemistry [@toro1994]. In contrast, there was no $\alpha$-Bgtx binding in mice deficient in $\alpha7$ expression [@orr-urtreger1997]. Finally, the crystal structure of $\alpha7$ receptor showed binding of $\alpha$-Bgtx to the extracellular domain of the receptor [@dellisanti2007].
Electrophysiological evidence provided mechanistic details of the interaction between $\alpha$-Bgtx and $\alpha7$ receptor. Incubation with nM concentrations of $\alpha$-Bgtx prevented responses to classical nAChR agonists of heterologous receptors in *Xenopus* oocytes [@couturier1990] as well as native receptors in PC12 cells [@blumenthal1997] and hippocampal neurons [@alkondon1991]. Upon removal and wash, the receptor responds to ACh normally [@couturier1990], thus the interaction between $\alpha$-Bgtx and $\alpha7$ are of high affinity, competitive and reversible.
<!-- Functional expression of insect receptors has been largely unsuccessful. Common problems associated with the heterologous expression of proteins in Xenopus or cell lines are low yields and incorrect processing. -->
<!-- @jensen2012 -->
<!-- tudies. x-ray studies, radiolabelled. -->
<!-- Note that alpha7 is abundandtly exprssed in the hypocapus [@]. -->
<!-- [@toro1994] tHIS PAPER SHOWS THAT ALPHA7 IS EXPRESSED IN VIRTUALLY ALL REGIONS OF TE BRAIN, CORRELATED WITH THE GBTX RADIOGRAPH [@clarke1985] - USSED IMMUNOCYTOCHEMISTRY Radiolabelled bgtx bind to sites in the brain sections consistent with ACh and nicotine. -->
<!-- , gold-bgtx labelling and electron micrographs [doi:10.1016/j.jneumeth.2003.11.001] and immunoreactivity [@10.1523/JNEUROSCI.21-20-07993.2001]. -->
<!-- Radiolabelled bgtx bind to native receptors in the brain [@chen1997]. -->
#### Highly permeable to calcium ions ####{#capermeability}
$\alpha7$ receptors are highly permeable to calcium ions [@seguela1993; @bertrand1993]. Historically, calcium ion permeability of nAChRs was measured by establishing the reversal potential of the agonist-evoked current by changing the concentration of calcium ions in the buffer and representing calcium ion flux as a function of sodium ion flux. Using this methods, is was established that there is up to 20-fold difference between calcium and sodium permeability of heterologously expressed $\alpha7$ receptors [@seguela1993]. More recently fluorescent calcium indicators [@neher1995] were used to measure calcium ion flux as a function of the entire transmembrane current. Calcium ions account for 11 % of the entire ionic conductance of the heterologously expressed $\alpha7$ receptors [@fucile2000]. In comparison to other nAChRs, $\alpha7$ has up to a 200-fold difference in calcium ion permeability when the channels are expressed heterologously [reviewed in @fucile2004].
#### Matured with the aid of NACHO and RIC-3 ####{#ric-3nacho}
Mammalian RIC-3 is a small protein with 2 transmembrane domains and a single coiled-coil domain [@wang2009]. It is expressed in most brain regions, enriched in the regions common to the $\alpha7$ expression, namely the hippocampus and the cerebellum, as shown by *in-situ* hybridisation [@halevi2003]. Fluorescently tagged-RIC-3 localised to the ER and not the surface when expressed heterologously [@roncarati2006], whereas immunostaining of native RIC-3 in PC12 and hippocampal neurons showed co-localisation with neuronal and ER markers [@alexander2010], providing evidence that RIC-3 is an ER residing protein.
RIC-3 has a role in receptor maturation. Co-expression of RIC-3 protein with heterologously expressed mammalian $\alpha7$ resulted in increased functional expression of this receptor, as measured by ACh-evoked current [@williams2005] and radiolabelled ligand binding [@lansdell2008]. Additionally, RIC-3 promotes association of nAChRs with proteins involved in post-translational modification, receptor trafficking and transport [@mulcahy2015]. Thus, RIC-3 promotes cell-surface expression of nAChRs.
<!-- Heterologous co-expression of RIC-3 with mammalian $\alpha7$ and Drosophila $\alpha5$ resulted in formation of binding sites, as shown by labelling with radiolabelled ligand binding of classical nAChR ligands [@lansdell2008; @lansdell2012]. Co-expression of *C. elegans* RIC-3 protein with heterolously expressed mammalian $\alpha7$ resulted in increased functional expression of receptors [@williams2005]. Therefore, RIC-3 is important in the maturation of worm, mammalian and insect nAChRs. -->
NACHO is an 18-kDa multi-pass protein ER protein expressed in neurons of hippocampus, cerebral cortex and the olfactory bulb [@gu2016]. ACh-evoked current and cell-surface labelling of heterologously expressed $\alpha7$ receptor were elicited upon co-transfection of cells with NACHO [@gu2016]. Absence of $\alpha7$ mediated current in the hippocampus of NACHO-knock-out mice, the lack of binding of classical antagonists as well as behavioural phenotype, consistent with the disruption of cholinergic neurotransmission [@matta2017] supports the role of NACHO in maturation of $\alpha7$ and other nAChRs including $\alpha4\beta2$, $\alpha3\beta2$ and $\alpha3\beta4$ [@matta2017].
<!-- [125I]a-Bgt autoradiography of brain slices and immunoblotting as shown by of extracted membranes with NACHO-specific antibodies shown Expressed , (The nAChR-current was detectable in transfected with alpha7 cells was detectable, upon co-expression of NACHO. Co-transefction of cells with tagged Extraceulllular domain resulted in surface labelling in co-transfected with NACHO cells, and not in the absence of NACHO. Thus, NACHO promoted cell-surface expression. . Note that NACHO does not assembly with alpah7 as shown by immunoprecipitation with Abs specific to the receptor (no detection of NACHO by Abs). Conversly, pulldown assay with Abs specific to NACHO - no bgtx binding. NACHO also involved in maturation of -->
Further experiments by @gu2016 and @matta2017, provided details of the interactions between the receptor, RIC-3 and NACHO. Transfection of HEK cells with $\alpha7$ and RIC-3 resulted in no surface expression, based on the lack of $\alpha$-bgtx or epibatidine binding. Surface expression was achieved when cells were co-transfected with $\alpha7$ and NACHO, and augmented by RIC-3. Based on these observatins it was proposed that was NACHO promotes early events in the receptor assembly, whereas RIC-3 in synergy with NACHO aids receptor maturation. [@matta2017].
RIC-3 may also aid interactions with many other proteins in the cells, as shown by the enhanced interactome of nAChR $\alpha7$ and other proteins in the cell upon co-expression of RIC-3 [@mulcahy2015].
RIC-3 and NACHO are the two must studied proteins involved in the maturation of $\alpha7$ nAChRs, but there are also many other proteins of less defined role involved in the biogenesis of nAChRs (reviewed by @crespi2018). For example, evolutionary coserved CRELD and EMC-6, which are ubiquitonously expressed and ER membrane-bound [@dalessandro2018; @richard2013], as well as NRA-2/nicalin (nicastrin-like protein) and NRA-4/nodal modulator (NOMO) involved in the regulation of receptor stoichiometry [@almedom2009].
Taken together, *Xenopus* oocytes and eukaryotic cell lines can be used as an heterologous expression platform for vertebral nAChRs. They have been used to described the receptor maturaton, stechiometry, pharmacological and kinetic properties of vertebrate nAChRs, such as $\alpha7$. However, the expression of many invertebrate receptors in these systems has failed [@huang1999; @liu2005; @liu2009; @yixi2009; @bass2006], hindering their functional characterisation. Thus, other approaches need to be considered.
### *C. elegans* expresses proteins important in nAChR maturation ###{#cematnachr}
Heterologous expression of receptor channels requires an appropriate cellular environment to enable receptor maturation and functioning at the cell surface. Expression of nAChRs is a complex process during which individual subunits come together, assemble into a correctly folded pentamer and are transported to the plasma membrane where they function. *C. elegans* expresses many proteins involved in these processes.
Identification and heterologous expression of *C. elegans* nAChRs greatly contributed to the understanding of proteins involved in the biogenesis of these ion channels. There are two nAChRs expressed at the NMJ of the body wall muscle of *C. elegans*: ACR-16 homopentamic receptor and a heteropentameric receptor composed of UNC-29, UNC-38, UNC-63, LEV-1 and LEV-8. These receptors are classified based on pharmacology into nicotine- and levamisole- sensitive and named N-type and L-type, respectively. DEG-3/DES-2 nAChRs are the neuronal receptors [@treinin1998], whereas EAT-2 containing nAChRs are expressed in the pharyngeal muscle [@mckay2004].
<!-- *C. elegans* is a powerfull tool in which the function and pharmacological properties of proteins can be studied by a combination of genetic, behavioural and cellular approaches (Section \@ref(genmanip) \@ref(analytical_behaviour)). -->
#### RIC-3 ####{#ric-3celegans}
RIC-3 (resistant to inhibitors of cholinesterase-3) is an evolutionary conserved, ER-residing [@roncarati2006; @alexander2010] transmembrane protein [@wang2009]. In *C. elegans*, it is ubiquitously expressed in most (if not all) neurons, pharyngeal and body wall muscle in worms [@halevi2002]. The predicted topology of *C. elegans* RIC-3 has 2 transmembrane domains and 3 coiled-coils. The *C. elegans ric-3* mutant has impaired locomotor behaviour, resistance to levamisole [@miller1996] and has an impaired nAChR responses, as measured by electrophysiological recording from the body wall muscle [@halevi2002]. The *C. elegans ric-3* mutant has impaired cholinergic nerurotransmission, as shown by the lack of the cholinergic component of the EPG recording resulting in significantly retarded pharyngeal pumping and starved appearance [@halevi2002].
Heterologous expression of *C. elegans* nAChR in *Xenopus* oocytes provides evidence for their function in receptor maturation. Choline-evoked currents of neuronal DEG-3/DES-2 receptors increased by 5-fold upon RIC-3 co-expression [@halevi2002].
This was markedly improved when acr-16 was co-expressed with RIC-3 [@ballivet1996]. The role of RIC-3 in the maturation of this receptor type was also demonstrated *in-vivo*. The nicotine induced current at the body wall muscle was markedly reduced in ric-3 mutant, in comparison to wild-type [@halevi2002].
*C. elegans* RIC-3 can also promote maturation of mammalian $\alpha7$ channels. RIC-3 co-expression improved $\alpha-7$ function in *Xenopus* oocytes as shown by enhanced choline- and acetylcholine-evoked currents and cell-surface binding of radiolabelled $\alpha$-Bgtx [@lansdell2005; @williams2005]. RIC-3 also enabled the expression of $\alpha-7$ in otherwise non-permissive insect cell lines [@lansdell2008]. It not only promotes the heterologous cell-surface expression of mammalian, but it also increases the expression of insect chimera nAChRs [@lansdell2012].
Successful heterologous expression of L-type *C. elegans* receptor in *Xenopus* oocytes upon co-expression of RIC-3 and two other proteins, viz. UNC-50 and UNC-74, revealed other components important in the process of maturation of nAChRs [@boulin2008].
#### UNC-50 ####{#unc50}
UNC-50 is an ortholog of evolutionary conserved GMH1 protein. In *C. elegans* it was first identified in behavioural and pharmacological screens of *C. elegans* mutants. Several phenotypes have been described including: uncoordinated movement [@lewis1980] reduced binding of radiolabelled levamisole to the membrane fractions [@lewis1987], resistance to levamisole in behavioural assays [@lewis1987; @abiusi2017] and no responses of L-type nAChRs at the body wall muscle to levamisole [@eimer2007]. The lack of cell-surface staining from antibodies against UNC-29 [@eimer2007] in *unc-50* mutant comfirmed the role of UNC-50 in nAChR maturation. *unc-50* mutant is also characterised by an increased lysozyme-dependent degradation of nAChRs, suggesting its preventative role in this process. UNC-50 is predicted to be expressed in the Golgi. Expression of GFP::UNC-50 fusion protein resulted in fluorescence typical of the localisation to this organelle [@eimer2007].
#### UNC-74 ####{#unc74}
UNC-74 is closely related to the human TMX3 protein which is thought to be ER-associated [@haugstetter2005]. Reduced radiolabelled meta-aminolevamisole binding to membrane fraction of *C. elegans* mutant [@lewis1987] combined with its role in expression of L-type receptor in *Xenopus* oocytes [@boulin2008] confirms its role in receptor maturation.
#### EAT-18 ####{#eat18}
EAT-18 is thought to be required for the function of pharyngeal nAChRs. It consists of a single transmembrane and an extracellular domain. Transgenic worms expressing EAT-18::GFP fusion protein reveal fluorescence in the pharynx with the strongest signal in the muscle, but also in the pharyngeal neuron M5 and unidentified 5 to 6 extrapharyngeal neurons [@mckay2004]. *eat-18* mutants are deficient in pumping and resistant to high concentraton of nicotine, supporting the function of EAT-18 in cholinergic neurotransmission of the pharynx [@raizen1995]. The association of *eat-18* with pharyngeal nAChR was indicated by comparison of the staining in the wild-type and *eat-18* mutant strains. Injection into the pseudocoelom of radiolabelled $\alpha$-bgtx resulted in straining of the pharynx. This was however abolished in the mutant strain [@mckay2004]. In addition, the expression of EAT-2 in *eat-2* was normal, suggesting EAT-18 is not involved in the trafficing of this receptor. It has been proposed that EAT-18 co-assembles with EAT-2 due to their common pharyngeal phenotypes in mutant strains and common cellular localisation in the pharyngeal muscle [@mckay2004]. Recently, successful expression of eat-2 co-assembled with eat-18 has been shown in *Xenopus* oocytes (personal communication).
### Biochemical methods to assess expression of the $\alpha7$ nAChR transgene in *C. elegans*
The cellular localisation of nAChRs expressed in *C. elegans* can be detected by an array of methods, such as using protein-specific pharmacological agents. $\alpha$-bgtx is a high affinity antagonist of nAChRs [@blumenthal1997], widely used to label expression on native and heterologous channels. Audioradiography of tissues incubated with radiolabelled $\alpha$-bgtx visualised mammalian nAChRs at the post-synatic membrane of the end-plate [@barnard1971], and in the peripheral [@clarke1985] and central nervous system [@carbonetto1979]. Flourescently labelled $\alpha$-bgtx was utilised to show successful expression of heterologous proteins such as mammalian $\alpha7$ in HEK, P12 and SH SY5Y cell lines [@cooper1997; @gu2016]. In *C. elegans*, conjugated-α-Bgtx injected into the pseudocoelom, labelled native nAChRs of the pharyngeal [@mckay2004] and body wall muscle nAChRs [@jensen2012]. It also allowed for the identification of heterologously expressed ACR-16 in the body wall muscle of *C. elegans* [@jensen2012].
$\alpha$-Bgtx is used to demonstrate cell surface expression, because it binds to the extracellular domain of the nAChR [@dellisanti2007] and does not permeate membranes. There are methods used to label heterologous proteins intracellularly. For example, @salom2012 and @gu2016 used detergents to permeabilised membrane to allow protein-specific antibodies or $\alpha$-Bgtx to access protein sites inside the cell.
<!-- Xenopus oocyte was the first expression system used for the production of recombinant nAChRs. Expression of proteins in Xenopus oocytes provided an invaluable insight into the stechiometry and pharmacological properties of a number of receptors, including *Torpedo* muscle and human neuronal $\alpha$ 7 nAChRs (reviewed in @millar2009). Whilst the expression of some invertebrate subunits has been succesful, such as *C. elegans* ACR-16 [@ballivet1996] and acr-2 receptor co-expressed with UNC-38 [@squire1995], the expression of insect receptors opposed difficulties. -->
<!-- A major drawback of nAChR expression in Xenopus oocytes is that the ionic properties of formed channels can be altered [@lewis1997] and hence not reflect their functionality in the native environment. Additionally, Xenopus is a single cell technique, so the preparation is short lived and cannot be propagated for future experiment. The process of recombinant protein expression is typically slow and laborious. -->
<!-- ### Cell lines -->
<!-- Cell lines are an attractive platform for heterologous expression of proteins for many reasons. They allow for temporal control of expression. Protein can be expressed either constitutively or trasiently (ref). Cell lines may also provide a more favourable cellular environemnt than the Xenopus oocytes for the expession of nAChRs (ref). In addition, larger quantitities of recombinant protein can be generated and hence heterologous expression quantified biochemically by immunoprecipitation and radiolabelled ligand binding studies, whereas function scored using electrophysiological approaches. The expression of full lenth vertebrate and invertebrate subunits in cell lines has been difficult. For example, expression of mammalian $\alpha$ 7 in human HEK-293 and tsA-201 cells was unsuccesful [@lansdell1997; @lansdell2008]. @lansdell2012 introduced 76 Drosophila subunit into the Drosophila S2 cell lines singularly and in different combinations with no success. Expression of Myzus $\alpha$ 1 - 4 in S2 failed [@huang2000], so did the expression of Nl $\alpha$ 1 - 4 [@liu2005], and Cat flee $\alpha$ 1 - 2 and 7, $\beta$ 1 [@bass2006]. -->
<!-- Over the years, several approaches have been adopted to improve functional expression of nAChR in cell lines, expanding the knowledge of important factor for receptor folding and assembly. -->
<!-- Typically, HEK-293 or tsA-201 human cells or S2 Drosophila cells are used for the expression of nAChRs. The choice of cell lines is crucial as the expression of nAChR is host specific and varies between preparations. For example, mammalian $\alpha$ 7 was succesfully expressed in 9 different cell lines, but the function was only detected in 2 cell line types [@cooper1997]. -->
<!-- The expression of subunits is also temperature sensitive. Expression of Drosophila $\alpha$ 1 or 2 was achieved in HEK-293 cells at 25 but not at 37 &deg;C [@lansdell1997]. -->
<!-- Difficulties in expression of vertebrate and invertebrate subunits could be overcome by generating chimera genes. Detectable expression of human $\alpha$ 7, Drosophila $\alpha$ 6 or $\alpha$ 5 nAChRs was achieved by the expression of a fusion protein containing N-terminal extracellular domain of the nAChR with transmembrane and C terminal domain from the 5-HT~3~ recepor [@eisele1993; @lansdell2004; @lansdell2012]. -->
<!-- The expression of receptors is also improved by the co-expression of nAChR subunits with other proteins. This includes chaperon proteins and $\beta$ subunits of nAChRs. -->
<!-- check this paper out [@bao2018] -->
<!-- @lansdell1997 succesfully detetced heterologous expression of receptors following co-transfection of cell line with Drosophila $\alpha$ 1 and 2 with rat $\beta$ 2. Ligand binding was also achieved following co-transfection of cells with Myzus $\alpha$ 1 1 3 or Nl $\alpha$ 1 - 3 with rat $\beta$ 2 [@huang2000; @liu2005]. Binding of nAChR compounds to chimera proteins co-expressed with beta subunit was also achieved. Acetylcholine bound to receptors formed from cat flee N-terminal $\alpha$ 1 or 3 / C-terminal Drosophila $\alpha$ 2 chimera and rat $\beta$ 2 subunit. [@bass2006]. -->
<!-- ###Whole animal preparations -->
<!-- Mice are used in knock out and knock in studies. Knock out mice do not express a functional protein; this approach is useful when studying the function of a native individual nAChRs (reviewed in @drago2003). Knock in techniques allow for the investigation of the effects of mutations in nAChRs on mice models. These mutations can be gain of function or diseaese-associating [@drago2003]. More recently, a technique for cell specific re-expression of nAChRs in knock out has been developed and used to study the function of receptors in specific cholineric circuits [@maskos2005]. This technique is useful for studying the function of native nAChR and for economical and ethical reasons, not used to characterise foreign receptors. -->
<!-- Both Drosophila and *C. elegans* are an attractive invertebarate models for heterologous protein expression. They are both cheap to cultivate, have fast life cycles, their genomes have been sequenced and annotated and there is no ethical issues associated with the genetic manipulation. -->
<!-- In addition, there are well described genetic techniques used for the generation of transgenic or mutant strains. The phenotypical analysis of trangenic lines is simple, because many of the typical wild-type behaviours have been characterised. An additional advantage of *C. elegans* is that it expresses RIC-3 protein, important for nAChR folding and assembly (ref) which aids succesful heterologous expression of nAChRs (ref). -->
<!-- Drosophila and *C. elegans* have been succesfully used for the expression and pharmacological characterisation of recombinant nAChR. For example, intoduction of nAChRs from house fly or the cabbage moth into Drosophila mutant, rescued resistance to insecticide sponosyd [@sloan2015]. Whereas expression of nAChRs from parasitic worms in *C. elegans* mutant rescued levamisole-resistance [@sloan2015]. -->
<!-- Transformation with exhogenous protein typically uses plasmid DNA containing a gene of interest. However, studies in which *C. elegans* gene function is studied use cosmids of YACs. -->
<!-- There are several elements of the bacterial plasmid enabling amplification in *E. coli* and purificiation. One of the most important elements is the promoter. Promoter sequence determines the expression patter on the gene of interest. -->
<!-- Use of phenotypic markers for trasnformation to enable easy identification of the tranformed worms under the microscope. Typically, a marker that the expression will not be interfered with is chosen. First co-marker used was rol-6, a dominant gene encoding for cuticular collagen. Injection into the *C. elegans* wild-type induces a roller phenotype in which the worm has altered movement [@mello1991] easily identified under the dissecting microscope. Other commonly used markers are fluorescent reporter genes. One such gene is green-flourescent protein (GFP). *C. elegans* is transparent, therefore alive organism can be assayed. Therefore by either fusing the gene of interest to the marker, or co-injecting another plasmid DNA this can be achieved. Worms appear green, when viewed under the fluorescence microscope. -->
<!-- 90% of animals expressig the marker, also express the co-injected gene. [@mello1991] as detected by phenotypical and biochemical techniques. Rollers were stained for beta-galactosidase. -->
#### *Eat-2* is a suitable genetic background for functional expression
Many of worm's behaviours are underpinned by the cholinergic neurotransmission (Section \@ref(cholinergicneurotransmissioninworms)). Pharyngeal pumping is a measure of the feeding behaviour of the worm, regulated by acetylcholine. It can be easily quantified in whole organisms or cellular assays. Thus, the activity of the pharynx can be used a platform to investigate the performance and sensitivity of this organ to cholinergic drugs in the wild-type and in strains deficient in cholinergic transmission.
The activity of the pharynx is regulated by acetylcholine, thus this organ can be also suitable for the heterologous expression of nAChRs. Acetylcholine acting on EAT-2 containing nAChRs in the pharynx is a main driver of fast pumping (Chapter 3 and @mckay2004). EAT-2 is expressed in pm4 and pm5 muscle cells [@mckay2004], which make synaptic connections with the MC [@albertson1976]. The feeding response is markedly hindered in *eat-2 C. elegans* mutant [@raizen1995; @mckay2004]. Thus, selective expression of nAChRs in the pharyngeal muscle of *eat-2 C. elegans* mutant at the MC synapse should be a suitable platform for functional expression.
<!-- *C. elegans* pharynx is an attractive platform for investigation of drug sensitivity due to the availbailabiloty of assays scoring the pharyngeal function and the genetic knowledge of the pharyngeal muscle function. -->
<!-- The effects of drug application on the pharyngeal function can be investigated in the behavioural or cellular assays (Chapter 3 and 4). -->
<!-- Whereas function of the pharynx is mediated by nAChR containing EAT-2 subunit. EAT-2 nAChR subunit is present at the NMJ between the MC neuron and pharyngeal muscles of the metacorpus (pm4) and isthmus (pm5) [@mckay2004]. *Eat-2 C. elegans* knockout has profound behavioral and pharmacological phenotype (Chapter 4). Therefore, selective expression of nAChRs at the post-synapse of the MC neuron of *eat-2 C. elegans* mutant should be a useful platform for the nAChR functional expression. -->
### Chapter aim
The aim of this chapter is to develop the *C. elegans'* pharynx as a platform to heterologously expression and pharmacologically characterise exogenous nAChRs.
## Results
```{r echo=FALSE, results="hide", include=FALSE}
library(grid)
library(cowplot) #plot_grid
library(tidyverse)
library(ggpubr)
library(readr) #read_csv
library(ggplot2) #ggplot
library(scales)
library(curl)
library(devtools)
library(extrafont)
```
This chapter describes the development of the method for the heterologous expression of nAChRs in the *C. elegans* pharynx.
The literature suggests EAT-2 is a single molecular determinant of the fast pharyngeal pumping. The *Eat-2* knock-out strain has been shown to have reduced pharyngeal response to food and 5-HT [@mckay2004], which can be rescued by the expression of EAT-2 in the pharyngeal muscle, however no data was provided to support this claim. Additionally, the rescue strains are no longer available (personal communication). Therefore, the first step was to generate these strains and to confirm the function of EAT-2.
Transgenic lines were generated by the process of microinjection (Section \@ref(microinjection)). *eat-2 C. elegans* worms were injected with DNA construct containing *nAChR* cDNA downstream of the *myo-2* promoter, which drives expression in all muscle cells of the pharyngeal musculature [@altun2009a].
<!-- Receptors were expressed in nAChR mutant worms, to determine if mutant phenotype can be reversed. *Eat-2* was used because it is deficient in expression of a single EAT-2 nAChR in the pharynx and exhibits marked behavioural and pharmacological phenotype (ref to chapter 2). Native EAT-2 nAChRs were expressed in the pharyngeal muscle of *eat-2* mutant to determine if myo-2 is an appropriate promoter and if the *eat-2* phenotype can be rescued. -->
### Heterologous expression of native EAT-2 nAChRs in *C. elegans* pharyngeal muscle
#### Generation of the expression vector
The expression vector was cloned using Gateway cloning method (Section \@ref(gatewaycloning)). Briefly, *eat-2* coding DNA was PCR-amplified from the pTB207 vector (a gift from Dr. Cedric Neveu) Table \@ref(tab:eat2-amplification), (Figure \@ref(fig:eat2-pcr-label)). Adenosine overhangs were added to the PCR-product (Table \@ref(tab:a-overhangs-addition)), which was subsequently cloned into the TOPO vector (Table \@ref(tab:TA-reaction), Figure \@ref(fig:eat-topo-label)). Cloning success was tested by performing PCR with one gene specific and one insert specific primers (Figure \@ref(fig:topo-eat2-pcr-label)). *Eat-2* was then inserted into the expression vector by the recombination cloning (Section \@ref(lr-reaction-section) and Figure \@ref(fig:pdest-eat2-label)). This was authenticated by the analytical digestion (Figure \@ref(fig:pdest-eat2-label)) and sequencing (Appendix B).
(ref:eat2-pcr) **Amplification of *eat-2* gene.** *Eat-2* cDNA was amplified from pTB207 vector, gel excised and purified for downstream cloning. (a) Cartoon representation of the process of amplification of the gene by PCR including the expected PCR product size (b) Agarose gel of the PCR product with the corresponding size, against DNA ladder (M).
```{r eat2-pcr-label, fig.cap="(ref:eat2-pcr)", fig.align='center', out.height = '80%', fig.scap = "Amplification of \\textit{eat-2} gene.", echo=FALSE}
knitr::include_graphics("fig/results4/PNG/PCR_of_eat2.png")
```
(ref:eat-topo) **Insertion of *eat-2* into the TOPO vector.** (a) Cartoon representation of the process of generation *TOPO-eat-2* vector. 3’ A overhangs were added to the purified *eat-2* cDNA to enable TOPO cloning. *Eat-2* containing TOPO vector was digested with *EcoRI* which cuts at sites flanking the inserted *eat-2* gene yielding (b) 2 linear DNA fragments. (c) Agarose gel of non-digested *TOPO-eat-2* plasmid and the two bands following *EcoRI* digestion.
```{r eat-topo-label, fig.cap="(ref:eat-topo)", fig.scap = "Insertion of eat-2 into the TOPO vector.", fig.align='center', out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/Generation-of-PCR-8-eat2.png")
```
(ref:topo-eat2-pcr) **PCR of *eat-2* gene from the TOPO vector.** (a) Cartoon representation showing the positioning of primers used to PCR amplify *Eat-2* from TOPO vector using insert specific (*eat2-Fw*) and vector specific (*TOPO-Rev*) primers. Only clone containing *eat-2* inserted in the right direction should produce a PCR product of 1436 bp. (b) Picture of agarose gel of PCR product against DNA ladder (M).
```{r topo-eat2-pcr-label, fig.cap="(ref:topo-eat2-pcr)", fig.scap = "PCR of eat-2 from the TOPO vector.", fig.align='center',out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/PCR_of_eat2_from_TOPO_vector.png")
```
(ref:pdest-eat2) **The generation of the vector for the expression of EAT-2 nAChR in the *C. elegans* pharynx.** (a) Cartoon representation of the cloning process and location of *EcoRI* restriction sites within plasmids. *Eat-2* was cloned into the expression backbone vector downstream of the *myo-2* promoter. To identify successful clones, expression vector with and without the cloned *eat-2* were analytically digested with *EcoRI*. *EcoRI* cuts the backbone plasmid in two places producing 2 DNA fragments. In contrast, digestion of the plasmid containing the *eat-2* sequence yields 3 DNA fragments. (b) Picture of the agarose gel containing the digested plasmids against DNA ladder (M). Plasmid names and DNA fragment sizes are given on the gel.
```{r pdest-eat2-label, fig.cap="(ref:pdest-eat2)", fig.scap ="The generation of the vector for the expression of EAT-2 nAChR in the \\textit{C. elegans} pharynx.", out.width='70%', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/Generation_of_pDEST-pmyo2-eat2.png")
```
#### Generation of the transgenic strain
Transgenic strains were generated by the process of microinjection (Section \@ref(microinjection)). A DNA mix of vector containing EAT-2 gene and vector containing the selectivity marker was prepared. Selectivity marker was a vector containing GFP under the *myo-3* promoter (*pmyo-3*). Endogenous *myo-3* promoter drives the expression of myosin in the body wall muscle. Therefore by driving the expression of GFP with *pmyo-3*, worms will appear green under the fluorescence microscope. This enables identification of successfully transfected worms. Worms expressing GFP are also predicted to express another injected gene, in this case EAT-2.
64 adult *eat-2* worms were injected. 6 of those generated 33 green progeny. Only 2 of the 6 F1 produced green progeny- these were kept as stable lines. The genotype of these lines is *eat-2::pmyo3::GFP;pmyo2::eat-2*, but for simplicity, they will be referred to as *eat-2::eat-2* or *eat-2* rescue.
Alongside, a control line was generated in which GFP was expressed at the body wall muscle of *eat-2* mutant. Worms were injected with a plasmid DNA containing GFP gene. 32 worms were injected. There were 5 green progeny present on a single plate, one of which produced green offspring. This transgenic line was kept and used as a control. The genotype of this line is *eat-2::pmyo3::GFP*, but for simplicity, they will be referred to as *eat-2::GFP* or *eat-2* transgenic control line.
#### Feeding phenotype of eat-2 expressing transgenic lines ####{#behaviourofeat2rescue}
*Eat-2* mutant has an overt feeding phenotype (Figure \@ref(fig:mutant-pumping-label)), @mckay2004]). To determine whether the expression of *eat-2* under *myo-2* promoter rescues the feeding retardation of *eat-2* mutant, behavioural assays were carried out. The feeding phenotype of generated strains, *eat-2* mutant and wild-type *C. elegans* were assayed (Figure \@ref(fig:transgenic-feeding-label)). Worms were placed on an agar plate containing an OP50 food patch and pharyngeal pumping on food of adult worms was scored. Wild-type worms pumped at a rate of 4.65 Hz. This dropped to 0.94 and 0.89 Hz in *eat-2* mutant and *eat-2* transgenic control strain, respectively. The feeding phenotype of two *eat-2* rescue lines was assayed. Their feeding phenotypes did not differ (data not shown), therefore results were pooled. Expression of *eat-2* in *eat-2* mutant restored feeding rate to 3.12 Hz.
(ref:transgenic-feeding) **Pharyngeal pumping of *C. elegans* nicotinic acetylcholine receptor mutant and rescue strains.** Pharyngeal pumping on food of N2 wild-type, eat-2 mutant, eat-2 transgenic control strain (eat-2::GFP) and eat-2 rescue (eat-2::eat-2) strains. Pharyngeal pumps of worms present on food were counted by visual observation for 30 seconds and expressed in Hz. Data are mean $\pm$ SEM, collected from 10-46 individual worms on 3 days. One way ANOVA (Kruskal-Wallis test) with Sidak Corrections, $****$P $\le$ 0.0001.
```{r transgenic-feeding-label, fig.cap="(ref:transgenic-feeding)", fig.scap = "Pharyngeal pumping of \\textit{C. elegans} nicotinic acetylcholine receptor mutant and rescue strains.", fig.align='center', echo=FALSE}
# data <- read_csv("Analysis/Data/Transformed/chapter_4_data.csv") %>%
# select(-1)
#
# data1 <- mutate(data, Strain = factor(Strain,
# levels= c("N2", "acr-7", "N2::pmyo3::GFP", "N2::pmyo3::GFP_pmyo2::CHRNA7", "eat-2", "eat-2::pmyo3::GFP", "eat-2::pmyo3::GFP_pmyo2::CHRNA7", "eat-2::pmyo3::GFP_pmyo2::eat-2"),
# labels= c("N2", "acr-7", "N2::GFP", "N2::alpha7", "eat-2", "eat-2::GFP", "eat-2::alpha7", "eat-2::eat-2")))
#
#
# data2 <- mutate(data1, experiment = factor(experiment, levels = c("pumping_on_food", "5-HT", "nic_cuthead_transg", "choline_cuthead_transg", "cytisine_cuthead_transg", "choline-cuthead", "ach_epg", "nic_epg")))
#
# data3 <- mutate(data2, Concentration = factor(Concentration,
# levels=c("not", "5-HT", "100nM", "1uM", "10uM", "20uM", "50uM", "100uM", "1mM"),
# labels=c("not", "0", "0.1", "1", "10", "20", "50", "100", "1000")))
#
# stats <- data3 %>%
# group_by(experiment, Strain, Concentration, Time) %>%
# summarise(mean_pumping = mean(Pumps30s),
# n=n(),
# sd = sd (Pumps30s),
# se = sd/sqrt(length(Pumps30s)))
#
#
# #plot <-
# stats1 <- stats %>%
# filter(experiment == "pumping_on_food" & Strain %in% c("N2", "eat-2", "eat-2::GFP", "eat-2::eat-2")) #here i am selecting by mutliple variables. %in% means select listed oservations in Strain variable % only include specified experiment
#
# plot <- ggplot(stats1, aes(x=Strain, y=mean_pumping)) +
# geom_bar(stat = "identity", fill= "grey" ) +
# geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) +
# ylab("Pumping (HZ)") +
# ylim(0, 5) +
# theme(axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# axis.text = element_text(size=12),
# axis.text.x=element_text(angle=90)) +
# ggsave("fig/results4/eat2rescue_feeding.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results4/PNG/eat2rescue_feeding_2.png")
```
#### Effects of 5-HT on pharyngeal pumping
The effects of 5-HT on pharyngeal pumping was scored to determine if expression of eat-2 in *eat-2* mutant worms rescues their 5-HT insensitivity (Figure \@ref(fig:DR-5HT-cuthead-2-label)). Cut-heads were used in this experiment and worms were exposed to 1 $\mu$M 5-HT because this dose elicits maximum response in the wild-type strain (Figure \@ref(fig:DR-5HT-cuthead-label)). After 30 minutes of incubation, the effects of 5-HT on pumping was scored (Figure \@ref(fig:eat-2-rescue-label)). Wild-type pharynxes pumped at a rate of 3.00 Hz. This was reduced to 0.89 and 0.91 Hz in *eat-2* mutant and *eat-2* mutant expressing GFP. Transgenic lines were scored separately. The pharyngeal pumping rate induced by 5-HT did not differ between lines, hence the results were pooled. Rescue *eat-2* worms pumped at an average rate of 2.97 Hz.
(ref:eat-2-rescue) **The effects of 5-HT on wild-type, *eat-2* mutant and *eat-2* rescue strains.** Cut heads of wild-type, *eat-2* mutant, transgenic control and rescue strains were incubated with 1 $\mu$M 5-HT or control vehicle. 30 minutes later, the effects of 5-HT on pumping was scored. Pharyngeal pumping was counted by visual observation for 30 seconds and expressed in Hz. Data are mean $\pm$ SEM of 7 - 30 worms collected from paired experiments done on 2 days. $****$P $\le$ 0.0001.
```{r eat-2-rescue-label, fig.cap = "(ref:eat-2-rescue)", fig.scap = "The effects of 5-HT on wild-type, \\textit{eat-2} mutant and \\textit{eat-2} rescue strains.", fig.align='center', echo=FALSE}
# plot2 <- filter(stats, experiment == "5-HT" & Strain %in% c("N2", "eat-2", "eat-2::GFP", "eat-2::eat-2")) %>%
# ggplot(aes(x=Strain, y=mean_pumping)) +
# geom_bar(stat = "identity", fill= "grey" ) +
# geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) +
# ylab("Pumping (HZ)") +
# ylim(0, 5) +
# theme(axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# axis.text = element_text(size=12)) +
# ggsave("fig/results4/eat2rescue_5ht.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results4/PNG/eat2rescue_5ht_2.png")
```
### Heterologous expression of human $\alpha7$ nAChRs in *C. elegans* pharyngeal muscle
To test whether successful expression of non-native nAChRs can be achieved, human $\alpha7$ receptor was introduced into the *C. elegans* pharynx. This receptor was chosen because it is homopentameric [@couturier1990; @cooper1997; @gu2016], therefore does not need to interact with other subunits to form a functional receptor. Additionally, its pharmacology has been thoroughly studied [@papke2002].
Two approaches were taken as they provide alternative ways of assessing the functionality of the introduced receptor.
First, human $\alpha7$ encoding gene (CHRNA7) was introduced into the *eat-2* background to determine whether the *eat-2* mutant behavioural and pharmacological phenotype can be reversed.
Alongside, CHRNA7 was introduced into the wild-type background of *C. elegans* to determine whether the pharmacology of $\alpha7$ receptor can be imposed on the pharynx.
#### Generation of the expression vector
A cDNA sequence was inserted downstream of *myo-2* promoter by LR recombination. Briefly, CHRNA7 was PCR amplified from *pDNA3.1* vector (AddGene plasmid #62276) using flanking primers (Table \@ref(tab:primer-seq1), Table \@ref(tab:CHRNA7-amplification) and Figure \@ref(fig:CHRNA7-amplification2-label)). Amplified PCR product was gel-purified and incubated with non-proofreading PCR polymerase to add 3' A-overhangs. This enabled cloning into the TOPO vector (Figure \@ref(fig:PCR8-CHRNA7-label) a). Produced plasmid was analytically digested with *EcoRI* (Figure \@ref(fig:PCR8-CHRNA7-label) b).
(ref:CHRNA7-amplification2) **Amplification of the gene encoding for human $\alpha7$ subunit of nAChR.** (a) Cartoon representation of the process of amplification of CHRNA7 by PCR. CHRNA7 was amplified from pcDNA3.1 vector, gel excised and purified for downstream cloning. (b) Picture of the agarose gel of the PCR products of 1509 bp against DNA ladder (M).
```{r CHRNA7-amplification2-label, fig.cap="(ref:CHRNA7-amplification2)", fig.scap = "Amplification of the gene encoding for human $\\alpha7$ subunit of nAChR.", fig.align='center', out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/PCR_of_CHRNA7.png")
```
(ref:PCR8-CHRNA7) **Insertion of CHRNA7 into the TOPO vector.** (a) Cartoon representation of generation of TOPO-CHRNA7 vector. 3’ A overhangs were added to the purified PCR product to enable TOPO cloning. CHRNA7 containing TOPO vector was digested with *EcoRI* which cuts at sites flanking and within the
inserted gene, yielding 3 linear DNA fragments. (b) Schematic representation (left) and an agarose gel (right) of DNA fragments generated upon *EcoRI* digestion against DNA ladder (M).
```{r PCR8-CHRNA7-label, fig.cap="(ref:PCR8-CHRNA7)", fig.scap = "Insertion of CHRNA7 into the TOPO vector.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/Generation-of-PCR-8-CHRNA7.png")
```
CHRNA7 was then cloned into the *pDEST* expression vector downstream of the *myo-2* promoter by LT recombination (Figure \@ref(fig:pdest-chrna7-cloning-label)). Four clones were analysed by digestion. A single positive clone (clone number 4 in lane 5 of the agarose gel in Figure \@ref(fig:pdest-chrna7-cloning-label) b) was selected, sequenced and used in downstream experiments. The entire *pmyo-2::CHRNA7* sequence can be found in the Appendix C.
(ref:pdest-chrna7-cloning) **Generation of the vector for the expression of $\alpha7$ nAChR in the *C. elegans* pharynx.** (a) CHRNA7 gene was cloned into the pDEST expression vector downstream of the *myo-2* promoter. Four clones of the generated plasmid and the backbone *pDEST* plasmid were digested with *EcoRI*. The *EcoRI* restriction sites within the backbone plasmid and the cloned plasmid are shown in a. (b) The resulting DNA fragments were run on the agarose gel. Digestion of *pDEST* backbone results in the generation of 2 fragments (Line 1 on the gel), where digestion of CHRNA7-containing plasmid yields 4 fragments (Lines 2-5).
```{r pdest-chrna7-cloning-label, fig.cap="(ref:pdest-chrna7-cloning)", fig.scap = "Generation of the vector for the expression of $\\alpha7$ nAChR in the \\textit{C. elegans} pharynx.", fig.align='center', out.height = '80%', echo=FALSE, message=FALSE}
knitr::include_graphics("fig/results4/PNG/Generation_of_pDEST-pmyo2-CHRNA7_2.png")
```
#### Generation of *eat-2* transgenic strain ####{#eat2charn2microinjection}
Transgenic worms were generated by microinjection. DNA mix containing two plasmids: CHRNA7 downstream of *myo-2* promoter and GFP downstream of *myo-3* promoter was prepared. 64 adult *eat-2* worms were injected. 3 plates contained a total of 23 green progeny. These 23 worms were separated and allowed to propagate. Green offspring were found on three plates. These plates were kept separately and treated as individual worm lines. The genotype of these lines is *eat-2::pmyo3::GFP;pmyo2::$\alpha7$*, but for simplicity, they will be referred to as *eat-2::$\alpha7$*.
The three *eat-2::$\alpha7$* lines were assayed separately. The behavioural output did not differ (data not shown), therefore the results were pooled.
A control strain in which GFP is expressed at the body wall muscle was generated previously.
#### Generation of N2 transgenic strain
59 adult N2 worms were injected with the DNA mix used previously (Section \@ref(eat2charn2microinjection)). 12 plates contained a total of 74 green progeny. These 74 worms were separated and allowed to propagate. Green offspring were found on two plates. These plates were kept separately and treated as individual worm lines. The genotype of these lines is *N2::pmyo3::GFP;pmyo2::$\alpha7$*, but for simplicity, they will be referred to as *N2::$\alpha7$*, or N2 transgenic. Their behavioural output did not differ (data not shown), therefore the results were pooled.
A control strain in which GFP is expressed at the body wall muscle was also generated. 8 worms were injected with the GFP containing vector. 2 generated 8 green offspring. 1 line was stable. The genotype of this line is *N2::pmyo3::GFP*, simply *N2::GFP* or N2 transgenic control line.
#### Feeding phenotype of transgenic lines ####{#feedingalpha7celegans}
The feeding phenotype of wild-type, *eat-2* mutant, $\alpha7$-expressing and control lines were assayed. Worms were placed on agar plate containing a food patch and the pharyngeal pumping was scored (Figure \@ref(fig:feeding-chrna7-transgenic-label)).
The feeding phenotype of worms did not change upon introduction of human $\alpha7$ in the pharynx. N2 wild-type, and transgenic *C. elegans* pumped at an average rate of 4.64 - 4.68 Hz. Pharyngeal pumping of *eat-2* mutant and *eat-2* transgenic worms varied between 0.89 and 0.98 Hz.
(ref:feeding-chrna7-transgenic) **Effects of human $\alpha7$ nAChR expression on the feeding phenotype of *C. elegans*.** Pharyngeal pumping of N2 wild-type, *eat-2* mutant, transgenic strains expressing human $\alpha7$ nAChR in the pharyngeal muscle (*N2::alpha7* and *eat-2*-alpha7) and transgenic control worms (*N2::GFP* and *eat-2-GFP*). Pharyngeal pumps of worms present on food were counted by visual observation for 30 seconds and expressed in Hz. Data are mean $\pm$ SEM, collected from 7-30 individual worms on 3 days. One way ANOVA (Kruskal-Wallis test) with Sidak Corrections.
```{r feeding-chrna7-transgenic-label, fig.cap="(ref:feeding-chrna7-transgenic)", fig.scap = "Effects of human $\\alpha7$ nAChR expression on the feeding phenotype of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
# stats2 <- stats %>%
# filter(experiment == "pumping_on_food" & Strain %in% c("N2", "N2::GFP", "N2::alpha7", "eat-2", "eat-2::GFP", "eat-2::alpha7")) # here i am selecting by mutliple variables. %in% means select listed oservations in Strain variable % only include specified experiment
#
# plot3 <- ggplot(stats2, aes(x=Strain, y=mean_pumping)) +
# geom_bar(stat = "identity", fill= "grey" ) +
# geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) +
# ylab("Pumping (HZ)") +
# ylim(0, 5) +
# theme(axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# axis.text = element_text(size=12),
# axis.text.x=element_text(angle=90)) +
# ggsave("fig/results4/rescuechrna7_feeding.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results4/PNG/rescuechrna7_feeding_2.png")
```
#### Effects of 5-HT on pharyngeal pumping ####{#htandtransgenicalpha7}
The effects of 5-HT on the pharyngeal pumping of wild-type, *eat-* mutant, transgenic and transgenic control worms expressing human receptor was assayed. (Figure \@ref(fig:human-transgenic-rescue-label)). Cut-heads were bathed in 1 $\mu$M 5-HT. 30 minutes later, the effects on pharyngeal pumping were scored.
Introduction of human $\alpha7$ receptor into the pharynx had no effect on the pharyngeal responses to 5-HT. After 30 minutes of incubation, the pharyngeal pumping of transgenic and control *C. elegans* did not differ.
(ref:human-transgenic-rescue) **Effects of human $\alpha7$ nAChR expression on the 5-HT induced pharyngeal pumping of *C. elegans*.** The effects of 5-HT on N2 wild-type, *eat-2* mutant, transgenic strains expressing human $\alpha7$ 7 nAChR in the pharyngeal muscle (N2::alpha7 and *eat-2*-alpha7) and transgenic control worms (N2::GFP and *eat-2*-GFP). Cut heads were incubated with 1 $\mu$M 5-HT or control vehicle. 30 minutes later, the effects of 5-HT on pumping was scored. Pharyngeal pumping was measured by counting the number of pharyngeal pumps/30s and expressed in Hz. Data are mean $\pm$ SEM of 7 - 30 worms collected from paired experiments done on 3 days.
```{r human-transgenic-rescue-label, fig.cap = "(ref:human-transgenic-rescue)", fig.scap = "Effects of human $\\alpha7$ nAChR expression on the 5-HT induced pharyngeal pumping of \\textit{C. elegans}.", fig.align='center', echo=FALSE}
# plot4 <- filter(stats, experiment == "5-HT" & Strain %in% c("N2", "N2::GFP", "N2::alpha7", "eat-2", "eat-2::GFP", "eat-2::alpha7")) %>%
# ggplot(aes(x=Strain, y=mean_pumping)) +
# geom_bar(stat = "identity", fill= "grey" ) +
# geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) +
# ylab("Pumping (HZ)") +
# ylim(0, 5) +
# theme(axis.title.x = element_blank(),
# axis.title = element_text(size=12),
# axis.text = element_text(size=12),
# axis.text.x=element_text(angle=90)) +
# ggsave("fig/results4/rescuechrna7_5ht.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results4/PNG/rescuechrna7_5ht_2.png")
```
### Pharmacological characterisation of $\alpha7$ expressing worms ####{#pharmaalpha7transegnicworms}
The experiments utilizing the pharyngeal pump phenotype on food and in the presence of 5-HT suggest lack of functionality of the introduced receptor. However, the experiments that we used may not be sensitive enough to be able to detect functional expression of the $\alpha7$ receptors. Thus, we extended the analysis to investigate the pharmacological sensitivity with the aim of determining if the transgenic lines heterologously expressing $\alpha7$ exhibit known $\alpha7$ pharmacology.
To asses whether the introduction of receptor into the pharynx of wild-type worms imposes $\alpha7$ pharmacology on the pharyngeal system, a series of pharyngeal assays were performed. nAChR agonists were tested to determine if there is a differential sensitivity between the N2 wild-type and transgenic worms. Compounds tested were acetylcholine, nicotine, choline and cytisine.
Effects of nAChR agonist on 5-HT induced pharyngeal pumping on cut-heads were tested. Cut heads were exposed to 1 $\mu$M 5-HT for 10 minutes. Following this the activated pharynxes were transferred to a dish containing 5-HT and nAChR agonist and the effects of an agonist on 5-HT induced pumping was scored for 50 minutes (Figure \@ref(fig:nicotine-label), \@ref(fig:5HTcholine-label), \@ref(fig:cytisine-label)).
Exposure to 5-HT results in dose and time dependent elevation of the pharyngeal pumping that is indifferent in the wild-type and the transgenic lines. Exposure to nAChR agonists leads to dose-dependent inhibition of this response.
Exposure of cut heads to nicotine from 1 to 50 $\mu$M, resulted in concentration-dependent inhibition of pumping in both wild-type and transgenic strains (Figure \@ref(fig:nicotine-label)). The IC~50 values were comparable: 13 and 11 $\mu$M, respectively indicating no shift in the sensitivity to nicotine upon introduction of human receptor in the *C. elegans* pharynx.
(ref:nicotine) **The effects of human $\alpha7$ 7 nAChR expression on the nicotine-induced inhibition of 5-HT evoked pumping.** Cut heads of wild-type (N2) and transgenic worms expressing human $\alpha7$ in the pharynx (*N2::alpha7*) were exposed for 10 minutes to 1 $\mu$M 5-HT to stimulated pumping. They were then transferred to 5-HT + indicated concentration of nicotine or vehicle control. a) The effects on pharyngeal pumping pre- (time point 0) and post- nicotine exposure were scored by visual observation for 30 seconds and expressed in Hz. b) 35-minute time points were taken, and normalised to the maximal (5-HT induced) and minimal response. Data are mean $\pm$ SEM from 5 - 10 individual worms collected from paired experiments done on 2 days.
```{r nicotine-label, fig.cap="(ref:nicotine)", fig.scap = "The effects of human $\\alpha7$ nAChR expression on the nicotine-induced inhibition of 5-HT evoked pumping.", fig.align='center', echo=FALSE}
# plot5 <- filter(stats, experiment == "nic_cuthead_transg") %>%
# group_by(Strain, Concentration, Time) %>%
# filter(Time <= 50) %>%
# ggplot(aes(Time, mean_pumping, colour = Concentration)) +
# geom_line(size=1) +
# geom_point() +
# geom_errorbar(aes(ymin = mean_pumping-se, ymax = mean_pumping+se)) +
# facet_wrap(~Strain) +
# xlab("Time (mins)") +
# ylab("Pumping (Hz)") +
# scale_y_continuous(breaks = seq(0, 6, by = 1)) +
# labs(colour=expression(Nicotine~mu*M), parse = TRUE) +
# theme(legend.position = "top",
# axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size = 12),
# legend.text=element_text(size=11),
# text= element_text(size=12, family="sans")) + ggsave("fig/results4/raw_images/nic_cuthead.pdf", width = 15, height = 9, units = "cm")
knitr::include_graphics("fig/results4/PNG/nicotine_cuthead.png")
```
The responses of both strains to choline concentrations ranging from at 1 $\mu$M to 1 mM were also indiscernible (Figure \@ref(fig:5HTcholine-label)). Choline inhibited 5-HT evoked pumping of the wild-type worms with the IC50 of 22 $\mu$M. The IC50 of choline on transgenic line was 15 $\mu$M.
(ref:5HTcholine) **The effects of human $\alpha7$ nAChR expression on the choline-induced inhibition of 5-HT evoked pumping.** Cut heads of wild-type (N2) and transgenic worms expressing human $\alpha7$ in the pharynx (N2::alpha7) were exposed for 10 minutes to 1 $\mu$M 5-HT to stimulated pumping. They were then transferred to 5-HT + indicated concentration of choline or vehicle control. a) The effects on pharyngeal pumping pre- (time point 0) and post- nicotine exposure were scored by visual observation for 30 seconds and expressed in Hz. b) 2-minute time points were taken, and normalised to the maximal (5-HT induced) and minimal response. Data are mean $\pm$ SEM from 3 - 12 individual worms collected from paired experiments done on 2 days.
```{r 5HTcholine-label, fig.cap="(ref:5HTcholine)", fig.scap = "The effects of human $\\alpha7$ nAChR expression on the choline-induced inhibition of 5-HT evoked pumping.", fig.align='center', echo=FALSE}
# plot6 <- filter(stats, experiment == "choline_cuthead_transg") %>%
# group_by(Strain, Concentration, Time) %>%
# filter(Time <= 50) %>%
# ggplot(aes(Time, mean_pumping, colour = Concentration)) +
# geom_line(size=1) +
# geom_point() +
# geom_errorbar(aes(ymin = mean_pumping-se, ymax = mean_pumping+se)) +
# facet_wrap(~Strain) +
# xlab("Time (mins)") +
# ylab("Pumping (Hz)") +
# scale_y_continuous(breaks = seq(0, 6, by = 1)) +
# labs(colour=expression(Choline~mu*M), parse = TRUE) +
# theme(legend.position = "top",
# axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size = 12),
# legend.text=element_text(size=11),
# text= element_text(size=12, family="sans")) + ggsave("fig/results4/raw_images/choline_cuthead.pdf", width = 15, height = 9, units = "cm")
knitr::include_graphics("fig/results4/PNG/choline_cuthead.png")
```
Wild-type cut-head were also exposed to cytisine at 100 nM, 1, 10 and 50 $\mu$M (Figure \@ref(fig:cytisine-label) a left panel). The two lowest doses had no effect on 5-HT induced pumping. 10 $\mu$M inhibited pumping almost completely and transiently after 2 minutes of incubation. After 10 minutes, the pumping rate was comparable to the control. Comparing the effects of cytisine on 5-HT evoked pumping of N2 wild-type to the effects on transgenic worms revealed a difference at a single dose of 50 $\mu$ M (Figure \@ref(fig:cytisine-label) a and b). In wild-type, cytisine rapidly inhibited pumping. Pharynxes remained paralysed for 10 minutes. They began to progressively recover, however the rate of the control was not reached. Transgenic pharynxes also remained paralysed for 10 minutes, however, pumping returned to a rate comparable to control after 20 minutes.
(ref:cytisine) **The effects of human $\alpha7$ nAChR expression on the cytisine-induced inhibition of 5-HT evoked pumping.** (a) Cut heads of wild-type (N2) and transgenic worms expressing human $\alpha7$ in the pharynx (N2::alpha7) were exposed for 10 minutes to 1 $\mu$M 5-HT to stimulate pumping. They were then transferred to 5-HT + indicated concentration of cytisine or vehicle control. The effects on pharyngeal pumping pre- (time point 0) and post- nicotine exposure were scored by visual observation for 30 seconds and expressed in Hz. b) Comparison of the 50 $\mu$M cytisine to show the difference in pharyngeal response between N2 and N2 transgenic worms. Data are mean $\pm$ SEM from 5 - 14 individual worms collected from paired experiments done on 2 days.
```{r cytisine-label, fig.cap="(ref:cytisine)", fig.scap = "The effects of human $\\alpha7$ nAChR expression on the cytisine-induced inhibition of 5-HT evoked pumping.", fig.align='center', echo=FALSE, fig.asp= 1.2}
# plot7 <- filter(stats, experiment == "cytisine_cuthead_transg") %>%
# group_by(Strain, Concentration, Time) %>%
# filter(Time <= 50) %>%
# ggplot(aes(Time, mean_pumping, colour = Concentration)) +
# geom_line(size=1) +
# geom_point() +
# geom_errorbar(aes(ymin = mean_pumping-se, ymax = mean_pumping+se)) +
# facet_wrap(~Strain) +
# xlab("Time (mins)") +
# ylab("Pumping (Hz)") +
# scale_y_continuous(breaks = seq(0, 6, by = 1)) +
# labs(colour=expression(Cytisine~mu*M), parse = TRUE) +
# theme(legend.position = "top",
# axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size = 12),
# legend.text=element_text(size=11),
# text= element_text(size=12, family="sans"))
#
#
# stats4 <- filter(stats, experiment == "cytisine_cuthead_transg") %>%
# group_by(Strain, Concentration, Time) %>%
# filter(Time == 20) %>%
# filter(Concentration != "0")
# stats4$Concentration <- as.numeric(as.character(stats4$Concentration))
#
# plot9 <- stats4 %>%
# ggplot(aes(Concentration, mean_pumping, colour = Strain)) +
# geom_line(size=1) +
# geom_point() +
# geom_errorbar(aes(ymin = mean_pumping-se, ymax = mean_pumping+se)) +
# xlab(label=expression(Cytisine~mu*M)) +
# ylab("Pumping (Hz)") +
# scale_y_continuous(breaks = seq(0, 5.5, by = 1)) +
# theme(legend.position = "top",
# axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size = 12),
# legend.text=element_text(size=11),
# text= element_text(size=12, family="sans"))
# plot9 <- filter(stats, experiment == "cytisine_cuthead_transg") %>%
# group_by(Time, Strain) %>%
# filter(Time <= 50) %>%
# filter(Concentration == 50) %>%
# ggplot(aes(Time, mean_pumping, colour = Strain)) +
# geom_line(size=1) +
# geom_point() +
# geom_errorbar(aes(ymin = mean_pumping-se, ymax = mean_pumping+se)) +
# xlab("Time (mins)") +
# ylab("Pumping (Hz)") +
# scale_color_manual(values=c('#333333','#CCCCCC')) +
# scale_y_continuous(breaks = seq(0, 6, by = 1)) +
# labs(colour=expression(Strain), parse = TRUE) +
# theme(legend.position = "top",
# axis.text = element_text(size=12),
# axis.title = element_text(size=12),
# strip.text.x = element_text(size = 12),
# legend.text=element_text(size=11),
# text= element_text(size=12, family="sans"))
#
# a <- plot_grid(plot7, plot9, nrow =2, labels = c("a", "b"))
# a <- ggsave("fig/results4/raw_images/cytisine_cuthead.pdf", width = 15, height = 18, units = "cm")
knitr::include_graphics("fig/results4/PNG/cytisine_cuthead_2.png")
```
<!-- (ref:nicotineDR) The effects of human $\alpha$ 7 nAChR expression in the pharynx on the nicotine-induced pharyngeal pumping of *C. elegans*. N2 wild-type, N2 transgenic (N2::alpha7) and N2 transgenic control (N2::gfp) cut heads were exposed to varying concentrations of nicotine. The number of pharyngeal pumps over 30 s at 30 minute time points were taken and expressed in Hz. Data are mean $\pm$ SEM of 4-14 individual worms collected from paired experiemnts done on 2 days. For comparison, the maximum pumping achieved by 5-HT is shown in dashed line. -->
<!-- ```{r nicotineDR-label, fig.cap="(ref:nicotineDR)", echo=FALSE} -->
<!-- knitr::include_graphics("fig/results4/PNG/Nicotine_DR_30_mins.png") -->
<!-- ``` -->
<!-- (ref:choline) The effects of heterologous human nAChR expression in the pharynx on choline induced pharyngeal pumping. N2 wild-type, N2 transgenic (N2::alpha7) and N2 transgenic control (N2::gfp) cut heads were exposed to 1 mM choline. The number of pharyngeal pumps pre- (time point 0) and post-choline exposure was recorded over time. Pharyngeal pumps were scored by visual counting the number of pumps in 30 expressed in Hz. Data are mean $\pm$ SEM of 9-17 individual worms collected from paired experiemnts done on 2 days. -->
<!-- ```{r choline-label, fig.cap="(ref:choline)", echo=FALSE} -->
<!-- plot10 <- filter(stats, experiment == "choline-cuthead") %>% -->
<!-- group_by(Strain, Time)%>% -->
<!-- ggplot(aes(Time, mean_pumping, colour = Strain)) + -->
<!-- geom_line(size=1) + -->
<!-- geom_point() + -->
<!-- geom_errorbar(aes(ymin = mean_pumping-se, ymax = mean_pumping+se)) + -->
<!-- xlab("Time (mins)") + -->
<!-- ylab("Pumping (Hz)") + -->
<!-- scale_y_continuous(breaks = seq(0, 5.5, by = 1)) + -->
<!-- theme(legend.position = "top", -->
<!-- axis.text = element_text(size=12), -->
<!-- axis.title = element_text(size=12), -->
<!-- strip.text.x = element_text(size = 12), -->
<!-- legend.text=element_text(size=11), -->
<!-- text= element_text(size=12, family="sans")) -->
<!-- plot10 -->
<!-- ``` -->
<!-- Application of 5-HT prior to exposure to drugs may musk the effects of drugs. Thus, in the second set of experiments, drugs were applied on ustimulated pharynx. The efefects of nicotine and acetylcholine on unstimulated pharynx of N2 wild-type and $\alpha$ 7 expressing worms were tested in electrophysiological experiments. Cut heads were perfused with drugs for 5 minutes and the effects on peak pumping frequency was tested. -->
<!-- It was previously shown that acetylcholine stimulated pumping frequency with the EC50 of 22 $\mu$M (Figure \@ref(fig:ach-train-label)). 1 $\mu$M is a dose close to the EC~50~ and it was chosen to determine if introduction of $\alpha7$ into the wild-type pharynx alters pharyngeal responses to ACh. There was no difference between the pumping frequency of N2 wild type and transgenic strain (Figure \@ref(fig:epg-acetylcholine-transg-label)). The pumping frequency was 0.67 and 0.47, respectively. -->
<!-- (ref:epg-acetylcholine-transg) The effects of human $\alpha7$ nAChR expression on acetylcholine induced EPG frequency. N2 wild-type and N2 transgenic (N2::alpha7) cut heads were perfused with 1 $\mu$M acetylcholine for 5 minutes. Data are mean $\pm$ SEM of 3 individual worms collected from paired experiemnts done on 2 days. -->
<!-- ```{r epg-acetylcholine-transg-label, fig.cap="(ref:epg-acetylcholine-transg)", echo=FALSE} -->
<!-- plot11 <- stats %>% -->
<!-- filter(experiment == "ach_epg") %>% -->
<!-- ggplot (aes(x=Strain, y=mean_pumping)) + -->
<!-- geom_bar(stat = "identity", fill= "grey" ) + -->
<!-- geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) + -->
<!-- ylab("peak pumping (HZ)") + -->
<!-- ylim(0, 1) + -->
<!-- theme(axis.title.x = element_blank(), -->
<!-- axis.title = element_text(size=12), -->
<!-- axis.text = element_text(size=12), -->
<!-- axis.text.x=element_text(angle=90)) -->
<!-- plot11 -->
<!-- ``` -->
<!-- Nicotine induces stimulation of the EPG frequency of wild-type worms with the EC~50~ of 2.7 $\mu$M (Rifure \@ref(fig:epg-nic-graphs-label)). 1 $\mu$M is close to EC~50~ and it weakly stimulates pumping for the duration of the EPG recording (Figure \@ref(fig:nic-epg-traces-label)). Therefore N2 wild-type and $\alpha$ 7 expressing cut heads were exposed to 1 $\mu$M nicotine to determine if expression of human receptor alters pharyngeal responses to this drug. There was no difference between nicotine-induced pumping frequency between the strains (Figure \@ref(fig:nicotine-epg-transg-label). The peak frequency was 1.1 $\pm$ 0.4 in wild-type and 2.1 $\pm$ 0.6 Hz in the transgenic worms. -->
<!-- (ref:nicotine-epg-transg) The effects of human $\alpha$ 7 nAChR expression on nicotine induced EPG frequency. N2 wild-type and N2 transgenic (N2::alpha7) cut heads were perfused with 1 $\mu$M nicotine for 5 minutes. The peak pumping rate in a 10s window was ploted. Data are mean $\pm$ SEM of 5-8 individual worms collected from experiemnts done on $\ge$ 3 days. -->
<!-- ```{r nicotine-epg-transg-label, fig.cap = "(ref:nicotine-epg-transg)", echo=FALSE} -->
<!-- plot12 <- stats %>% -->
<!-- filter(experiment == "nic_epg") %>% -->
<!-- ggplot (aes(x=Strain, y=mean_pumping)) + -->
<!-- geom_bar(stat = "identity", fill= "grey" ) + -->
<!-- geom_errorbar(aes(ymin=mean_pumping-se, ymax=mean_pumping+se, width = 0.4)) + -->
<!-- ylab("peak pumping (HZ)") + -->
<!-- ylim(0, 5) + -->
<!-- theme(axis.title.x = element_blank(), -->
<!-- axis.title = element_text(size=12), -->
<!-- axis.text = element_text(size=12), -->
<!-- axis.text.x=element_text(angle=90)) -->
<!-- plot12 -->
<!-- ```
The work above utilized 3 distinct functional criteria to address the possible expression. Based on phenotypic rescue of the pharmacological sensitivity, there is little indication that the mammalian $\alpha7$ is expressed. However, the cytisine effects hint at change in sensitivity of the system.
To better determine if the introduced human receptor is expressed in *C. elegans*, staining of pharynxes with FITC-$\alpha$-Bgtx was carried out. $\alpha$-Bgtx is a high affinity toxin that acts as a selective antagonist of human $\alpha7$ nAChRs and it binds to the extracellular domain of this receptor. $\alpha$-Bgtx conjugated with a fluorescent reagent can be utilized to histologically define expression and resolve sub-cellur localisation of $\alpha7$ receptor in mammalian tissue and *C. elegans* [@barnard1971, @jensen2012]. This technique has been used to shown that $\alpha$-Bgtx binds to receptors at the body wall muscle [@jensen2012] and to the nAChR axillary subunit EAT-18 in the pharynx [@mckay2004].
However, it has little antagonistsic effect on the body wall receptors [@boulin2008, @abongwa2016] and on the pharyngeal receptors (preliminary data not shown). -->
#### $\alpha$-Bgtx staining ####{#bgtxstaining}
To determine if FITC-$\alpha$-bgtx binds to native nAChRs, an isolated pharynx was used (Section \@ref(fitcmethod) and Figure \@ref(fig:exposed-pharynx-label)). In this preparation, there is no cuticular barrier, therefore, $\alpha$-Bgtx should access to the extracellular nAChR binding sites in the cell membrane of the pharyngeal muscle. Pharynxes were incubated with $\alpha$-Bgtx for 1 hour before being washed to remove unbound toxin.
Images of N2 wild-type and transgenic as well as *eat-2* mutant and transgenic pharynxes were taken (Figure \@ref(fig:staining-label)). There was either no fluorescence (12 out or 21 preparations) or very weak fluorescence in the corpus and/or terminal bulb of the wild-type and mutant strains. In comparison, exposure of transgenic pharynxes in which human $\alpha7$ was expressed in both *C. elegans* N2 wild-type and *eat-2* mutant strains led to strong fluorescence in the pharynx. Comparison of the fluorescence localisation to the localisation of muscle cells in the pharynx (Figure \@ref(fig:pharyngeal-muscle-label)) showed that the fluorescence was selectively present in the terminal bulb and largely localised to pm7 and pm8 muscle cells. Weak fluorescence was also observed in the isthmus and corpus, however this was inconsistent among preparations (6 out of 14).
(ref:staining) **The staining of *C. elegans* pharynxes with FITC-bungarotoxin (FITC-bgtx).** Representative images of the isolated pharynxes of N2 wild-type, *eat-2* mutant, and human $\alpha7$ nAChR expressing transgenic worms (N2::CHRNA7 and *eat-2*::CHRNA7). Isolated pharynxes were incubated with FITC-$\alpha$-Bgtx. 1 hour later, they were washed for 1 hour and imaged immediately after. Bright field (left column) and fluorescent images (middle column) were taken and superimposed (right column). Note that fluorescence posterior to the terminal bulb may represent staining of the extrapharyngeal structures [@mckay2004]. Scale bar (5 $\mu$M) is in the second top image on the left.
```{r staining-label, fig.cap="(ref:staining)", fig.scap = "The staining of \\textit{C. elegans} pharynxes with FITC-bungarotoxin (FITC-bgtx).", fig.align='center', echo = FALSE}
knitr::include_graphics("fig/results4/PNG/bgtx_1.png")
```
## Discussion
Understanding the molecular basis of the mode of action of insecticides is the first step towards development of more selective compounds. Neonicotinoids act by targeting nAChRs, but the receptor subunit specificity remains to be elucidated. Several other heterologous systems have been used for the expression of exogenous nAChR [@millar2009a]. However, to enable pharmacological characterisation of nAChRs, we focused on using the *C. elegans* system.
*C. elegans'* pharynx is an attractive platform firstly because it has low relative sensitivity to neonicotinoids (Chapter 4 and 5). Secondly, it expresses chaperone proteins including RIC-3 and UNC-50 that are known to be important in aiding the maturation of nAChRs [@millar2008a; @eimer2007]. Additionally, *C. elegans* has been previously used for the recombinant expression of ion channels, including potassium-activated calcium channels [@crisford2011] and nAChRs [@sloan2015]. Lastly, it allows for scoring of the functionality of introduced receptors in behavioural assays.
### *Eat-2* as a genetic background for functional nAChR expression
EAT-2 nAChR subunit is the single determinant of the fast pharyngeal function in the pharynx. Literature suggest that the *eat-2 C. elegans* mutant has profoundly altered feeding and disrupted cholinergic neurotransmission in the pharynx [@raizen1995]. These can be rescued by the re-introduction of the EAT-2 receptor into the pharyngeal muscle [@mckay2004]. Thus, the selective expression of the nAChR at the muscle should be a platform for the functional expression of the introduced receptor. However, *eat-2* transgenic strain used in @mckay2004 are no longer available and data supporting rescue was not provided in the publication. Therefore, the first step in this study was to generate *eat-2* rescue of *C. elegans*. Worms were injected with a DNA construct containing *eat-2* cDNA downstream of *myo-2* promoter. As a result, the expression of the nAChR was driven in the pharyngeal muscle of *C. elegans*.
The *eat-2* mutant and rescue strains were analysed behaviourally and pharmacologically. The intact mutant worms pump on food 70 % less than the wild-type. *Eat-2* worms are also relatively insensitive to the application of 5-HT in the cut-head pharyngeal pumping assays. Introduction of *eat-2* partially rescued the feeding phenotype of the mutant as measured by counting the number of pharyngeal pumps of the intact worms on the food patch. The insensitivity of the pharynx to 5-HT was reversed.
These results support the argument from Chapter 2, that EAT-2 nAChR is a major driver of the feeding response and the 5-HT induced pharyngeal response in worms. Whilst the 5-HT sensitivity was restored fully (5-HT induced pumping rate in wild-type was 3.00 Hz in comparison to 2.97 in transgenic lines), the pumping rate on food was not. Rescue lines pumped at rate slightly lower in comparison to the wild-type (3.12 vs 4.65 Hz). This lack of full rescue in feeding assay may suggest there are some differences in which pharyngeal pumping is elevated in response to food and 5-HT. Indeed, exogenous application of 5-HT acts directly onto pharyngeal nervous system to stimulate pumping.
<!-- Specifically, it activates MC and M4 neurons [@raizen1995; @niacaris2003]. These neurons in turn release ACh which acts on EAT-2 nAChR to stimulate pumping [@mckay2004]. -->
In contrast, food stimulates MC and M4 indirectly. Initially it was thought that food evoked response was mediated by 5-HT released from NSM neurons [@horvitz1982]. More recently it was shown that the release of 5-HT selectively from ADF neurons is sufficient to drive the feeding response [@cunningham2012]. 5-HT released from ADF activates ADJ neurons and MC and M3 neurons. MC and M3 release ACh leading to pharyngeal response. Therefore the 5-HT elevation caused by exogenous 5-HT application is likely to be more diffused in comparison to the 5-HT levels in response to food. 5-HT application in the presence of food causes a small increase in the pumping rate, indicative of the presence of circuits regulating feeding in response to 5-HT but not activated in the presence of food.
Although the reversal of the feeding deficiency and 5-HT insensitivity in rescue lines suggests that the *myo-2* promoter is suitable for the heterologous nAChR expression in the *C. elegans* pharynx, this promoter may also have some limitations.
Transgenic strain carrying myo2-GFP reporter gene, expresses GFP in all muscles of the pharynx [@altun2009a and (Figure \@ref(fig:pharyngeal-muscle-label)]. In contrast, the EAT-2 receptor in native worms is expressed at the NMJ of the MC and pm4 muscle (reference). Therefore, cellular EAT-2 expression driven by the native promoter, may be much more restricted in comparison to the expression driven by *myo-2* promoter.
### No apparent functionality of human $\alpha7$ receptors in the *eat-2* mutant pharynx
To determine whether exogenous nAChR can be successful expressed in *C. elegans*, human $\alpha7$ receptor was introduced into the pharynx. This receptor protein was chosen because it is known to function as a homopentamer, its pharmacology has been well studies, and there are a number of $\alpha7$ selective compounds which could be used to detect their functionality [@Mazurov2006].
A DNA construct containing $\alpha7$ nAChR cDNA was generated and authenticated by sequencing. This was used to generate transgenic lines that should drive expression in the pharyngeal muscle of N2 and *eat-2* strains. Introduction of human receptor into the *eat-2* pharynx did not rescue the feeding phenotype, nor did it reverse the 5-HT insensitivity. This could suggest that $\alpha7$ may not be capable of performing the function of EAT-2 possibly due to the biological and molecular distinct nature of the pharynx.
One of the unique feature of the pharynx is the presence of acetylcholine-gated chloride channels, expressed in cholinergic and glutamatergic neurons [@pereira2015; @takayanagi-kiya2016], which are involved in the regulation of the synaptic release and inhibition of the neurons they are expressed in.
The properties of EAT-2 channel differ from those of $\alpha7$. In contrast to $\alpha7$, EAT-2 is classified as a non-$\alpha$ subunit, due to the lack of vicinal cysteine in the extracellular domain. Typically, non- $\alpha$ subunit must assembly with $\alpha$ subunit to form a functional receptor, however, EAT-2 may function as a homooligomer, as observed by a current was elicited in response to application of nAChR agonist on the *Xenopus* oocyte injected with *eat-2* (Lindy Holden-Dye, personal communication).
The function of the EAT-2 is dependant on EAT-18 [@mckay2004]. EAT-18 is a single pass transmembrane protein of unclear function, but it seems critical in eliciting feeding response [@mckay2004]. The native EAT-2 channels are localised to the pm4 muscle of the pharynx [@mckay2004] in the juxtaposition to cholinergic MC neuron [@albertson1976]. Expressed $\alpha7$ is mainly localised to pm7 and pm8 which make synaptic connections with cholinergic motor neuron M5 [@albertson1976].
The EC~50~ for ACh acting on EAT-18-containing receptors is not known, but these receptors are likely activated by the phasically and synaptically released agonist. The EC~50~ of ACh on heterologously expressed $\alpha7$ is 173 $\mu$M [@papke2002]. The concentration of ACh in the pharynx may not be adequate to activate human receptors in response to 5-HT or food.
Taken together, the cellular environment, the differences in structure and functional properties as well as the likely different localisation of EAT-2 and $\alpha7$ receptors in the pharynx, may account for inability of the human receptor to perform the function of EAT-2 in the pharynx. If so, the feeding and 5-HT assays are not appropriate for the detection of $\alpha7$ functionality.
### Distinct response of the N2 transgenic worms to cytisine.
An alternative approach was taken, in which human receptor was introduced into the pharynx of the wild-type worm. $\alpha7$ is Ca^2+^ specific channel, so one might expect its ability to couple to muscle upon ACh activation. In addition, wide expression of $\alpha7$ driven by the *myo-2* promoter might result in the wide activation of ACh receptor, resulting in feeding behaviour that which could result in abnormal rate of growth [@halevi2002]. However, development of transgenic lines was normal and there was no subtle feeding phenotype observed.
Further experiments were carried out to determine whether pharmacology of $\alpha7$ receptor can be imposed on the *C. elegans* pharynx. In the presence of exogenous receptor that is selectively disrupted upon the application of the pharmacological agent, a change in pharyngeal response is expected. The function of the pharynx was scored in the presence of a series of nAChR agonist: acetylcholine, nicotine, cytisine and choline. The latter are selective $\alpha7$ agonists with the EC~50~ on the heterologously expressed $\alpha7$ receptors at 14.3 and 565 $\mu$M, respectively [@chavez-noriega1997; @briggs1996]. The ability of these compounds to inhibit 5-HT induced pharyngeal responses of cut heads were examined.
No differences between the wild-type and transgenic lines were noted in response to acetylcholine, nicotine and choline. The intrinsic sensitivity of the pharynx to these compounds precludes these experiment from being diagnostic for human $\alpha7$ expression.
Investigating the effects of cytisine on wild-type and transgenic lines shows an interesting difference in the kinetics of the response at a single dose of 50 $\mu$M. Following rapid inhibition of pumping, a pumping recovery was observed in the continual presence of cytisine in both genetic backgrounds. In wild-type, the recovery was slow. In contrast, transgenic lines recovered rapidly. However, it is unclear whether the recovery is due to cytisine acting on $\alpha7$, since these receptors desensitise rapidly in the presence of agonist and do not recover until the drug is washed off [@briggs1998].
Overall the intrinsic sensitivity of the pharynx to nAChR agonists confounds this approach to determine expression of endogenous receptor but it hints at distinct signature in terms of dynamic of the receptor activation in response to cytisine. Further experiments should be carried out to characterise the responses of the wild-type and transgenic lines in experiments emitting the 5-HT stimulation. The EPG approach should be taken to observe the early time points effects, prior to receptor desensitisation. The effects of choline and other selective nAChRs should be investigated on the wild-type and transgenic worms.
### $\alpha7$ receptors are expressed on the surface of the pharyngeal muscle.
The lack of significant behavioural and pharmacological differential between the transgenic and control strains suggests lack of functionality of these receptors in the *C. elegans* pharynx, or the inability to resolve the functional human receptor. To independently assess whether $\alpha7$ is expressed, staining of isolated pharynxes with conjugated $\alpha7$ nAChR selective antagonist FITC-$\alpha$-bgtx was carried out.
The lack of intense staining in wild-type suggest that pharynx does not endogenously express $\alpha7$-Bgtx sensitivity. This is in contrast with the body wall muscle where ACR-16 is readily detected by $\alpha$-bgtx [@jensen2012]. This reinforces the distinct nature of pharyngeal cholinergic receptors. In contrast, the robust detection of $\alpha$-bgtx-binding in excised transgenic heads was observed. $\alpha$-Bgtx can bind to partially assembled receptors. X-ray crystal structure of human $\alpha1$ shows $\alpha$-Bgtx binding to the extracellular domain of a single subunit, suggesting, a fully assembled receptor is not necessary for the binding of this antagonist [@dellisanti2007]. This may suggest that the expressed $\alpha7$ subunits are monomeric. However, nAChR assembly is strictly regulated in the cell [@crespi2018]. Incorrectly assembled receptors are degraded [@brodsky1999] or accumulate inside the cell [@han2000. In this study, there was no detergent permeabilization, thus, the robust $\alpha$-Bgtx staining is likely concentrated to extracellular cell surface. This favours the idea that staining is to the cell surface homopentamers.
The $\alpha$-bgtx staining of $\alpha7$ receptors is consistently localised to pm7 and pm8 muscle cells, and inconsistently in other muscle cells of the pharynx. The receptor expression is driven by the *myo-2* promoter, which should result in protein production in all muscle cells of the pharynx [@altun2009a], however selectivity has been observed previously (Anna Crisford, personal communication). In the endogenous system, EAT-2 functions at pm4, suggesting eat-2 promoter should be used to avoid restriction of endogenous promoter expression.
<!-- Bgtx-staining and pharyngeal pumping in the presence of cytisine experiments hint at the successful expression and function of endogenous receptor in *C. elegans*. However, it is also possible that $\alpha7$ is expressed in the muscle, but not functional. -->
<!-- <!-- Another chaperon in Nacho which is a NACHO - a TM neuronal ER protein important in receptor folding, assembly, maturation and surface expression - [@gu2016] - (read! Brain a 7 Nicotinic Acetylcholine Receptor Assembly Requires NACHO) -->
<!-- <!-- Another possibility is that $\alpha$ 7 interacts with native nAChR subunits to form non-functional complexes [@millar2007]. Indeed, in human cell lines, heterologous expression of recombinant forms of heterometic $\alpha$ 7/$\beta$ 2 was noted, whereas in a native environment $\alpha$ 7 forms homopentameric channels. -->
<!-- Evidence suggests that the heterologous expression of mammalian $\alpha7$ varies between many types of cell lines [@cooper1997] and even between the isolates of the same cell lines [@blumenthal1997]. Similarly to results obtained here, @cooper1997 and @blumenthal1997 showed that the expression of nAChRs could be detected by staining with antibodies, but there was no binding of nAChR-compounds and thus no functional read-out was obtained. This highlights a complex nature of receptor function. -->
<!-- <!-- processing and function. Sequences within N terminus, TM domains and N terminus all seem to play a role in nAChR folding and assembly (ref). Improved expression of functional nAChRs upon fusion of N-teminal domain of nAChR to C-termal domain of 5-HT receptor was achieved. This indicates that the interactions between the receptor and cellular proteins are crucial for the formation of biologically active receptor. -->
<!-- Proteomics analysis identified 55 potential $\alpha7$ 7 interacting partners [@paulo2009]. There proteins regulate many functions including receptor responsiveness, phosphorylation, clustering, folding and assembly (reviewed in @jones2010a). Some of these interacting partners may not be present in the *C. elegans* pharynx. -->
<!-- Expression of the full lenght human $\alpha7$ on the cell surface without the function was also noted in mammalian cell lines. This was due to the innapropriate disulphide bond formation [@rakhilin1999]. -->
<!-- Taken together, there are several reasons for which the functional $\alpha$ 7 expression in the pharynx may have failed. These data highlights the complexity of nAChR processing and assembly and the importance of the cellular environment in these processes. The succesfulness of the heterologous nAChR expression depends on the host and the receptor subunit. Alhough there is no data suggesting functionality of human nAChR in the pharynx, other receptors may exhibit function in this environment. For this reason, efforts into expression of invertebrate receptors in the *C. elegans* pharynx should be made. -->
19-discussion.Rmd 0 → 100644
View file @ e74fe8cf
# General discussion {#discussion}
## Environmental levels of neonicotinoids do not impact on the behavior or development of *C. elegans*
Increased use of insecticides requires a better understanding of their environmental impact. Therefore, the initial aim of this project was to investigate the effects of neonicotinoid-insecticides on the Nematoda representative *C. elegans*. Neonicotinoids have been introduced to the marked in the 1990s and since have become the most commonly used insecticides worldwide [@jeschke2011]. They have many advantages, including a high potency against wide range pest insects (Section \@ref(potentpests)) and low mammalian toxicity. However, neonicotinoids can have significant field effects on non-target species. The adverse effects of environmental neonicotinoids on bees have been studied for decades (Section \@ref(sublethalbees)), whereas the effects on other ecologically important species is less understood but unlikely to have a problem.
There are several forms in which neonicotinoids are delivered onto fields including spray and granules, but seed-coating is the most common method [@jeschke2011]. This focused application ensures the presence of drug inside the plant at effective concentrations [@stamm2016], nevertheless neonicotinoids have long half-life and a leeching potential, therefore can reside in soil for prolonged time periods, coming in contact with inhabiting organisms. This leads to potential exposure to soil namatodes and earth worms, two important cultivars of the biomass and nutrient cyclers, that contribute to the soil fertility [@ingham1985; @neher2001]. The lethal dose of neonicotinoids on earths worms and nematodes varies between 2.74 and 62.08 $\mu$M (Table \@ref(tab:toxallanimal)), however neonicotinoids at lower doses can induce sublethal effects (Section \@ref(sublethalsoilworm)). The investigations into their effects on the nematode representative and model organism *C. elegans* were carried using thiacloprid, clothianidin and nitenpyram.
The effects of these three compounds on locomotion in liquid and solid media, egg-laying and egg-hatching of wild-type worm were investigated (Chapter 3 and 4). This study reports low potency of neonicotinoids against wild-type *C. elegans* [@kudelska2017]. Neonicotinoids were either not effective, or effective at mM concentrations.
These data suggests that neonicotinoids have minimal, if any, effect on locomotion, reproduction or feeding of *C. elegans*, however it is possible that they affect more intricate aspects of worm’s physiology. They impact on learning and plasticity in honeybees [@williamson2013], therefore efforts into determining their effects on the ability to perceive and process information could be made. For example, decision making could be tested in food leaving [@shtonda2006] or chemotaxis assays [@law2004].
<!-- When tested against locomotion in liquid, nitenpyram had an inhibitory effect at mM concentrations and the estimated EC50 of 195.8 mM. Thiacloprid and clothianidin had no effect at concentrations up to 1 and 2.5 nM, respectively (Section \@ref(effectsofneonicsonthrashing)). When on solid medium, the locomotion was inhibited by thiacloprid with the estimated EC50 of 3.7 mM but not by nitenpyram at 1 mM or clothianidin at 3.75 mM (Section \@ref(bodybendsneonics)). The low potency of neonicotinoids on intact *C. elegans* is consistent with the literature (Section \@ref(chapter3effectsofneonics)). -->
<!-- It would also be beneficial to perform long-term exposure assay to determine whether neonicotinoids bio-accumulate in worm’s adipose tissue, or are metabolised to toxic chemical species [@suchail2001]. However, experiemnts in which Lastly, these compounds can act on multiple targets and exert effects at a very low and high doses [@pisa2015], therefore it would be beneficial to determine if *C. elegans* exposure to low doses (high nM - low $\mu$M) have an impact on its behavior. -->
Exposure of *C. elegans* mutant with increased cuticle permeability [@xiong2017] resulted in increased sensitivity of *C. elegans* to tested compounds. Ten-fold increase in the potency of nitenpyram was noted, as indicated by the shift in the EC50 in the thrashing assay. Thiacloprid and clothianidin were with no effect on the wild-type strain, but inhibited locomotion with the EC50 of 337.6 $\mu$M and and 3.5 mm, respectively (Section \@ref(effectsofneonicsonthrashing)). The nematode cuticle is the major route of entry for many drugs, therefore the ability of compounds to cross the cuticular barrier often defines their potency [@alvarez2007]. The cuticle limits bioavailability of many compound used in agriculture [@xiong2017] and by doing so it protects the worm against their potentially harmful effects.
The cuticle encapsulates the body of nematodes as well as earthworms. Their structures have several similarities, as revealed by the electron microscopy of redworm *L. terrestris*, greenworm *Allolobophora chlorotica* [@reed1948; @coggeshall1966; @knapp1971] and *C. elegans* preparations [@cox1981]. The main components of the cuticle are the collagen fibrils embedded within the matrix. This relatively thick layer is covered by a much thinner epicuticle, which consists mainly of lipids. In earthworms, the epicuticle is perforated by a coat of outward projections, shorter ellipsoidal bodies and longer microvilli. In *C. elegans* the surface coat consists of the glycoprotein-mesh. Based on the architectural and chemical similarities, it is likely that the cuticle of earthworms may also play a role in drug permeability. This is however poorly investigated.
<!-- [@carter2014]. -->
Generally, the concentrations at which neonicotinoids impair on *C. elegans* behaviour are several folds higher than those found in the field [@sanchez-bayo2016] and concentrations effective against insect [@goulson2013]. These data suggests *C. elegans* is not impacted by neonicotinoids in the field, however no field-studies are available to confirm this.
The sensitivity of *C. elegans* to neonicotinoids differs from that of parasitic nematodes and earth worms. In *C. elegans* neonicotinoids impact on locomotion at low mM concentrations (Figure \@ref(fig:thrashing-tc-comp-label) and \@ref(fig:BB-plot-label)), but have no effects on reproduction (Figure \@ref(fig:EL-plot-label) and \@ref(fig:EH-plot-label)). In plant parasitic nematode, neonicotinoids are effective at $\mu$M concentrations. The LD50 of thiacloprid on the root-knot nematode *M. incognita* is 143.23 $\mu$M [@dong2014], whereas the IC50 from the egg-hatching experiments is 300 $\mu$M [@dong2014; @dong2017]. Earthworms seem to be the most susceptible, with reported toxic lethal doses greater or equal to 2.74 $\mu$M (Table \@ref(tab:toxallanimal)) and doses effective against their reproduction and mobility at 488.85 nM, or higher (Section \@ref(sublethalsoilworm)). Thus, there is a differential neonicotinoid-susceptibility between *C. elegans* and parasitic nematodes and between *C. elegans* and earth worm species. The same is true among the insects, where some species are much more susceptible than others (Section \@ref(tab:toxallanimal)). Therefore, the sensitivity of each species to neonicotinoids should be considered separately when evaluating the environmental impact of these insecticides. This highlights the complexity and difficulty of the neonicotinoids risk characterisation and usage management.
## *C. elegans* as a model to study the mode of action of neonicotinoids
The adverse effect of neonicotinoids on biological pollinators and the emerging resistance (Section \@ref(resgenevidence)) opposes a threat to the food safety and highlights the need for the synthesis of novel and more selective insecticides. One of the first steps towards the synthesis of new insecticides is the understanding of their mode of action [@metcalf1971]. Neonicotinoids act by targeting insect nAChRs (Section \@ref(neonicstarget)), however their mode of action and receptor specificity differs. They can have agonistic, antagonistic and super-agonistic action, depending on the animal preparation upon which they are applied (Section \@ref(moaneonicsinsects)). In addition, even neonicotinoids sharing the same pharmacophore, target distinct receptors [@thany2009; @moffat2016]. Difficulties in the heterologous expression of insects' receptors hiders their pharmacological characterisation and description of neonicotinoid-receptor specificity (Section \@ref(ric3insect)).
Model organism *C. elegans* is an alternative system in which the mode of action of chemical agents can be studied in-vivo [@lewis1987; @lewis1980]. *C. elegans* expresses at least 29 nAChR subunits (Figure \@ref(fig:seqidentityecd-label)) [@jones2007a] which form receptors at the neuromuscular junction and in the nervous system. Muscle-type receptors are involved in the regulation of locomotion, reproduction and feeding (Section \@ref(pharmacelegans) \@ref(nachrutantfeeding)). Neuronal type receptors are expressed in circuits involved in the sensory processing and chemosensation [@yassin2001]. The suitability of the *C. elegans* system for the mode of action studies was investigated by scoring the sensitivity of native pharyngeal nAChRs receptors to neonicotinoids.
Pharynx is a neuromuscular system in which feeding is carried out by a musculature under the influence of the pharyngeal nervous system. In the presence of food, 5-HT is released, which stimulates MC neuron. MC releases acetylcholine which acts directly on EAT-2 containing nAChRs to drive fast pumping. Thus, EAT-2 is a molecular determinant of the fast pharyngeal response. Although EAT-2 is the only nAChR subunit with clearly characterised function, ACR-7 is also expressed in the pharyngeal muscle [@saur2013].
To determine the effects of neonicotinoids on the pharyngeal nAChRs, dissected head preparations were exposed to clothianidin, thiacloprid and nitenpyram. Their effects on 5-HT stimulated pharyngeal pumping were investigated. Nitenpyram and clothianidin inhibited 5-HT stimulated pumping at 25 mM and 500 $\mu$M, respectively (Section \@ref(dissectedanimalnicotineandneonics)). The impact of neonicotinoids on unstimulated pharynx was also investigated and revealed no effects of thiacloprid and nitenpyram. In contrast clothianidin stimulated pumping. The lowest dose of clothianidin effective against this *C. elegans* behaviour was 75 $\mu$M. These data suggest nAChR expressed in the pharynx have low affinity to neonicotinoids. In contrast, neonicotinoids are effective at nM concentrations on target insect receptors (section \@ref(electrophysevidence) and \@ref(ligbinding)) suggesting nAChR pharmacophore present in pest and beneficial insects are distinct from those found in the *C. elegans*.
nAChR pharmacophore consists of the contributions from the $\alpha$ (principal) subunit and non-$\alpha$ (complementary) subunit (Section \@ref(bindingsite) and \@ref(pharmacophore)). Residues important in binding of agonists have been identified in mollousc AChBP and nAChR bound to agonists, including nicotine and acetylcholine, thiacloprid, imidacloprid and clothianidin [@celie2004; @hansen2005; @ihara2008; @talley2008; @ihara2014; @zouridakis2014; @morales-perez2016]. Residues identified as those important in binding of agonists were compared between worm and insect nAChRs, by aligning their sequences.
Chosen insect subunits are those that form receptor chimeras in the recombinant system and confer high binding affinity to neonicotinoids (i.e Kd below 10 nM, Section \@ref(chimerareceptors) and Table \@ref(tab:bindignrecombinant) and $\beta1$ subunit, identified as a molecular determinant of neonicotinoid-resistance in *M. persicae* [@bass2011]. Amino acid sequences of these subunits were aligned against nAChR subunits forming functional receptors at the body wall muscle, namely ACR-16 [@ballivet1996; @boulin2008; Section \@ref(muscletypenachr)], as well as EAT-2 and ACR-7 which are two subunits identified in the pharyngeal system [@mckay2004; @saur2013 and Section \@ref(nachrinpharynx)].
Comparison of nAChR binding pocket residues in *C. elegans* and insect receptors identified several differences. Basic residue at position 34 in the loop G of the complementary non-$\alpha$ subunit, has been shown to confer high binding affinity of thiacloprid and clothianidin to AChBP [@ihara2014]. No basic residue has been identified in the aligned *C. elegans* sequences. Comparison of the remaining *C. elegans* subunits revealed that 3 have basic residue at that position, namely UNC-63, UNC-38 and ACR-6. UNC-38 and UNC-63 are the $\alpha$ subunits of one of the BWM receptor. There is a binding site formed at the interface of UNC-38 and UNC-63, whereby UNC-63 contributes the complementary residues. Low potency of neonicotinoids in locomotory assays suggest that they bind with low affinity to BWM *C. elegans* receptors, suggesting basic residue in loop G is not the sole determinant of neonicotinoids binding selectivity.
Sequence alignment of insect and *C. elegans* subunits, revealed further differences including residue corresponding to Gln55 in loop D of AChBP. Basic residue at that has been identified as important in conferring neonicotinoid-susceptibility in structural studies of neonicotinoid and nicotine bound AChBP [@ihara2008; @talley2008] and in genetic studies of insects resistant to neonicotinoids [@hirata2015; @hirata2017; @bass2011]. This basic residue corresponds to neutral or positive residue in most receptors subunits in *C. elegans*. Out of 5 aligned *C. elegans* sequences, only 1 had basic residue at that position. An alignment of all *C. elegans* subunit against the insect $\beta1$ was carried. Out of 29 subunits, 6 namely ACR-7, ACR-9, ACR-25, ACR-15, ACR-10 an UNC-38 had basic residue at that position (data not shown).
There are also differences in the loop B amino acid at position 145, which has been identified in the genetic analysis of imidacloprid-resistant strain of *Nilaparvata lugens* [@liu2005] and in loop E which contributes aromatic amino acids to the binding site.
Taken together, a small number of *C. elegans* nAChR subunits have amino acids corresponding to those identified as those important in conferring neonicotinoid-sensitivity of insects. Despite this, *C. elegans* is not sensitive to neonicotinids, suggesting *C. elegans* nAChRs are of low affinity to these compounds. This suggests that there are other determinants of neonicotinoid-sensitivity, or that multiple residues must be found in a single receptor to confer high affinity to neonicotinoids.
The differences between the insect and *C.elegans* binding pocket are mainly found in the complementary site, suggesting the contributions from the complementary site determine neonicotinoids-selectivity. This is supported by the literature [@marotta2014; @hansen2004]. For example, swapping of $\beta$ subunits in $\alpha4\beta2$ mammalian receptor diminished cytisine activity on this receptor [@harpsoe2013]. Receptor becomes responsive to cytisine at sub-$\mu$M concentrations by a mutation in a single amino acid in the complementary binding pocket [@marotta2014]. Thus the variation in the complementary binding pocket residues gives rise to ligand binding specifities and pharmacological differences between various compounds and receptors.
(ref:gendiscussion-celegansinsectalagnment) **Sequence alignment of the pharmacophore of insect and *C. elegans* nAChR subunits.** Ligand binding pocket is formed from the loops originating from the principal (a) and complementary (b) receptor subunits. Amino acids important in forming drug-receptor interactions are color-coded as in Figure \@ref(fig:binding-pocket-label). Non-conserved residues are underlined. Numbering is according to the AChBP of Ls sequence. Mp = *M. persicae* (peach aphid), Dm = *D. melanogaster* (fruit fly), Ce = *C. elegans*. Sequence alignment generated by MUSCLE.
```{r gendiscussion-celegansinsectalagnment-label, fig.cap="(ref:gendiscussion-celegansinsectalagnment)", fig.scap= "Sequence alignment of the pharmacophore of insect and \\textit{C. elegans} nAChR subunits", fig.align='center', out.width= '80%', echo=FALSE}
knitr::include_graphics("fig/gen_discussion/celegans_and_insect_added_loopG_and_B.png")
```
<!-- Lack of sensitivity of neonicotinoids on exposed pharynx suggest that residing nAChs are pharmacologically distinct from those found in insects. -->
<!-- Conversy, anthelmintic levamisole has potent action on *C. elegans*, but is a weak agonist on insect receptors. Levamisole at conc induce depolarisation of ...*C. elegans* receptors (ref). In contrast, they weakly depolarise cocroach motor neuro [@pinnock1988]. These data suggest that there is a striking difference between the neonicotinoid affinity on insect neurons and on *C. elegans* pharynx. -->
<!-- Other pharma differences : read this papar: tornoe1994. -->
## *C. elegans* pharynx as a platform for the pharmacological characterisation of nAChRs
Low sensitivity of *C. elegans* to nitenpyram, clothianidin and thiacloprid in behavioural and cellular assays precludes its use as a model to study the mode of action of neonicotinoids per se, but highlights its potential use as a suitable background for the heterologous expression of insect nAChRs. New insecticides are needed to prevent the negative environmental impact of neonicotinoids and combat emerging resistance. The first step towards the synthesis of neonicotinoids with improved selective toxicity profile is the heterologous expression of nAchRs from pests and non-target species in a suitable host.
Cell lines and Xenopus oocytes are routinely used as biological systems for heterologous nAChR expression (Section \@ref(biologicalsystemfornachrexpression)). Model organism *C. elegans* is an alternative system in which recombinant proteins can be expressed by generation of transgenic worms [@crisford2011; @sloan2015]. In comparison to other systems, *C. elegans* is cheap and easy to maintain, whereas transgenic worms can be preserved for years at - 80 &deg;C. The function of recombinant nAChRs can be studied in-vivo by evaluating their impact on behaviours underpinned by the cholinergic neurotransmission.
Acetylcholine is a major neurotransmitter of the pharynx, released by at least 7 out of 14 neurons (Table \@ref(tab:pharynx-neurons)). It is key and necessary for the induction of fast feeding in response to food (Section \@ref(achpumping)). Its action on the pharynx is mediated by nAChRs, most notably EAT-2 expressed at the NMJ (Section \@ref(nachrinpharynx)). *C. elegans* pharynx does not posses an innate susceptibility to low concentrations of neonicotinoids, creating an appropriate genetic background in which effects of these compounds on recombinantly expressed receptor can be studied. In addition, it expresses an array of chaperon proteins, creating a favorable environment for the maturation and function of these ion channels (Section \@ref(cematnachr)). *C. elegans* pharynx has been successfully used for the heterologous expression of non-native proteins [@crisford2011], including nAChRs [@sloan2015].
EAT-2 is a single nAChR subunit that confers pharyngeal 5-HT sensitivity and feeding response in *C. elegans* [@mckay2004]. We show that *eat-2* mutant is a suitable genetic background, in which the expression of heterologous nAChRs could be scored in behavioural assays. Transgenic line in which *eat-2* is heterologously expressed, rescued the blunted pharyngeal response to food and restored 5-HT resistance of the *eat-2* mutant (Section \@ref(behaviourofeat2rescue)). However, the expression of human $\alpha7$ nAChR in the *C. elegans* mutant pharynx had no observable phenotypical consequences (Section \@ref(feedingalpha7celegans) and Section \@ref(htandtransgenicalpha7)). Similarly, expression of this receptor in the wild-type worm revealed no differences in pharyngeal responses to nAChR agonists nicotine or choline (Section \@ref(pharmaalpha7transegnicworms)). Staining with fluorescently labelled human $\alpha7$ nAChR antagonist $\alpha-Bgtx$, reveled increased fluorescence in the pharyngeal muscle of transgenic, when compared to control worms (Section \@ref(bgtxstaining)). $\alpha$-bgtx binds to the extracellular, domain of the receptor [@dellisanti2007]. This suggests that $\alpha7$ receptor is expressed on the cell surface of the pharyngeal muscle, however due to the lack of phenotype its functionality is unclear. Further pharmacological experiments of transgenic strains (as described in the Discussion of Chapter 6) should be carried out to determine whether $\alpha7$ retains its function upon expression in the pharynx of *C. elegans*.
The expression of $\alpha7$ was driven a myo-2 promoter, which should drive the expression in all cells of the pharyngeal musculature [@altun2009a]. However, $\alpha-Bgtx$ staining of transgenic worms was concentrated in pm7 and pm8 muscle cells, suggesting $\alpha7$ is expressed in the terminal bulb, which does not overlap with the localisation of native EAT-2, native protein. Thus, native EAT-2 promoter should be used to ensure correct localisation of the expressed protein.
<!-- In dissected animal, in the absence of food pharynx continues to pump. It is myogenic or neurogenic? -->
<!-- Rhythmical pattern of muscle contraction and relaxation can be controlled by neuronal input or the intristic ability of the muscle to contract without the input of the nervous system. Rhythmic contraction of muscle can be driven by the neuoronal network controls the pattern of contraction-relaxation or myogenic if this cycle is control by the intrinsic ability of muscle cells to inititate and control APs without the neuronal input. Laser ablation of all pharyngeal neurons does not abolish pumping entirely suggesting it can act without neuornal input. However In C. elegans, the contraction of pharynx is mostly controlled by ACh. Mutants deficient in production of ACh or ACh neurotrasmission hatch but do not feed and die shortly after hatching [@rand1989, @alfonso1993). Same happens when all neurotrasnsmission is abolished [@nonet1998). In addition, in transgenic adult worms pharmacological switching off of the pharyngeal nervous system abolished pumping entirely [@trojanowski). This supports the neurogenic control of pumping. @trojanowski2016 suggests tonically released ACh from the pharyngeal nervous system drives the myogenic activity of the muscle. -->
<!-- note that It is also possible that it is controlled by the extrapharyngeal nervous system and humoral neurotransmission. -->
<!-- Laser ablation of pharyngeal nervous system did not ablate pumping because there were still inputs from the extrapharyngeal nervous system. Supports the idea finding that the pumping rate on dissected animal are lower than those off food on plate (you can show data here) or 5-HT stimulated in intact vs dissected animal. There are two points of conection: between RIP neurons and I1 neurons which are connected by a pair of gap junctions [@albertson1976). However ablation of RIP -->
<!-- does not led to marked behavioural changes. It did not cause changes in pumping rates on or off food (our lab, data not published, nicos thesis). The exception is the absence of the inhibitory effect on pharynx due to light touch [@riddle1997). However the pharynx can be influenced by extrapharyngeal system. For example, inhibitory responses on pumping of drugs is diminished when a head in cut away from the rest of the body or when I1 neurons are ablated the sensitivity decreases [@dent2000). Also acute inhibitory response to light. Light detected by RIP (or other neurons which synapse onto RIP) neurons signal to I1 which synapses to MC to inhibit pumping. Response is blunted by RIP and I1 ablation [@bhatla2015). -->
<!-- As mentioned in cut head section, these contraction were weak. Note that these look exactly like the once seen in this paper here: https://www.nature.com/articles/srep22940. Long EPG, small amplitude and long duration. In this paper they stimulated the muscle but the nervosus system is silenced. Hence these effects could be due to a direct effect of nicotine on muscle? -->
<!-- Some report that bees prefenrentialy feed on food containing thiamethoxam and clothianidin not by sensory processed. thiamethoxam, imidacloprid and clothianidin inhibit B. terrestris feeding, thiamethoxam and clothianidin of A. mellifera [@kessler2015). Bombus terrestris reduction of feeding due to imidacloprid and clothianidin. Thiamethoxame has no effect [@thompson2015). It might be they are either incapable of feedin or choose not to feed. However, @kessler2015 showed they do not act on gustatory or sucrose sensing neurons [@kessler2015). Authors suggest honey bees and bumbkebees cannot taste neonicotinoidss. The exact mechanism of these alteratiosn is to be investigated. -->
<!-- ###Senory effects of nicotine -->
<!-- Effects of nicotine on food-stimulated pumping was scored by placing worms on palates containing food patch and nicotine incorporated into the agar. Worms escaped the experimental plates containing nicotine at concentrations $\ge$ 25 mM by crawling to the edge of the plate. This suggests nicotine has sensory effect on worms and induces avoidance response. This behaviour was also triggered by nicotine-related compoud quinine [@hilliard2004). There are two potential cellular targets of nicotine in worms: sensory IL1 and IL2. -->
<!-- Cholienrgic IL2 [@pereira2015) labial sensory neurons are present around the mouth of the worm. They are not exposed to the external environment, but are in close proximity to the surface of the worm. IL2 express nAChR DES-2 subunit [@treinin1998). 2 out of 6 IL2 neurons output onto RIP neurons [@Serrano-Saiz2013) which connect the somatic and pharyngeal nervous system [@albertson1976). -->
<!-- IL1 neurons are neurons positioned around the mounth of the worm and exposed to the external environment. They are involved in mechanosensation [@Kindt2001) and make connections with RIP [@albertson1976). There is some evidence that IL2 express ACR-2 nAChR subunits [@Nurrish1998, @Hallam2000). -->
<!-- Nicotine can also bind to receptors other than nAChRs, for example TRP channels [@Liu2004, @Talavera2009). TRPV channels are expressed on IL1 neurons [@Kindt2001) and are involved in responses to nicotine in a worm [@feng2006). -->
<!-- # general discussion -->
<!-- Moreover, *C. elegans* physiology means there is a dual route of exposure potentially to much higher than average concentrations of insecticides. Worms are mobile in soil, therefore can forage in close proximity or make a physical contact with a coated seed, whereas their feeding activity means they are not only making a direct contact with a substance, but also ingesting contaminated material. -->
<!-- Reported doses effective against worms are several orders of magnitude higher than those found in the field [@franciscosanchez-bayo2016]. This might suggest that worms are not impacted by field realistic levels of neonicotinoids in the soil. However, a long term exposure assays should be performed to asses if prolonged exposure leads to bioaccumulation and exacerbate effects. -->
<!-- look at this article to see the expression levels change in response to chronic nicotine treatment of naive worms https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4385460/ -->
<!-- this paper shows that effects of nicotine could be due to receptor containing lev-8 https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1471-4159.2004.02951.x -->
<!-- eat-2 is sensitive to nicotine. eat-18 is not https://pdfs.semanticscholar.org/8df9/6213dbc75e8ae0eb67b391e04fab38ab3903.pdf -->
<!-- In contrary, no potency difference was observed in acute exposure experiment and effects on pumping. The reason may lay in the differential routes of drugs’ entry in these assays. Whilst in liquid, worms generally do not pump [@gomez-amaro2015] hence in acute motility assays drugs must cross the cuticle to reach molecular targets. In contrast, in pumping assays pumping is instigated by addition of 5-HT. As a result, drugs gain access through ingestion and diffusion across the cuticle, equilibrating much more readily. -->
<!-- Increased potency of compounds was also observed in moderate (24-hour) exposure assays. Thiacloprid and clothianidin had no effect on N2 wild-type worm, but inhibited feeding and egg-laying locomotion of bus-17 mutant at low mM concentrations. -->
<!-- ### Neonicotinoids exhibit differential effect on worm behaviour -->
<!-- In acute and moderate exposure assays, intact worms were subject to treatment and as shown, the cuticle had a major effect on the efficacy of compounds. To investigate the issue of permeability, further assays were employed in the following chapter. circumvent the issue of permeability dissected worm assay was employed. In this assay, C. elegans pharynx is cut away from the rest of the body. By doing so, the cuticular barrier is diminished, whereas drugs only need to cross the basal membrane separating pharynx and external environment to bind to the molecular targets. Isolated pharynx pumps <5 pumps/seconds. By direct application of drugs, their excitatory effects can be tested. In addition, application of 5-HT to elicit pumping and subsequent application of a drug enables determination of inhibitory effect of compounds on 5-HT stimulated pharyngeal pumping. -->
<!-- In general, results from the cut head experiment confirm that the removal of the cuticle resulted in increased efficacy of drugs when compared to the results from the pharyngeal pumping acute exposure assays. The greatest 3 orders of magnitude shift was observed for nicotine. The efficacy of nitenpyram increased 18-fold shift, whereas thiacloprid 3-fold. Clothianidin had no effect in both preparations. Relative shifts in potency suggest neonicotinoids penetrate biomembranes much less readily in comparison to nicotine at least in part due to the physicochemical properties. Generally, nicotine is more hydrophobic and less lipophilic that neonicotinoids and protonated at physiological pH (Table 1.1). -->
<!-- In exposed pharynx experiments neonicotinoids have shown a differential effect on the pharyngeal pumping. Clothianidin induced a transient excitation. This effect was also observed in honey bee neuronal preparation [@palmer2013]. Thiacloprid induced sustained excitation [@moffat2016] have shown that N-nitroguanidines clothianidin, thiamethoxam and imidacloprid have divergent effect on the behaviour and the development of bumblebees, as well as on the function of mushroom body Kenyon cells. This suggests that neonicotinoids act on different receptors or they may have a differential mode of action in bee and C. elegans. Indeed, clothianidin has been shown to act on both imidacloprid-sensitive and insensitive nAChRs in cockroach isolated SUM ganglion [@thany2009]. -->
<!-- 5-HT stimulates both. Pumping instigated by the action of 5-HT on MC neurons by acting on ser-7 receptors, whereas insthmus peristalsis by the action on M4 neurons by ser-7 too [@song2013a]. Ser 7 are serotonin gated GPCRs [@hobson2003]. -->
<!-- MC and M4 are cholinergic and output directly onTO the muscle. In response to 5-HT, MC and M4 release ACh to stimulate pumping. -->
<!-- >>>>>>> a966d072d44f70c03380ef6b978ec19ddb9bf549 -->
<!-- Sensory stimulation of the pharyngeal system -->
<!-- Hence function might be redundant. -->
<!-- Ablation of I1 had no effect in the presence of food [@raizen1995), but reduced pumping in the absence of food [@trojanowski2014). I2 is the only cholinergic neuron that does not synapse onto the pharyngeal muscle directly. it activates the pharynx via MC and M2 [@albertson1976). -->
<!-- SENSORY RESPONSE TO ODOUR -->
<!-- <<<<<<< HEAD -->
<!-- potentiation of pumping or depression in response to attractive or repelling odourants. Detected by 2 different sets of neurons : AWC and ASH neurons [@li2012). -->
<!-- note that peristalsis is also regulated by other neurotransmitters. Here is shows that neuroipeptides and monoamines control insthus persistalsis in response to 5-HT -->
<!-- ======= -->
<!-- potentiation of pumping or depression in -->
<!-- Anatomically, it is mailny composed from muscle and nerve cells. There are 20 muscle cells . Muscle cells are in the syncytium, so that the electrical signal can be spread almost instantenously from one section of the pharynx to the next. Moreover, the AP can also readily travel from one anatomical structure to the next. That is why the contraction of the corpus and the terminal bulb begin simultaneouly [@raizen1994). -->
<!-- >>>>>>> a966d072d44f70c03380ef6b978ec19ddb9bf549 -->
<!-- <<<<<<< HEAD -->
<!-- Pharynx is a feeding organ of the worm composed of three distinct anatomical features: most anterior corpus, middle isthmus and posterior terminal bulb. Pharynx is located in the head of the worm, separated from the intestine by the and surround by... Its functions it to trap, filter, smash and pass the bacteria to the gut for digestion. These are performed by two motions: pumping and peristalsis. Pumping is the contraction and a susequent relaxation of the corpus, anterior isthmus and the terminal bulb. Peristalsis of the posterior isthus. Anatomically, it is mailny composed from muscle and nerve cells. There are 20 muscle cells [@albertson1976). Muscle cells are in the syncytium, so that the electrical signal can be spread almost instantenously from one section of the pharynx to the next. Moreover, the AP can also readily travel from one anatomical structure to the next. That is why the contraction of the corpus and the terminal bulb begin simultaneouly [@raizen1994). The action of the pharynx is under the control of the pharyngeal system. -->
<!-- There are 20 neurons of 14 types in the pharynx [@albertson1976), but only three of those have identified as sufficient to elicit feeding. Those are MC which inititiates the pump [@raizen1994, @raizen1995), M3 ends it [@avery1993) whereas M4 is initiating peristalsis [@avery1987). -->
<!-- The activity of the pharynx is mainly reulated by acetylcholine, glutamine and serotonin. -->
<!-- Pharyngeal system is connected to the extra-pharyngeal nervous system at a single point. Extrapharyngeal RIP neurons and pharyngeal I1 neurons are connected by a pair of gap junctions [@albertson1976). Sensory resonses modulate pumping. But are not required for normal/intrinsic pumping. Hence laser ablation of RIP has no effect. But it does get rid of the ability to normally respond to the environment. -->
<!-- The presence of familial food is detected by dendrites of ADF head chemosensory neurons situated outiside the pharynx [@sze2000]. A release of serotonin from ADF neurons [@bargmann1991] activates neurosecretory NSM neurons within the pharyngeal nervous system. It has been suggested that NSM sense bacteria in the pharynx lumen as well. Evidence that stimulation of NSM is more imp in locomotion control than in the pharyngeal control [@cunningham2012]. NSM release 5-HT to the pseudocoelomic fluid to inhibit locomotion and stimulate pumping and alter other bahaviours. Pumping stimulation is due to the action of 5-HT on MC and M3 and M4. -->
<!-- 5-HT stimulates both. Pumping instigated by the action of 5-HT on MC neurons by acting on ser-7 receptors, whereas insthmus peristalsis by the action on M4 neurons by ser-7 too [@song2013a]. Ser 7 are serotonin gated GPCRs [@hobson2003]. Duration of the action potential is regulated by M3 neurons which release glutamine and causes repolarisation. -->
<!-- MC and M4 are cholinergic and output directly onTO the muscle. In response to 5-HT, MC and M4 release ACh to stimulate pumping. -->
<!-- Evidence suggests exhogenous 5-HT acts by the enhancement of M3 which releases glutamine to reduce the pump latency and enable fast pumping frequency of ~250 pumps/min. -->
## *C. elegans* as a model for mammalian toxicity studies
To better understand the pharmacological profile of *C. elegans* nAChRs, the effects of endogenous neurotransmitter acetylcholine as well as agonist nicotine and cytisine were tested on the pharynx. Acetylcholine, nicotine and cytisine were applied on cut-head and the effects on EPG was assayed. All three induced potent and transient stimulation of pumping leading to muscle tetanus (Figure \@ref(fig:epg-nicotine-2-label))). Concentrations effective were in the low $\mu$M range. The order of potency as measured by the EC~50~ was: nicotine > cytisine > acetylcholine. In comparison to human $\alpha7$, effective concentrations were in a similar range [@papke2002]. In addition, like pharyngeal nAChRs, human $\alpha7$ receptors insensitive to low doses of neonicotinoids with the EC~50~ values of 0.74 mM and 0.73 mM, respectively for clothianidin and imidacloprid, on the heterologously expressed channel [@cartereau2018]. This suggests the pharmacophore of human $\alpha7$ and pharyngeal nAChRs is conserved. This was confirmed by aligning the sequences of key amino acids forming the nAChR binding pocket in $\alpha7$ and two of the pharyngeal nAChRs (Figure \@ref(fig:pharmacophoreceleganspharynxandhumanalpha7-label)).
(ref:pharmacophoreceleganspharynxandhumanalpha7) **Amino acid sequence alignment of human $\alpha7$ and two of the pharyngeal *C. elegans* nAChRs ligand binding pockets.** Amino acid sequences forming nAChR binding pocket were aligned. Amino acids important in agonist binding are highlighted, as in Figure \@ref(fig:binding-pocket-label). Ce = *C. elegans*, Hs = human. Sequence alignment generated with MUSCLE.
```{r pharmacophoreceleganspharynxandhumanalpha7-label, fig.cap="(ref:pharmacophoreceleganspharynxandhumanalpha7)", fig.scap="Amino acid sequence alignemnt of human $\\alpha7$ and pharyngeal \\textit{C. elegans} nAChRs ligand binding pockets.", fig.align='center', out.width= '150%', echo=FALSE}
knitr::include_graphics("fig/gen_discussion/celeganseat2andacr7andhumanalpha7.png")
```
Comparison of human $\alpha7$ and pharyngeal nAChR subunits EAT-2 and ACR-7 revealed high sequence similarity. Almost all residues forming ligand binding pocket are conserved between these subunits, suggesting pharyngeal nAChR subunits are homologous to human $\alpha7$. Besides pharyngeal nAChR subunits, homologs of over two thirds of human proteins can be found in *C. elegans* [@sonnhammer1997; @lai2000]. The similarities between mammals and *C. elegans* extends beyond genetics. *C. elegans* has conserved synaptic function, due to the presence of almost all vertebrate neurotransmitters and conserved neuronal signalling pathways [@bargmann1998; @kaletta2006]. There are however some differences. *C. elegans* presents expresses inhibitory glutamate-gated chloride channel absent in mammals [@cully1994], but lacks voltage-gated sodium channels which is present in humans [@bargmann1998]. Despite these limitations, *C. elegans* emerges as an attractive model for toxicity studies [@hunt2017].
Methods to use *C. elegans* as a model to study acute toxicity as well as developmental and reproductive toxicology have been developed [@boyd2010; @xiong2017]. A good correlation between the rank order of toxicity of many compounds on *C. elegans* and mammals for acute toxicity, growth and reproduction endpoints have been found [@williams1988b; @boyd2010]. This includes organophosphates, which act by disrupting cholinergic neurotransmission at the synapse [@chadwick1947]. The rank order of acute toxicity, as measured by LC50, correlated well with the LD50 ranking of these agents in rats and mice [@cole2004]. This highlight the potential suitability of *C. elegans* as a model for toxicity testing of cholinergic and other neurotoxins. Introduction of *C. elegans* into toxicity testing has a potential to reduce the use of conventional mammalian models, resulting in the reduction of cost and duration of such studies [@williams1988].
<!-- ## Cholinergic drive of the *C. elegans* pharynx -->
<!-- Cholinergic neurotransmission is crucial in driving the food evoked pharyngeal response in *C. elegans*. Experiments were carried out to investigate the cholinergic drive of the *C. elegans* pharynx. In the presence of food, wild-type *C. elegans* pumps at a rate of 4.5 Hz. This effect can be mimicked by the application of 5-HT. In the presence of 5-HT, pharyngeal pumping of dissected *C. elegans* increases with the EC~50~ of 169 nM. This supports the 5-HT driven stimulation of pumping, whereby in the presence of food, 5-HT is released from pharyngeal MC neuron to stimulate pumping. It was also shown that the 5-HT driven and food driven pharyngeal pumping is dependent on EAT-2 nAChR. However, high rates of pharyngeal pumping can be induced with nicotine and clothianidin in both wild-type and *eat-2* mutant. This suggests there is an alternative, EAT-2 independent pathway inducing fast pumping in *C. elegans*. This pathway could involve other nAChRs because it is likely that there are other receptors expressed in the pharyngeal muscle. The expression pattern of nAChR auxilary subunit EAT-18 is much more diffused than that of EAT-2 receptors. EAT-2 maps onto pm4 and pm5 muscle, whereas EAT-18 on all pharyngeal muscles and M5 neuron [@mckay2004]. The identity of these receptors, (with the exception of ACR-7 of unknown function) is to be determined. -->
<!-- Nicotine and clothianidin may act at least partially independently on the MC. Stimulation of MC neurons in *eat-2* mutant (in the presence of metabotropic ACh antagonist) also elicits pumping response, but only to 0.7 Hz [@trojanowski2014]. In the presence of nicotine and clothianidin pharynx of the *eat-2 C. elegans* strain pump at a maximum measured average rate of 2.1 and 4.2 Hz, suggesting both compounds by-pass MC. -->
<!-- <!-- Nicotine may act to elicit potent pharyngeal response by proteins other than nAChRs. The pharyngeal response to nicotine in *eat-18* mutant was reduced, not diminished [@raizen1995]. However this could also mean that there are nAChRs capable of functioning independetly of EAT-18. -->
<!-- <!-- Response of the pharynx to clothianidin are distinct from classical nAChR agonist responses, therefore it is also possible that it acts on proteins other than nAChR to stimuate pharynx. -->
<!-- Therefore, this study suggests that there are multiple routes for the activation of the *C. elegans* pharynx. MC - EAT-2 pathway is involved in food and 5-HT driven response, whereas nicotine and clothianidin may elicit pumping via an independent pathway(s), which remains to be identified. -->
<!-- (fig:seq-sim) **The sequence similarity between the ECD of *C. elegans*, insect and human receptors.** The sequence similarity between amino acid sequences computed with -->
<!-- ```{r seq-sim-label, fig.cap="(fig:seq-sim)", fig.scap='The sequence similarity between the ECD of \\textit{C. elegans}, insect and human receptors.', fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/results3/similarity_pharyngeal_am_hs.png") -->
<!-- ``` -->
<!-- (fig:seq-iden) **The sequence identity between the ECD of *C. elegans*, insect and human receptors.** -->
<!-- ```{r seq-iden-label, fig.cap="(fig:seq-iden)", fig.scap = 'The sequence identity between the ECD of \\textit{C. elegans}, insect and human receptors.', fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/results3/identity_pharyngeal_am_hs.png") -->
<!-- ``` -->
21-appendix-a.Rmd
View file @ e74fe8cf
# Title of appendix # Pharmacophore of the nicotinic acetylcholine receptor
\newpage
```{r echo=FALSE, fig.pos='H', fig.align='center', out.width="70%"}
knitr::include_graphics("fig/appendix/seq_align_1a.png")
```
(ref:pharacophore-seq) Sequence alignment of the binding pocket of the ligand binding protein and nicotinic acetylcholine receptors. Amino acid sequences from the principal (a) and complementary (b) binding site loops, which form the ligand binding pocket. Residues important for agonist binding are highlighted and color coded as in Figure \@ref(fig:binding-pocket-label). Numbering corresponds to the sequence of the great pond snail acetylcholine binding protein (AChBP). Alignment was generated with MUSCLE [@edgar2004]. Abbreviations used: Ls - *Lymnaela stagnalis* (great pond snail), Am- *Apis mellifera* (honeybee), Mz- *Myzus persicae* (peach aphid), Hs- *Homo sapiens* (human), Gg- *Gallus gallus* (chicken), Ce - *C. elegans*.
```{r pharacophore-seq-label, fig.cap="(ref:pharacophore-seq)", fig.scap="Sequence alignment of the ligand binding pocket of the AchBPs and nAChRs.", fig.align='center', echo=FALSE, fig.pos='H'}
knitr::include_graphics("fig/appendix/seq_align_1b.png")
```
First appendix
22-appendix-b.Rmd
View file @ e74fe8cf
# Title of appendix # DNA sequence used for the expression of *eat-2* in the pharyngeal muscle of *C. elegans*.
\newpage
(ref:app2) Sequencing of *myo-2-eat-2* from the *pDEST* vector. Myo-2::eat-2 nucleotide fragment from the expression vector used to generate *C. elegans* transgenic strains was sequenced following cloning. 3 forward (Fw) and a reverse (Rev) primer were used to generate overlaping sequencing fragments spaning the entire sequence of interets (a). Sequencing results authenticated the identity of the construct (b) and confirmed the amino acid sequence of the *eat-2* gene.
```{r echo=FALSE, out.height = '80%'}
knitr::include_graphics("fig/results4/PNG/1-myo2-eat-2.png")
```
```{r echo=FALSE}
knitr::include_graphics("fig/results4/PNG/2-myo2-eat2.png")
```
```{r echo=FALSE}
knitr::include_graphics("fig/results4/PNG/3-myo2-eat2.png")
```
```{r echo=FALSE}
knitr::include_graphics("fig/results4/PNG/4-myo2-eat2.png")
```
\newpage
```{r app2-label, fig.cap="(ref:app2)", fig.scap= "Sequencing of \\textit{myo-2-eat-2} from the \\textit{pDEST} vector", include="TRUE", results="show", echo=FALSE}
knitr::include_graphics("fig/results4/PNG/5-myo2-eat2.png")
```
Second appendix
\ No newline at end of file
23-appendix-c.Rmd 0 → 100644
View file @ e74fe8cf
# DNA sequence used for the expression of human $\alpha7$ in the pharyngeal muscle of *C. elegans*.
\newpage
(ref:app1) Sequencing of *pmyo2-CHRNA7* from the *pDEST* expression vector.
```{r out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/1-myo2-chrna7.png")
```
```{r out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/2-myo2-chrna7.png")
```
```{r out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/3-myo2-chrna7.png")
```
```{r out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/4-myo2-chrna7.png")
```
```{r app1-lbl, fig.cap="(ref:app1)",, fig.scap = "Sequencing of \\textit{myo-2-$\\alpha$-7} from the pDEST vector", fig.align='center', out.height = '80%', echo=FALSE}
knitr::include_graphics("fig/results4/PNG/5-myo2-chrna7.png")
```
\ No newline at end of file
24-appendix-d.Rmd 0 → 100644
View file @ e74fe8cf
# Expression of the nicotinic acetylcholine receptor extracellular domain
\newpage
## Introduction
nAChRs are the molecular targets of neonicotinoid insecticides. The adverse effects of neonicotinoids on non-target insects led to the restricted use and an eventual ban of these chemicals in the EU, which highlights the need for the synthesis of more selective compounds. The first step towards the generation of compounds effective on pest and not beneficial insects, is the understanding of the interactions between the neonicotinoid and their targets based on the knowledge of the agonist binding site structure.
### Structral basis of acetylcholine and agonist binding
Crystal structure of the mollusc homologue of nAChR extracellular domain (ECD) AChBP bound to imidacloprid [@ihara2008; @talley2008] and genetic analysis of the insect resistant strains [@liu2005] highlighted the importance of residues in both the principal and complementary site of the ligand binding site. The key determinants for acetylcholine are well known (Section \@ref(pharmacophore)). Neonicotinoids forms similar interactions with the conserved residues in the binding pocket (Section \@ref(pharmacophoreofneonics)). There are cation-pi interactions with the aromatic amino acids, hydrogen bonds via water molecule and Van der Waals interactions with loop E residues - these are common to interactions made with other agonists of nAChRs. There are also some proposed unique interactions between imidacloprid and AChBP, such as a hydrogen bond with Gln 55 of loop D. However, this Gln is not conserved and corresponds to basic residue in many insect nAChR subunits, thus the unique interaction may be present in some, and not all insect receptors. The importance of this residue was highlighted in the genetic analysis of naturally occuring resistant strains. Mutation from basic arginine to threonine at the corresponding position of $\beta1$ nAChR subunit of *Myzus Persicae* confers imidacloprid resistance [@bass2011].
Although AChBP is a useful model to study nAChR-drug interactions, as indicated above, there are differences in the amino acid sequence in the ligand binding pocket of AChBP and nAChR (Appendix A), including those that appear as key determinants of drug sensitivity. Therefore, a high resolution structure of nAChRs are needed to fully understand the underpinnings of selectivity of neonicotinoids and the chemical space in which improved selectivity might be achieved. Structures of $\alpha4\beta2$ [@morales-perez2016] and nAChR extracellular domain (ECD) of $\alpha2$ [@kouvatsos2016] and mouse $\alpha1$ [@dellisanti2007] human $\alpha9$ [@zouridakis2014] are known. Structures of nAChR extracellular domain bacterial homologes GLIC [@hilf2009] and ELIC [@hilf2008] as well as pentameric ion channels GABA [@miller2014] and glycine [@huang2015] have also been described. However, the crystal structure of insect receptors is not available. This may be caused by the difficulties in expression and purification of folded and soluble recombinant proteins [@rosano2014], which are essential and first steps towards the structural characterisation.
## Biological systems for recombinant protein expression
The requirements for the structural analysis of any protein is the high level expression of stable and correctly folded protein [@rosano2014]. There is an array of biological systems used for the recombinant protein expression, however there is no single system that subserves as the single route to the best production of all proteins. This often means a trial and error approach, until the right system is identified. Some of the commonly used systems are: isolated cell lines of mammals or insects, and whole organisms such as yeast, fungi or algae. *E. coli* is one of the most commonly used host organisms for heterologous soluble protein expression [@berman2000] due to its simplicity, low cost, relatively good knowledge of transcription, translation and protein folding processes as well as ease of manipulation. According to Protein Data Bank, almost 75 % of all structures have been derived from proteins expressed in *E. coli* [@berman2000]. This includes the structure of GLIC [@hilf2009] and ELIC [@hilf2008]. In addition, an expression of functional AChBPs [@abraham2016] in *E. coli* cells and full length human $\alpha7$ [@tillman2016] have been reported.
(ref:e-coli-structure) **The *E. coli* cell.** *E. coli* is a Gram negative bacteria shielded by a capsule and encapsulated by 2 layers of the membrane separated by the periplasmic space. Main organelles in the cytosol are nucleoid containing the genetic material, inclusion bodies typically containing protein aggregates and ribosomes for protein translation.
```{r e-coli-structure-label, fig.cap="(ref:e-coli-structure)", fig.scap='Schematic representation of the \\textit{E. coli} cell.', fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/e_coli.png")
```
<!-- ### Expression strains of *E. coli* -->
<!-- There is a number of *E. coli* strains used in molecular biology for protein expression, most of which are descendants of K-12 and B *E. coli* strains [@daegelen2009, bachmann1996]. K-12 cells were first isolated in the early 20th century in California [@bachmann1996]. The origin of B-cells is unknown, but it has been in use since the early 20th century in multiple labs [reviewed in @daegelen2009]. The mutation of B-cells led to generation of multiple strains, one of which is BL21 [@daegelen2009]. -->
<!-- Over the years, strains used for protein expression have been extensively mutagenized to allow recombinant protein expression and to aid proteins' stability and folding. A major development in the generation of expression strains was a development of BL21(DE3). DE3 is a genomic sequence derived from bacteriophage. It was integrated into the chromosomal sequence of BL21 to produce BL21(DE3). DE3 containing bacteriophage T7 RNA polymerase system. Under normal conditions, the expression of T7 is inhibited by a repressor. However, T7 can be produced, should an inducer, such as Isopropyl $\beta$-D-1-thiogalactopyranoside (IPTG) be added to the growth medium. IPTG binds to the repressor, allowing native *E. coli* T3 RNA polymerase to transcribe the T7 polymerase. T7 polymerase can then transcribe any gene under the control of T7 promoter in the expression vector (section below). -->
<!-- There is a number of other genomic alterations introduced into BL21(DE3) cells to increase their efficiency in recombinant protein production. To increase stability of the plasmid DNA, genes involved in DNA restriction and methylation processes (hsdS and dmc methylase) have been altered. Whereas deletions and mutation of genes encoding for some proteases, for example outer membrane bound OmpT and cytoplasmic Lon, should reduce proteolysis of expressed recombinant proteins. BL21(DE3) cells have been further modified to generate more specialised strains to accommodate expression of problematic proteins. For example, Rosetta BL21(DE3) pLysS reduced background expression of the recombinant protein. and is an attractive system for the expression of toxic proteins. Whereas Origami B allows for formation of disulphide bonding in the cytoplasm of *E. coli*, therefore can be used for the production of disulphide-bond rich proteins in the cytoplasm. -->
<!-- ### Plasmid DNA -->
<!-- Molecular biologists take advantage of genetically engineered expression plasmids to produce the protein of interest in *E. coli* cells. Expression vectors have been synthesised based on native plasmids. Native plasmids are bacterial small, circular and double stranded extra-chromosomal pieces of DNA. They encode for elements not necessary for bacterial survival, but beneficial in certain conditions. For example, they may contain an antibiotic resistant gene, allowing cells to proliferate in the presence of an antibiotic. They also contain an origin of replication sequence. This sequence is recognisable by the native bacterial replication machinery, which copies the entire plasmid DNA during growth and cell-replication. This ensures plasmid is retained in the cells and passed to the daughter cell. -->
<!-- Expression plasmids take advantage of these two features. They also contain additional sequences enabling insertion of genes encoding for the protein of interest into the plasmid. Specifically, there are multiple restriction sites. These sites are recognisable by the restriction enzymes some of which cleave the double-stranded circular DNA producing a linear DNA fragment containing overhangs. A gene of interest with complementary overhangs can then be incorporated into the linearised plasmid. This process requires the presence of T4 ligase enzyme, which two pieces of linearised DNA, joins complementary ends to produce a circular plasmid containing a gene of interest. -->
<!-- There are also elements necessary for the gene translation, such as bacteriophage-derived T7 promoter. T7 promoter is a substrate for T7 polymerase. These two elements allow for inducible translation of the gene downstream of the T7 promoter upon addition of IPTG (ref to prev section). -->
<!-- Most expression plasmids contain these four elements: the origin of replication, the antibiotic resistance, multiple cloning site and T7 promoter. Some expression plasmids contain sequences enabling protein targeting and/or purification -->
<!-- In Gram negative bacteria, such as *E. coli*, proteins can be targeted into 4 different locations: the inner or outer membrane, the periplasmic space or out of the cell. The process of protein targeting is regulated by the signal sequences. Signal sequences are short sequences of amino acids, typically 16-32, at the N-terminus of the protein, recognisable by the intracellular translocation machinery [@perlman1983]. DNA encoding for these sequences can be utilised in the expression vector, to ensure the recombinant protein is destined to the appropriate sub-cellular compartment. This is critical for successful expression of some proteins. For example, membrane proteins must be targeted to the inner membrane, whereas proteins requiring the formation of disulphide bridges must be targeted to the periplasm of *E. coli*, where oxidation of cysteines takes place [@bardwell1991]. There are two commonly used periplasmic space signal sequences - OmpT and pelB [@lei1987]. pelB is native to *Erwinia carotovora*. It is a 22-amino acid sequence: *MKY*LLPTAAAGLLLLAAQ**PAMA**. As many other signal sequences, it contains 3 basic residues at the N-terminus (italic), a string of hydrophobic amino acids, and a cleavage site (bold) [@perlman1983]. The cleavage site is recognisable by the membrane bound signal peptidase [@pugsley1993], releasing the downstream peptide into the periplasmic space. Although not native to *E. coli*, pelB directs tagged proteins to the periplasm of this bacterium [@yoon2010], via the Sec translocation pathway (Figure \@ref(fig:folding-e-coli-label). -->
<!-- (ref:folding-e-coli) **Targeting and folding of periplasmic recombinant proteins in *E. coli*.** The premature protein containing pelB signal sequence (red) is targeted to the Sec translocation system. The co-translational translocation of the proteins occurs using the energy [@daniels1981]. Partially folded protein is released into the periplasmic space. Partially folded protein can be: aggregated in the inclusion bodies (1), degraded by proteases such as DegP or Prc (2), folded into the correct tertiary (and/or quaternary) structure with the aid of chaperones such as Skp and FkpA (3) or covalently modified by formation of disulphide bonds. Cysteines can be oxidised by DSbA (4), whereas incorrectly formed disulphide bonds reduced by DsbC (5). -->
<!-- ```{r folding-e-coli-label, fig.cap="(ref:folding-e-coli)", fig.scap='Targeting and folding of periplasmic recombinant proteins in \\textit{E. coli}.', fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/results5/png/secretion_ecoli.png") -->
<!-- ``` -->
<!-- Another feature of many expression vectors are affinity tags. These are sequences either on N or C terminus of cDNA encoding for the protein of interest. Upon expression, they allow for selective purification of the tagged recombinant protein. There are a number of tags available, including large globular proteins such as 40.6 kDa maltose binding protein (MBP) and small several amino acids long stretches of amino acids, such as histidine-tag (HIS-tag). HIS-tag is a sequence encoding for 6-10 histidines. Upon expression, these histidines bind with high affinity to divalent cations. This binding affinity is used in the process of purification. Some tags, sucgh as MBP provide not only means of protein purification, but also aid solubility and stability of proteins, therefore are an important feature of expression vectors [@lebendiker2011]. -->
## Strategies used to express pentameric ligand gated ion channels in *Escherichia coli (E. coli)*.
Despite the instrinsic difficulties of expressing multimeric and membrane proteins in *E. coli*, they have been used to express and purify high quantity of folded nAChRs and related proteins. This includes AChBP [@abraham2016], ELIC [@nys2016; @hilf2008] and full length human $\alpha7$ nAChRs [@tillman2016], and the ECD of the rat $\alpha7$ [@fischer2001]. Strategies employed in these studies highlight ways of overcoming major difficulties faced when trying to express recombiant proteins in *E. coli*.
Eukaryotic secretory and membrane proteins are targeted to ER and Golgi where they undergo a process of maturation, before being sent their correct localisations. As part of the maturation process, vast number of these proteins undergo a process of post-transcriptional modification [@khoury2011], such as addition of carbohydrates (glycosylation) or formation of disulphide bonds. These modifications can contribute to the stability of the protein, aiding their folding [@xu2015]. The *E. coli* secretory system is much simpler, therefore the nature, the frequency and the mechanism of post-translational modifications differ from those in eukaryotic cells [@dell2010]. There are a number of strategies employed to overcome this problem. For example, proteins requiring formation of disulphide bonds can be targeted to the periplasmic space of the *E. coli*, where this process can take place, due to the presence of active alkaline phosphatases [ref]. To enable formation of disulphide bonds of recombinant human nAChR, $\alpha7$ was targeted to the periplasmic space of *E. coli* with the pelB sequence [@tillman2016].
Targeting to the periplasmic space may also have other advantages. There periplasmic environment is less crowded due to reduced number of secreted proteins, in comparison to the cytoplasm, therefore the likelihood of proteolysis of the recombinant protein is reduced [@makrides1996]. This may lead to potential increased stability of proteins in the periplasm vs cytoplasm. Expression in the periplasm may be advantageous for some proteins, even those that do not require formation of disulphide bonds, such as ELIC [@hilf2008; @nys2016].
One of the major obstacles when producing a recombinant protein in *E. coli* is it that many proteins tend to form insoluble aggregates [@peternel2011]. This issue can be addressed by a number of approaches. First, recombinant protein can be tagged by another protein, native to the biological host. MBP is an *E. coli* periplasmic protein [@bedouelle1983]. N-terminal fusion of the protein of interest with MBP increases solubility and stability of proteins expressed in both cytoplasmic and periplasmic space [@raran-kurussi2015], including those rich in disulphide bonds [@planson2003]. MBP fusion strategy was employed by @fischer2001 to express $\alpha7$ ECD and @hilf2008 to express ELIC. Another way to increase solubility is to to produce a fragment and not a full length of the protein. This is a common approach employed when studying the soluble domains of transmembrane proteins, such as ECD containing the agonist-binding pocket of nAChRs. ECD is soluble, therefore it may be easier to successfully express and purify than the full-lent protein containing hydrophobic sections [ref]. Importantly, ECDs expressed heterogeneously can form pentameric assemblies and folded binding sites [@kouvatsos2016; @dellisanti2007]. ECD of $\alpha7$ was expressed in *E. coli* by @fischer2001. Another approach is to modify the genetic code, to introduce amino acid mutations, some of which may favour expression. For example, mutation of 2 amino acids to increase solubility can increase expression by 264-fold [@dale1994]. Mutation of a single amino acid in $\alpha7$ ECD sequence increases stability and solubility of expressed protein [@tsetlin2002]. There is also another version of the $\alpha7$ ECD containing greater alterations generated by @zouridakis2009 (Figure \@ref(fig:alpha7-seq-mutant-label)). These mutations increased protein solubility and production yield of the protein.
(ref:alpha7-seq-mutant) **Sequences of ECD nAChR variant with increased solubility.** Sequences of ECD used in this study: human $\alpha7$ (hu a7), honey bee $\alpha5$ (Ap a5) and *C. elegans* ACR-21 (Cel ACR-21) have been mutated (residues in red) based on the mutant version of $\alpha7$ (mut-10) (@zouridakis2009). In addition, Cys-loop of the honey bee and *C. elegans* subunits have been replaced for the more soluble Cys-loop sequence of *Aplysia* AChBP.
<!-- and alignment of wild-type and mutated amino acid sequence of human $\alpha7$ ECD. Introduction of these mutations, resulted in increased expression levels of folded protein in yeast. Mutated amino acids are underlined in red. Cysteines forming disulphide bonds are in yellow boxes, whereas TrpB and Tyr involved in interaction with the agonist in grey boxes. Sequence alignment taken from . -->
```{r alpha7-seq-mutant-label, fig.cap="(ref:alpha7-seq-mutant)", fig.scap = "Sequences of ECD nAChR variant with increased solubility", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/intro_alignment.png")
```
Summarising, there is no universal protocol for the expression of folded and stable recombinant proteins particularly in the challenging subdomain of the membrane protein that derives from protein with complex quaternary (pentameric) structure. Therefore, it is a common practise to try several approaches, optimising the *E. coli* growth and expression conditions along the process. Years of research developed the use of solubility enhancers, targeting signalling sequences and other approaches to allow for the expression of complex molecules, such as nAChRs and bacterial structurally related proteins. For example, to express and purified ELIC from *E. coli*, @hilf2008 expressed ELIC tagged by maltose binding protein (MBP) and targeted to the periplasmic space by pelB. pelB is native to *Erwinia carotovora* [@lei1987]. It is a 22-amino acid sequence: *MKY*LLPTAAAGLLLLAAQ**PAMA**. As many other signal sequences, it contains 3 basic residues at the N-terminus (italic), a string of hydrophobic amino acids, and a cleavage site (bold) [@perlman1983]. The cleavage site is recognisable by the membrane bound signal peptidase [@pugsley1993], releasing the downstream peptide into the periplasmic space. Although not native to *E. coli*, pelB directs tagged proteins to the periplasm of this bacterium [@yoon2010], via the Sec translocation pathway. Despite all these advances, the successful expression of nAChRs in *E. coli* has been achieved only in a handful of cases. The inability to produce high quantity and quality of nAChRs, hinders their structural analysis and understanding of the molecular basis of selectivity of important agricultural compounds, such as neonicotinoids.
\newpage
## Aims
The aim of this chapter is to develop an *E. coli* based expression platform for insect nAChRs to enable characterisation of the ligand binding site and determination of structural features underpinning their interactions with neonicotinoids.
As the first step, the expression and purification of human $\alpha7$ was initiated as a test bed. This receptor was chosen because it forms homopentameric receptors in which the recombinant expression of a single subunit can potentially drive functional expression of the ECD.
To enable expression of proteins in *E. coli* cells, necessary DNA elements were cloned into the expression vector (Figure \@ref(fig:construct-diagram-label)). These elements are the START codon, pelB, sequence encoding for a string of 10 histidines (DecaHIS), maltose binding protein (MBP) and clevage site 3C.
<!-- 1. Start codon for initiation of translation2. pelB signal sequence -->
<!-- 2. DecaHIS for purification of the proteins -->
<!-- 3. 2 amino acid long linker (amino acid sequence (PM) -->
<!-- 4. Solubility enhancer MBP -->
<!-- 5. 3 amino acid long linker (amino acid sequence PGS) -->
<!-- 4. Protease cleavage site 3C -->
<!-- 5. Extracellular domain of the human $\alpha$ nAChR -->
<!-- 6. 8 amino acid linker (GEVEQPLE) -->
<!-- 7. 2GSC subunit of a pentameric protein -->
<!-- 8. Stop codon to terminate translation -->
(ref:construct-diagram) **Schematic diagram of the DNA construct used for the expression of $\alpha7$ ECD in *E. coli*.** This is more text that belongs here.
```{r construct-diagram-label, fig.cap="(ref:construct-diagram)", fig.scap = "Schematic diagram of the DNA construct used for the expression of $\\alpha7$ ECD in \\textit{E. coli}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/Final_construct.png")
```
START codon initiates protein translation, pelB targets the protein to the periplasm, DecaHIS and/or MBP enable purification with a nickel or dextrin chromatography column, respectively. MBP also acts as a solubility enhancer, whereas 3C is cleavage site enabling removal of pelB-HIS-MBP-3C from downstream peptide upon treatment with an appropriate protease. Downstream of these elements sequence encoding for the $\alpha7$ extracellular domain was cloned. There are several reasons why expression the ligand binding domain without the transmembrane domain was carried out. First, this study is concerned with the structure of the ligand binding site, which is contained in the ECD domain of the receptor. ECD is potentially soluble, therefore easier to successfully express and purify than the full-length protein containing hydrophobic sections. Although ECDs can form pentameric channels, the sequences within the TM region of the receptor may be also important in the process of receptor assembly [@wang1996a]. To account for this, the ECD was flanked by sequence encoding for 2GSC - a single subunit of a pentameric protein.
(ref:2gsc) **Comparison of the pentameric soluble bacterial protein transmembrane domain of the nicotinic acetylcholine receptor.** 2GSC is a 4-helical protein, assembling into a pentameric bundle (a). The general architecture and dimensions closely reassemble those of the nAChR transmembrane domain (b). Images and dimensions were derived in UCSA Chimera (PDB codes:2GSC and 2BG9 for muscle nAChR). Distances were derived by calculating distances from the most distal atoms on the polar ends of the structures.
```{r 2gsc-label, fig.cap="(ref:2gsc)", fig.scap="Comparison of the pentameric soluble bacterial protein transmembrane domain of the nicotinic acetylcholine receptor", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/2GSC+TM_nachr.png")
```
2GSC is a cytosolic protein endogenous to Gram-negative bacteria *Xanthomonas campestris*. Its structure was derived by X-ray crystallography, following the expression in and purification from *E. coli* (Figure \@ref(fig:2gsc-label)) [@lin2006]. 2GSC is a four-helical protein assembling into pentameric bundles. The overall architecture is similar to that of the nAChR membrane spanning domain (Figure \@ref(fig:2gsc-label)), however, 2 GSC is soluble. It is therefore hypothesised that the oligomerisation of the 2GSC could aid assemble of pentameric ECD of nAChRs.
It needs to be noticed that although this chapter describes the expression of human $\alpha7$ receptor, the expression of several other genes have been tested.
Two further ECDs, namely honey bee $\alpha5$ and *C. elegans* ACR-21 subunit were cloned. Their expression was driven from plasmids containing 2GSC, as well as two other proteins: 1VR4 and 2GUV. 1VR4 and 2GUV are bacterial proteins of unknown function, shown to form pentamers in *E. coli*. Out of 9 constructs tested, the results from the $\alpha7$ were the most promising.
<!-- ```{r tesing-constructs, echo=FALSE} -->
<!-- library(kableExtra) -->
<!-- library(dplyr) -->
<!-- testconstructs <- data.frame( -->
<!-- Construct = c("$\\alpha7$-1VR4", "$\\alpha7$2GUV", "ACR21-2GSC", "ACR21-1VR4", "ACR21-2GUV", "$\\alpha5$-2GSC", "$\\alpha5$-1VR4", "$\\alpha5$-2GUV"), -->
<!-- Expression = c("", "~10 % purified. Remainer lost after 1st spin", "", "", "", "", "", ""), -->
<!-- Purification = c("", "", "", "", "", "", "", ""), -->
<!-- Gel = c("ND", "ND", "ND", "ND", "Aggregates", "ND", "ND", "ND") -->
<!-- ) -->
<!-- testconstructs %>% -->
<!-- mutate_all(linebreak) %>% -->
<!-- kable("latex", align = "l", booktabs = TRUE, escape = F, -->
<!-- col.names = linebreak(c("Construct", "Expression", "Purification", "Gel\npurification")), -->
<!-- caption = 'Expression of human, honeybee and C. elegans nAChR extracellular domains in E. coli', -->
<!-- ) %>% -->
<!-- kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") -->
<!-- ``` -->
\newpage
## Results
### Generation of the vector for the expression of human $\alpha7$ nAChR in *E. coli* periplasm.
The expression vector was generated in a two-step reaction. First, *pelB-HIS-MBP-3C* was cloned, followed by the *$\alpha7$-2GSC*. For simplicity, *pelB-HIS-MBP-3C* sequence will be refereed to as MBP-3C.
MBP-3C was PCR amplified (Figure \@ref(fig:pet27-mbp-label), Table \@ref(tab:MBP-amplification)) with *SalI*, *NdeI* flanking primers (Table \@ref(tab:primer-seq1)) from the vector used for expression of ELIC [@hilf2008]. Purified PCR product and the destination *pET27* vectors were sequentially digested with *SalI* and *NdeI* restriction enzymes to enable ligation (Figure \@ref(fig:pet27-mbp-label)). Ligation and colony selections were performed to generate *pET27-pelB-HIS-3C* (*pET27-MBP-3C* for short), suitable for expression of proteins in the periplasm. The success of cloning was provisionally indicated by *NdeI* and *SalI* digestion to produce the backbone and insert DNA fragments of purified plasmid. The positive clones were amplified and sequenced using primers flanking the insert (Appendix \@ref(fig:pelb-3c-lbl)). A single nucleotide mutation (C substituted by A) occurred between the *pelB* and *DecaHIS*, but this conservative mutation (GCC to GCA codon) encode for alanine (Appendix E).
(ref:pet27-mbp) **Generation of the vector for the expression of proteins in the periplasm of *E. coli*.** (a) Cartoon representation of the process of amplification of the gene by PCR (a) indicating the restriction sites of enzymes used for DNA digestion. *pelB-HIS-MBP-3C* sequence was amplified from *pET26-GLIC* vector, gel excised and purified. Digested with *SalI* and *NdeI* PCR fragment was cloned into digested *pET27*. 9b) Agarose gel of digested PCR template (*pET26-GLIC*), PCR products (2), *pET27* vector backbone (3) and cloned expression *pET27-pelB-HIS-MBP-3C* vector (4 and 5) against DNA ladder (M). The sizes of generated DNA fragments in bp are given under the DNA bands. The localisation of restriction sites within the DNA fragments are indicated in a.
```{r pet27-mbp-label, fig.cap="(ref:pet27-mbp)", fig.scap = "Generation of the vector for the expression of proteins in the periplasm of \\textit{E. coli}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/cloning_pet27_mbp.png")
```
$\alpha7$-ECD-2GSC was cloned into the *pET27-MBP-3C* expression vector (Figure \@ref(fig:pet27-hu-ligation-label)). *pBMH* plasmid containing coding *$\alpha7$-ECD-2GSC* sequence was synthesised. The *Hu$\alpha7$-2GSC* gene was PCR amplified with primers containing non-complementary sequences containing *SalI* and *NheI* restriction sites (Table \@ref(tab:primer-seq1) and Table \@ref(tab:human-lgd-amplification)). PCR product and *pET27-MBP-3C* were sequentially digested with *SalI* and *NheI* restriction enzymes. Purified DNA fragments were ligated, colonies selected and DNA purified. DNA was then analytically digested with *SalI* and *NheI* as well as send for sequencing. Cloned DNA sequence was error free (Appendix F). The generated *pET27-MBP-3C-$\alpha7$-ECD-2GSC* vector was used for the expression of $\alpha7$-ECD.
(ref:pet27-hu-ligation) **Generation of the vector for the expression of ligand binding domain of human $\alpha7$ nAChR.** Schematic representation (a) and DNA agarose gel (b) of generation of expression vector. $\alpha7$ was PCR amplified using primers flanked with restriction enzyme recognition sites, digested and cloned into digested *pET27-pelB-3C* vector.
```{r pet27-hu-ligation-label, fig.cap= "(ref:pet27-hu-ligation)", fig.scap= "Generation of the vector for the expression of ligand binding domain of human $\\alpha7$ nAChR.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/generation-of-pet27-hua7-1vr4.png")
```
### Expression of $\alpha7$ chimera in *E. coli*
The *pET27-pelB-3C-$\alpha7$-ECD-2GSC* was used to express the chimera protein in *E. coli* cells. To enable protein expression, *E. coli* cells were transformed with the expression plasmid and grown in the presence of antibiotic kanamycin. Bacteria were grown in LB growth media, which contains nutrient to support bacterial growth. The conditions at which bacteria are grown can be modified to optimize protein expression (PhD thesis of Ben Yarnall, data not shown). The factors were investigated with resoect to the induced expression of $\alpha7$ ECD chimera. Transformed *E. coli* culture was grown at 37 $^\circ$C until OD600nm≈1.0 before adition of 0.5 mM IPTG for 6 hours. This method allowed for high levels of protein expression over a short period of time.
In parallel, culture was grown at 37 $^\circ$C until it reached the exponentially growing phase (OD~600nm~ = 0.6). At that point, the temperature was lowered to 18 $^\circ$C, and the growth allowed to proceeded until OD~600nm~ = 1.0. At this point, 0.2 mM IPTG was added and the cultures incubated overnight at 18 $^\circ$C.
Pre- and post-induction samples were collected for both growth and IPTG induction conditions (Section \@ref(samples) and mixed with denaturing sample buffer. Proteins present in the SDS-bacterial cell extracts before and after IPTG induction were resolved with sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualised with the Coomassie staining (Figure \@ref(fig:hua7-WB-label)).
Addition of IPTG should lead to the expression of the $\alpha7$ construct. Indeed, a distinct band of 84 kDa can be seen on the gel. The size of this band corresponds to the predicted size of expressed coding sequence from the $\alpha7$ construct.
To authenticate the band as the protein of interest Western blot of the samples run on the SDS-PAGE was performed (Section \@ref(western)). Western blot uses antibodies with high affinity for the N-terminal DecaHIS tag (Section \@ref(abs)). As seen in Figure \@ref(fig:hua7-WB-label), no protein was detected in the pre-induction sample. Whereas addition of IPTG inducer resulted in production of HIS-tagged protein. This protein is of expected size of ~ 84 kDa.
Western blot was examined closely to establish which condition resulted in the production the highest amount of the recombinant protein. Samples run on the SDS-PAGE gel were volume-normalised, thus the intensity of bands on Western blot can be compared. The expression of $\alpha7$ chimera at 37 $^\circ$C and induction with 0.5 mM IPTG was the highest after 2 hours and decreased over time. Interestingly, multiple bands were detected in sample collected after the overnight protein expression at lower temperature and lower IPTG concentration. This suggests multiple sized HIS-tagged proteins are present in the sample, including truncated or proteolysed ones. Based on band intensities, the highest level of expression was achieved after overnight expression with low IPTG concentration and at low temperature.
(ref:hua7-WB) **Expression of the $\alpha7$ ECD chimera protein in *E. coli*.** Coomassie stained SDS-PAGE gels (a) and corresponding Western blot (b) of proteins obtained from the lysed whole cell samples. Transformed with $\alpha7$ ECD containing plasmid *E . coli* were grown in 1 L of LB. Protein expression was induced with either 0.5 mM IPTG and proceeded to be grown at 37 $^\circ$C or with 0.2 mM IPTG and proceeded to be raised at 18 $^\circ$C. Samples of the cellular suspension prior to induction (pre-induction) and at 2, 4, 6 hours after the induction with high IPTG concentration were taken. Alongside, a sample after overnight (16-hour expression) driven by low concentrations of IPTG (0.2 mM) were taken. Samples were prepared as described in Section \@ref(samples).
```{r hua7-WB-label, fig.cap="(ref:hua7-WB)", fig.scap= "Expression of the $\\alpha7$ ECD chimera protein in \\textit{E. coli}.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/induction-of-hua7-2gsc-WB-and-SDS.png")
```
Following overnight protein expression at 18 $^\circ$C, induction by 0.2 mM IPTG, and 6-hour expression at 37 $^\circ$C induction with 0.5 mM IPTG, the protein was purified. (Section \@ref(purification-general-methods)). At each stage of purification the samples were collected to run them on the SDS-PAGE gel. Briefly, purification was done is a three-step process. The cells were precipitated and broken down by sonication to release their content. Homogenised cells were then spun down (low speed spin) to remove the unbroken cells, nucleic acids, organelles and large insoluble cellular particles, such as inclusion bodies (precipitant was collected as a whole cell sample). The supernatant from this low speed spin was then spun at 100 000g to precipitate cellular organelles. $\alpha7$ ECD in the 100 000g soluble fraction was subsequently resolved using solid phase Ni^2+^-NTA IMAC purification (Section \@ref(his)). Briefly, the soluble fraction was incubated with Ni^2+^-NTA resin for 2 hours at 4 $^\circ$C to allow binding of the expressed HIS-tagged $\alpha7$ ECD chimera to beads. The mixture was decanted into the chromatography column. The unbound proteins were collected in the flow-through, before the the beads were washed three times. The wash fractions were pooled and run as “Wash” on the gel. The resin-bound protein was then eluted by washing the column with 5 mL of 0.2 mM imidazole, to displace the HIS-tagged protein from the imobilized Nickel by competition. The eluted proteins were collected in two eluate fractions (Eluate 1 and 2).
Representative samples from each of the fractions indicated above were resolved on the SDS-PAGE gel (Figure \@ref(fig:expression-conditions-test-label)) and the presence of recombinant protein was detected by a Western blot with anti-HIS-tag antibodies (Figure \@ref(fig:expression-conditions-test-label) b). Since most of the purification features are common following expression at 18 and 37 $^\circ$C, some general comments are be made first. Then the comparison between the total purified protein will be made between the two.
The whole cell sample is the precipitate collected after the low-speed spin of the sonicated cells. As expected, a large number of proteins of various sizes were present in this sample, as visible on the Coomassie stained SDS-PAGE. There is a high intensity band of 84 kDa (size corresponding to the expression product of $\alpha7$ ECD chimera) on both the Coomassie stained SDS-PAGE and the Western blot. This suggests that following harvest, the cells were either not broken up entirely and the recombinant protein retained intra-cellularly, or the protein was present in the inclusion bodies. To account for this, the sonication steps were extended from 6 to 8 minutes in the future experiments.
"Flow through" and "Wash" were samples collected during the first two steps of IMAC, and are expected to contain proteins with no- or weak - affinity to Ni^2+^-NTA resin. Indeed, a large number of proteins of various sizes can be seen on the Coommassie stained gel, particularly in the "Flow through". Additionally, there is also Immunoreactive proteins of the expected $\alpha7$ ECD chimera protein size present in both the Flow Through and Wash, suggesting it failed to bind to the Ni^2+^-NTA resin with high affinity. This could indicate that the insufficient amount of resin was present, therefore not all HIS-tagged protein managed to bind. Alternatively, the HIS-tag was buried in the tertiary and/or quaternary structure of the protein and was thus not accessible for interactions. Therefore, the amount of resin was increased for future experiments from 0.5 mL to 1 mL used for purification of the protein from 1 L of culture. Additionally the incubation time of the incubation of the soluble fraction with resin was increased from 2 hours to overnight.
Eluate samples are expected to contain proteins with high affinity to Ni^2+^-NTA resin. However, no immunoreactive protein was detected in the eluate following expression induced at 37 $^\circ$C and 0.5 mM IPTG. In contrast, there is a band on the Western blot in the eluate collected after expression at 18 $^\circ$C and 0.2 mM IPTG, corresponding to the $\alpha7$ ECD, based on its size of 84 kDa. Thus, more protein is being successfuly purified following extended expression at lower temperature. Therefore, based on the expression and purification, more protein is being expressied at and purified following expression at 18 $^\circ$C.
(ref:expression-conditions-test) **The effects of the temperature and inducer concentration on the expression of $\alpha7$ nAChR chimera in *E. coli*.** SDS-PAGE gel (a) and corresponding Western blot (b) of samples collected during the purification of $\alpha7$ nAChR chimera following the side by side expression of the protein at two different conditions. The expression was proceeded as explained in Figure \@ref(fig:hua7-WB-label). Following expression, cells were harvested and homogenised. Protein purification proceeded as described in methods (ref). The expected size of monomeric $\alpha7$ nAChR chimera is 84 kDa.
```{r expression-conditions-test-label, fig.cap = "(ref:expression-conditions-test)", fig.scap = "The effects of the temperature and inducer concentration on the expression of $\\alpha7$ nAChR chimera in \\textit{E. coli}.", fig.align='center', fig.align='center', out.height = '60%', echo=FALSE}
knitr::include_graphics("fig/results5/png/expression_condition_comparison_2.png")
```
### Purification of the $\alpha7$ chimera protein
The expression and purification process was repeated with the modified conditions. That is, 1. lower IPTG concentration and low temperature during the expression, 2. extended sonication time, 3. overnight equilibration of the soluble fraction with resin and 4. increased amount of resin used were.
To determine whether modified conditions have an effect on the protein purification efficiency, samples were collected during the purification procedure. Following expression of the protein at 37 $^\circ$C induced with 0.2 mM IPTG, cells harvested from 1 L of culture were sonicated and centrifuged at 16000g. The centrifugation precipitate sample was run on the SDS-PAGE (Whole cells). The supernatant was spun down again at 100000g to collected a soluble fraction (Load) which was subsequently incubated with 1 mL of Ni^2+^-NTA resin (binding capacity of up to 40 mg) overnight. The mix was decanted onto the chromatography column. This was followed by 3 washes in 10 mL of buffer and 1 mL of 0.2 mM imidazole-containing buffer to generate 5 distinct eluate fractions obtained from the Ni2+-NTA IMAC samples. Collected samples were prepared and run on the SDS-PAGE gel (Figure \@ref(fig:hua7-expression-gel-label)).
This showed a band of the expected size of 84 kDa was present in eluate samples suggesting successful purification of $\alpha7$-ECD chimera together with few other contaminants, the 50 kDa one being the most prominent, as judged by the staining intensity.
Intensely stained band corresponding to the size of the $\alpha7$-ECD chimera is also seen in the whole cell and the load fractions, suggesting that the significant proportion of the induced protein was lost during centrifugation steps.
<!-- In comparison to the previous results, the intensity of $\alpha7$ ECD chimera protein bands is greater here, indicating a higher amount of protein present. This suggests that the introduced protocol changes do indeed improve the purification efficiency. However, since these changes were all introduced at once, it is difficult to state which ones were the most beneficial. -->
(ref:hua7-expression-gel) **Coomassie stained SDS-PAGE gel of samples collected during purification of $\alpha7$ ECD chimera protein.** *E. coli* cells were grown in 1L of TB. Protein expression was induced with 0.2 mM IPTG and proceeded overnight.
```{r hua7-expression-gel-label, fig.cap="(ref:hua7-expression-gel)", out.height = '30%', fig.scap = "Coomassie stained SDS-PAGE gel of samples collected during purification of $\\alpha7$ ECD chimera protein.", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/Hua7_expression.png")
```
During preparation of samples for the SDS-PAGE, samples are heated resulting in protein denaturation and disintegration of individual subunits in multimeric complexes. Therefore, based on obtained SDS-PAGE results, it is impossible to state whether the expressed $\alpha7$ ECD chimera is monomeric or pentameric. It is crucial for the recombinant protein to form multimeric complexes, because the nAChR ligand binding sites are on the interface of two neighbouring subunits. A blue native PAGE gel of non-denatured and non-reduced samples was run to allows for separation of proteins based on their mass and charge. The bands were visualised using a Coomassie stain.
The collected eluate (Figure \@ref(fig:hua7-expression-gel-label)) was pooled. Two samples were prepared, one of which was boiled for ~ 5 minutes to denature any multimeric proteins into their constituent subunits. The boiled sample should contain proteins only in the monomeric form, whereas non-boiled sample should contain proteins in their native state. The boiled sample was cooled and together with the un-boiled one, run on the native gel with the aim to determine whether there are any high molecular weight bands selectively present in the un-boiled sample (Figure \@ref(fig:native-gel-label).
Boiled sample contains a single band of ~ 55kDa. There is also a corresponding band in the unboiled sample. A clear and strong staining present at the top of the gel produced from the un-boiled sample is also evident. This could represent a multimeric form of the $\alpha7$ ECD chimera. The size of a pentamer is 420 kDa, therefore it is possible that the electrophoresis was run not for long enough to allow the protein to enter the gel. Alternatively, the staining could represent protein aggregates.
<!-- Protein samples run on SDS-PAGE gel undergo denaturation. To determine if $\alpha7$ ECD chimera is purified as a monomer or oligomer, purified samples were run on a native gel. -->
<!-- Samples were boiled and unboiled. Boiling on the protein leads to denaturation, hence this sample should complain monomeric proteins exclusively. In contrast, unboiled samples could contain monomeric and oligomeric proteins. Alongside, bovine serum albumin (BSA) was run as a size marker. BSA is a monomeric protein of 66.5 kDa- similar to the size of a monomeric $\alpha7$ ECD chimera. It also forms dimers on native gel of 127 kDa []. -->
<!-- Comparing boiled and unboiled samples on the native gel, there is no difference in the distance travelled by bands present. Both samples produced bands. These bands are between the monomeric and dimeric BSA. This means, their size is larger than 66.5 kDa, but smaller than 127 kDa. These bands probably represent a monomeric version of the protein of 76 kDa. -->
<!-- Interestingly, unboiled sample contains a staining at the well entry. This may suggest there are protein aggregates, or alternatively a protein of large size which has not entered the gel. The latter is unlikely, as the boiled sample does not contain such staining. Therefore it is likely that expressed protein forms aggregates. -->
(ref:native-gel) **Commasie stained Native Blue PAGE gel of $\alpha7$ ECD chimera eluates.** Boiled and unboiled eluate samples of eluted $\alpha7$ ECD chimera protein (Figure \@ref(fig:hua7-expression-gel-label)) were run on native non-denaturing gel alongside molecular weight markers (M) and un-boiled Bovine Serum Albumin (BSA) sample of 66.5 kDa.
```{r native-gel-label, fig.cap="(ref:native-gel)", fig.scap='Commasie stained Native Blue PAGE of denatured and native elaute samples collected following the $\\alpha7$ ECD chimera purification', fig.align='center',out.width='30%',echo=FALSE}
knitr::include_graphics("fig/results5/png/annotated_native_gel.png")
```
Size-exclusion chromatography, also known as gel filtration, is a complementary method for accessing the size of protein. The advantage of this method over PAGE is that the size estimation is much more accurate and the separation range is much greater (in this case, 10 - 600 kDa). This procedure uses a matrix filled column, containing pores of defined size. Loaded proteins can travel through the column at a defined speed, depending on their molecular weight. There is a reversal relationship between the molecular weight and the motility rate. That is, smaller molecules travel slower and are eluted later from the column, in comparison to the larger ones. Proteins are detected by spectroscopy because their amide bonds absorb at 280 nM. The result is a spectra of the absorbance against the eluted volume (Figure \@ref(fig:standard-curve-gel-filtration-label)).
To estimate the size of proteins present in a sample, the standard curve was generated using (Section \@ref(calibration)). The homogeneous solutions of proteins of known sizes were run to derive their spectra. The proteins used were: trypsin of 23.3 kDa, chicken serum albumin of 47.5 kDa, bovine serum albumin of 66.5 kDa and Dextrin which forms large aggregates. The peak position as a function of volume eluted was derived and normalised to the peak position of the void (aka protein which does not enter the column pores, but passes straight through). The the normalised peak positions for blue dextran, BSA, Chicken Serum Albumin and Trypsin were 0, 5.25, 6.90 and 7.75, respectively (Figure \@ref(fig:protein-standard-label)). These values were plotted on a logMw against normalised peak position graph and to produce an equation of a staright line of y = -0.17 x + 2.78, where y is the log molecular weight of the protein and x is the normalised peak position. This equation was then used to calculate the size of the proteins present in $\alpha7$ ECD chimera.
<!-- {r figure-1, fig.cap="(ref:native-gel)", fig.scap='Commasie stained NAtive Blue PAGE of denatured and native elaute samples collected following the $\alpha7$ ECD chimera purification', fig.align='center',out.width='\\textwidth',echo=FALSE} -->
(ref:standard-curve-gel-filtration) **Calibration curve for molecular weight determination by gel filtration.** 1 mL of standard proteins were applied to the column. Blue dextran was used to determine the void volume.
```{r standard-curve-gel-filtration-label, fig.cap="(ref:standard-curve-gel-filtration)", out.width= '80%', fig.scap= "Calibration curve for molecular weight determination by gel filtration." , fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/standard_curve.png")
```
To prepare samples, protein was expressed in 1 L of the growth medium and purified using optimized protocol. Eluate samples collected following Ni^2+^-NTA IMAC were pooled and concentrated to 500 $\mu$L. The final concentration of the sample was 3 mg / mL, as measured by spectoscropy. This sample was run on the SDS-PAGE gel (Figure \@ref(fig:gel-filtration-eluate-label) a).
(ref:filtration-gel) **Expression and purification of $\alpha7$ ECD chimera for size-exclusion chromatography**. SDS-PAGE gel of samples collected during protein expression and purification.
```{r filtration-gel-label, fig.cap="(ref:filtration-gel)", fig.scap="Expression and purification of $\\alpha7$ ECD chimera for size-exclusion chromatography", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/160512_SDS_purification_ACR21-2GUV.png")
```
A protein of desired size of 84 kDa was present, as well 50 and 25 kDa bands. The sample was run through the filtration column and the peak spectra was derived (Figure \@ref(fig:gel-filtration-eluate-label) b). The highest peak was eluted at 16.20 mL. Normalised to void, this is 6.72 mL. This equates to 42.6 kDa. There are also small peaks: one eluted at 22 mL, and the other at 26.70 mL. These proteins are below 10 kDa. A small peak can be also seen at ~ 10 mL which overlaps with the void peak and may represent aggregated proteins.
(ref:gel-filtration-eluate) **Estimation of proteins sizes following $\alpha7$ chimera expression and purification.** SDS-PAGE gel (a) and gel filtration spectra of concentrated $\alpha7$ ECD chimera eluate.
```{r gel-filtration-eluate-label, fig.cap="(ref:gel-filtration-eluate)", fig.scap = "Estimation of size of proteins present following $\\alpha7$ ECD chimera expression and purification", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/gel_filtration_eluate.png")
```
<!-- ```{r expression-table, echo=FALSE} -->
<!-- library(kableExtra) -->
<!-- library(dplyr) -->
<!-- phusion_components <- data.frame( -->
<!-- Construct = c("Hua7-2GUV", "Hua7-1VR4", "Ap a5-2GSC", "Ap a5-2GUV", "Ap a5-1VR4", "ACR-21-2GSC", "ACR-21-2GUV", "ACR-21 1VR4"), -->
<!-- Expression = c("YES", "YES", "YES", "YES", "YES", "YES", "YES", "YES"), -->
<!-- IMAC yield = c("", "", "", "", "", "", "", ""), -->
<!-- Column yield = ("", "", "", "", "", "", "", "")) -->
<!-- phusion_components %>% -->
<!-- mutate_all(linebreak) %>% -->
<!-- kable("latex", booktabs = T, escape = F, -->
<!-- caption = "Expression and purification of ECD of nAChRs in *E. coli*".) %>% -->
<!-- kable_styling(latex_options = "hold_position") -->
<!-- ``` -->
\clearpage
## Discussion
This chapter aims to determine whether *E. coli* BL21(DE3) cells are appropriate for the expression of ECD of nAChRs. This was done with a view to characterize candidate neonicotinoid binding sites. The difficulties in expression and purification of recombinant proteins, hinders their structural analysis and hence identification of molecular interactions between the target and the ligand.
There are several host systems available for the production of nAChRs and related proteins. For example, yeast cells have been successfully used to express assembled and folded mammalian $\alpha2$ [@kouvatsos2016], $\alpha1$ [@dellisanti2007] and $\alpha9$ [@zouridakis2014] LBD of nAChRs and nAChR LBD structural surrogate mollusc AChBP [@hilf2008; @hilf2009]. Functional mammalian $\alpha4\beta2$ receptors were successfully expressed and subsequently purified from both mammalian [@morales-perez2016] and insect cell lines [@kouvatsos2014]. *E. coli* is an attractive alternative due to the relative low cost of use and ease of manipulation. The successful expression of folded AChBPs [@abraham2016] and full length human $\alpha7$ [@tillman2016] was achieved in *E. coli* cells.
The suitability of *E. coli* as an expression system for nAChR ECD was tested by expressing and purifying human $\alpha7$ ECD - chimera protein.
### Expression and purification of $\alpha7$ ECD chimera yields product of the correct size
The initial experiments were carried out to determine whether and under what conditions can the expression of $\alpha7$ ECD - chimera can be achieved. Two conditions were tested: rapid expression at 37 $^\circ$C and 0.5 mM IPTG and slower expression at 18 $^\circ$C and 0.2 mM IPTG. The cells expressing $\alpha7$ LBD - chimera were collected from both conditions. Pre- and post-induction samples were run on the SDS-PAGE gel and Coomassie stained to resolve and visualise proteins (Figure \@ref(fig:hua7-WB-label)). $\alpha7$ LBD - chimera was authenticated by Western blot using anti-HIS antibodies. Clear band of 84 kDa present in the induced samples, confirming successful expression. Greater intensity of the band from 18 $^\circ$C and 0.2 mM IPTG suggest this is a favourable condition for the expression of $\alpha7$ LBD - chimera. Lower temperature and IPTG concentrations were also beneficial for the expression of other $\alpha7$ LBD construct [@abraham2016].
In addition, to the band representing $\alpha7$ LBD - chimera there was also an induction of the 50 kDa protein, which is likely a proteolytic fragment with the HIS-tag, based on immunoreactivity.
<!-- It was the thickness at 2 hrs and smallest at 6 hours. This suggests the protein is either degraded, or the expression of $\alpha7$ LBD - chimera induced with high IPTG concentration was toxic to cells. The toxicity could be detected by measuring the optical density of the culture. The decreasing values would suggests $\alpha7$ LBD - chimera is toxic. Toxicity of cell due to the expression of eukaryotic proteins is a common problem during the protein expression [dumon-seignovert2004]. This may be a result of aggregation of large amount of mRNA in the cell which saturates the translation and translocation system [@wang2011a]. Sample from the overnight expression induced by 0.2 mM was collected 16 hrs after the expression was induced. A band of the size corresponding to the $\alpha7$ ECD - chimera was detected. In comparison to the 2 hrs fast expression band, it was thicker, suggesting induction of expression with 0.2 mM IPTG and expression at lower temperature give rise to higher expression yields. Temperature and IPTG concentration are important determinants of the soluble protein expression [@san-miguel2013]. Low temperature and IPTG concentrations were also beneficial in expression of another $\alpha7$ ECD chimera [@abraham2016]. -->
Western blot with anti-HIS antibodies detected the presence of HIS-tagged proteins with immunoreactivity consistent with the expressed size of $\alpha7$ ECD - chimera. However, purification results showed that the proportion of induced protein availble for binding was disappointing. The expressed protein was lost during the purifcation procedure, some was precipitated following centrifugation of sonicated cells (Figure \@ref(fig:expression-conditions-test-label) Whole Cell sample), suggesting the formation of inclusion bodies. In addition, some expressed protein failed to bind to the nickel resin, potentially due to misfolding or aggregation. The expression of remaining contstruct was even more challenging, with a smaller proportion of the ECD - chimera purified.
### Analysis of the quaternary structure.
To determine whether the protein was purified as a pentamer, a native-PAGE gel was run, which enables separation of folded and assembled proteins on the gel. Two samples were prepared: one containing denatured by boiling proteins and the other containing non-denatured, un-boiled proteins. A clear staining of high molecular weight proteins was observed in the un-boiled sample, but not in the boiled sample, suggesting purification of multimeric proteins. The presence of high molecular weight protein was not confirmed by gel filtration. Therefore further experiments are needed to investigate whether expressed $\alpha7$ ECD chimera forms pentameric structures. This could include binding of radio labelled ligands, such as $\alpha-bgtx$ [@barnard1971; @carbonetto1979; @clarke1985].
<!-- ### Expressed protein is prone to the proteolytic cleavage. -->
<!-- Additional information can be extracted about the stability of expressed proteins by the analysis of sizes of protein present in the eluates following $\alpha7$ ECD - chimera expression and purification. SDS-PAGE and Western blot revealed there is a number of HIS-tagged proteins of smaller than $\alpha7$ ECD chimera purified. Since HIS-tag is on the N-terminus, these bands represent the N-terminal portions of the protein. The major band detected is of the size of ~ 50 kDa, which corresponds to the size of the HIS-MBP. This may suggest that there is a proteolytic site in the MBP-$\alpha7$ ECD linker sequence, or at the N-teminal site of the $\alpha7$ ECD. However, due to the poor availability of substrate sequences for *E. coli* proteases, this is difficult to predict. An alternatively explanation for the C-terminal proteolytic degradation is that $\alpha7$ ECD-2GSC does not fold correctly and is unstable. 2GSC is a bacterial 4-helical structure forming pentamers [@lin2006]. The crystal structure was derived from proteins expressed and purified in *E. coli* cytoplasm, whereas in this study it was targeted to the periplasm [@lin2006]. Targeting to the periplasmic space may have a detrimental effect on the stability and solubility of the protein (@latifi2015), leading to protein degradation. It would be therefore beneficial to further optimise the purification protocol to increase stability of the protein, for example by growth of transformed *E. coli* cells with $\alpha7$ ligands to stabilise $\alpha7$ ECD. An addition of heat shock inducing compounds to promote formation of chaperones could be also beneficial [@tillman2016]. -->
In summary, this chapter validates the use of *E. coli* as a system for the expression of $\alpha7$ ECD and highlights the need for further optimisation to improve stability and purification efficiency of the recombinant protein.
\newpage
<!-- Analysis of the proteins by the SDS-PAGE requires denaturation of proteins prior to loading samples on the gel. Therefore all proteins are in the monomeric state. To establish whether eluates collected post expression contain proteins of various sizes, native-SDS-PAGE was run. This method allows for the analysis of eluate samples without the necessity of denaturing. 2 samples were prepared: one boiled (hence containing denatured, monomeric proteins), and the un-boiled (hence containing non-denatured, potentually multimeric proteins). The shift in the distance migrated by proteins on the gel were examined. No differences were observed, suggesting all protein is monomeric state. -->
<!-- In conclusion, this chapter validates the -->
<!-- ###Finally, some changes to the protocol to be made and future directions -->
<!-- 1. Resticted flexibility due to tagging to other proteins. - MBP was used as a tag during AChBP exprression. It waspurified as a pentmer, therefore shpuld not interfere with pentamer formation. 2GSC is on the C-terminal end of the protein. C-terminal of $\alpha7$ ECD is linked to the N-terminal end of the 2GSC by a 8 amino acid linker. 2GSC has similar architecture to the transmembrane domain of the nAChRs, however there are also some differences. For example, Therefore tagging $\alpha7$ to 2GSC may have restricted the flexibility to $\alpha7$ ECD resulting in insufficient interactions between the subunits and inability of these to form pentamers. -->
<!-- 2. Misfolded proteins will not form pentamers - Why would they be missfolded? May imprtant sequence for oligomerisation in the ECD [@sumikawa1992; @sumikawa1994; @kreienkamp1995]. However, there may also be some sequences within the TM domain [@wang1996] of $\alpha7$ nAChRs important for oligomerisation. These are missing in this constructr. whilst the expression of ECD of some nachrs was successful [@dellisanti2007; @zouridakis2014], the expression of full lenght $\alpha7$ has only been reported [@tillman2016]. Expression of alpha and delta subunits in alpha-delta heterodimers. Expression of ECD of alpha 1 with other muscle subunits folds but does not associate with delta subunit [@wang1996a]. Inclusion of M1 seq only was enough to rescue oligomerisation of alpha1 with delta. -->
<!-- Folding of nAChRs is a complex process, with as many as 55 potential interacting partners. Maturation with many interacting partners through ER-Gogi process. In *E. coli* it is released to the periplasm as it is being synthesised. Chaperons identified: Skp captures unfolded proteins and aids their correct maturation, also other proteins including PPIases, SurA, FkpA, among others [reviewed in @baneyx2004]. -->
<!-- Another way of assesing the size of proteins present in the sample is by gel-filtration. Size of the protein is In this method, protein sample is loaded onto the porous-gel filled column. The time taken for the protein to travel across the column is inversly correlated to the molecular weight. which allows for estimation of the molecular weight of proteins present in the sample. The major protein species of the size of 50 kDa. proteolytic cleavage ? -->
<!-- Detection of proteins of sizes exceeding pentameric form of ECD of alpha7 fused to MBP also found here [@fischer2001]. -->
<!-- Note that periplasmic signal sequences destabilisies proteins [@singh2013]. -->
<!-- Better to use native signal sequences such as MA [@samant2014]. -->
<!-- Further experiemts are needed to determine whether this construct is suitable for generation of folded pentameric $\alpha7$ ECD. One would be binding to bgtx. -->
<!-- Strategies to stabilise the protein - expression of chaperon proteins and ligands - for example cholie and sorbitol used succesfully to express full lenght nAChR [@] -->
<!-- ###Expression and purification of $\alpha7$ ECD chimera yields product of the correct monomeric size -->
<!-- 1. Modify the protocol - purification at 4 $deg;C thruoghpout to slow down the rate of proteolysis - PROBLEM OF DEGRADATION - test this system first! -->
<!-- 2. Use several costructure containing many different nachrs subuntis and screen for the one that can be expressed in *E. coli*. Expression in *E. coli* [@jia2016]. -->
<!-- 1. Try different construct - try expressing HPSD, MBP, $\alpha7$ in isolation to determine what effect they have on *E. coli*, whether high quantity of folded proteins can be generated. Then combine and see whether tagging to each has an effect. -->
<!-- 2. Use defined protocols for the expression of nAChRs - some of which include *E. coli*. However, these had problems too -->
<!-- Alternative may be to Try different host - most structure come from proteins expressed in yeast because they are capable of post-transcriptional modification, such as glycosylation imp in processing of nAChRs. -->
<!-- did similar things - fused rat $\alpha7$ ECD to three stuctures assembling into pentamers. No stable proteins and all deposited into inclusion bodies. -->
<!-- @utkin2001 @fischer2001 ECD of $\alpha7$ some pentamers,but mostly aggregated proteins. -->
<!-- Column exceeds -->
<!-- Also aggregates - This is a common problem when eucaryotic proteins expressed in *E. coli*. These two factors often need to be optimised, because recombinant proteins tend to misfold and form aggregates in the inclusion bodies or in the cytoplasm and periplasm of *E. coli*. MBP was used as a tag for expression improvements for many proteins in *E. coli* []. 2GSC were expressed to high levels in *E. coli* cells for structure analysis [@lin2006], therefore $\alpha7$ ECD may be the issue here. -->
<!-- ###Protein is prone to degradation -->
<!-- ###*E. coli* may not be suitable for expression of nAChR - why? -->
<!-- Folding -->
<!-- Processing -->
<!-- Other systems should be tested -->
<!-- Alternatively different construct -->
<!-- More soluble version of nAChR is also available. @zouridakis2009 introduced several changes to the -->
<!-- Also modification of the genetic code to mutate AAs may improve solubility. -->
<!-- MBP fusion $\alpha7$ ECD [@fischer2001] and ELIC [@hilf2008] and glutathione S‐transferase (GST) $\alpha7$ ECD [@utkin2001]. -->
<!-- 2. Expression of AChBP in cytoplasm of BL21(DE3) cells [@abraham2016] -->
<!-- 3. ELIC expressed in C43 E. coli cells. ELIC fused to MBP on the N-terminal end [@nys2016] -->
<!-- 4. ELIC: His-Tag, MBP, 3C protease site and the ELIC sequence [@hilf2008]. -->
<!-- 1. Expression of the full length alpha7 nachr receptor from T7 promoter plasmid. In RosettaBL21(pLys) cells. With pelB sequence [@tillman] -->
<!-- Alternatively, the linker may not provide sufficient solubility and flexibility for the $\alpha7$ ECD to fold properly, resulting in protein degradation. $\alpha7$ ECD and MBP are linked by an 8 amino acid long sequence: Gly-Glu-Val-Glu-Gln-Pro-Leu-Glu. This sequence was used for the production of ELIC [@hilf2008], and contains features shared among many other synthetic linkers used in molecular biology and native linkers naturally occurring in biological systems [@chen2013]. Linkers connecting recombinant proteins can play a major role in the efficiency of the expression (reviewed in @chen2013), therefore they are commonly optimised for different fusion proteins. This includes the optimisation of the amino acid number and sequence to alter linker's primary and the secondary structure. -->
\ No newline at end of file
25-appendix-e.Rmd 0 → 100644
View file @ e74fe8cf
# Bacterial homopentameric soluble domains.
(ref:appd) **Structures of soluble homopentameric soluble domains**. Single subunits are color coded and the termini of a single subunits (in purple) are shown. 2GUV and 1VR4 subunts were used as C-terminal tags of nAChR expressed in *E. coli* to prompte pentamerisation. Images generated in USCF Chimera (PDB codes: 2GUV and 1VR4).
```{r appd-label, fig.cap="(ref:appd)", fig.scap="Structures of soluble homopentameric soluble domains", fig.align='center', echo=FALSE}
knitr::include_graphics("fig/results5/png/HPSD.png")
```
\ No newline at end of file
26-appendix-f.Rmd 0 → 100644
View file @ e74fe8cf
# DNA sequence used for the expression of human $\alpha7$ extracellular domain in *E. coli*
@nauen1996
@neher1995
@nguyen1995
@niacaris2003
@noda1982
@noda1983
@okkema1993
@orr1990
@partridge2008
@pereira2015
@perry2008
@petzold2011
@planson2003
@putrenko2005
@raizen1994
@raizen1995
@rand1984
@rand1985
@rand1989
@reynolds1978
@richmond1999
@rogers2006
@rosano2014
@ruan2009
@ruaud2006
@salom2012
@sattelle1981
@sattelle1983
@sattelle2005
<!-- (ref:appe) **Sequencing of *pelB-3C* cloned into *pET27* expression vector.** Inserted into *pET27 pelB-3C* sequence was sequenced using universal T7 forward and T7 terminator primers (a). The cloned sequence (Query) was compared to the expected sequence (Subject) (b). Single nucleotide mutation from A to C occured, highlighted in red, changing the codon from GCC to GCA, both of which encode for alanine. The cloned nucleotide sequence was translated (c) and major functional domains, as well highlighted. -->
<!-- \newpage -->
<!-- ```{r out.height = '90%', fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/results5/png/pelb-3c_seq_1.png") -->
<!-- ``` -->
<!-- ```{r fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/results5/png/pelb-3c_seq_2.png") -->
<!-- ``` -->
<!-- ```{r pelb-3c-lbl, fig.cap = "(ref:appe)", fig.scap= "Sequencing of \\textit{pelB-3C} cloned into \\textit{pET27} expression vector", fig.align='center', echo=FALSE} -->
<!-- knitr::include_graphics("fig/results5/png/pelb-3c_seq_3.png") -->
<!-- ``` -->
\ No newline at end of file
27-appendix-g.Rmd 0 → 100644
View file @ e74fe8cf
---
output:
pdf_document: default
html_document: default
---
# Sequencing of the DNA sequence used for the expression of of the $\alpha7$ ECD-2GSC
\newpage
(ref:appf) **Sequencing of $\alpha7$ ECD-2GSC cloned into pET27-pelB-3C expression vector.** Inserted into pET27-pelB-3C vector $\alpha7$ ECD-2GSC was sequenced using universal T7 Terminator reverse primer and primer within the 3' region of MBP (a). The cloned sequence (Query) was compared to the expected sequence (Subject) (b). The sequence was translated and merged with the pel-3C to depict the entire protein expressed (c). The major domains are highlighted, as well as the mutated Cys-loop (in red).
```{r echo=FALSE}
knitr::include_graphics("fig/results5/png/alpha7-2gsc-seq1.png")
```
```{r echo=FALSE}
knitr::include_graphics("fig/results5/png/alpha7-2gsc-seq2.png")
```
```{r appe-label, fig.cap = "(ref:appf)", fig.scap = "Sequence of the $\\alpha7$ ECD-2GSC", echo=FALSE}
knitr::include_graphics("fig/results5/png/alpha7-2gsc-seq3.png")
```
Analysis/Data/Exported/24_hrs_assay/Avoidance/% worms present.csv 0 → 100644
View file @ e74fe8cf
Cond,%_on_plate,%_on_plate,%_on_plate,%_on_plate,%_on_plate,%_on_plate
Nicotine 0,100,100,100,100,100,100
Nicotine 0.5,100,100,90,100,,
Nicotine 1,100,100,87,,,
Nicotine 10,66.66,100,100,75,,
Nicotine 25,0,25,70,25,,
Nicotine 50,0,50,,,,
Nicotine 100,0,25,,,,
Analysis/Data/Exported/24_hrs_assay/Body bends/Clot_N2_BB.csv 0 → 100644
View file @ e74fe8cf
Ctr 0,Clothianidin 1,Clothianidin 3.75
33,36,42
43,40,48
45,49,39
42,32,48
34,37,45
40,40,42
32,38,38
33,24,
41,0,
39,29,
41,29,
35,34,
42,36,
44,34,
40,20,
46,19,
47,,
38,,
40,,
36,,
30,,
29,,
34,,
38,,
32,,
43,,
49,,
\ No newline at end of file
Analysis/Data/Exported/24_hrs_assay/Body bends/Clot_bus17_BB.csv 0 → 100644
View file @ e74fe8cf
Ctr 0,Clothianidin 0.5,Clothianidin 1,Clothianidin 2,Clothianidin 3.75
30,23,0,19,18
32,25,0,18,23
29,32,22,5,0
25,34,12,15,0
32,24,17,24,12
34,24,23,22,19
33,23,26,18,17
35,17,0,20,22
24,17,9,21,16
37,11,47,18,19
30,16,47,18,18
37,,42,17,22
42,,45,,18
41,,,,0
24,,,,
22,,,,
26,,,,
35,,,,
28,,,,
25,,,,
23,,,,
23,,,,
27,,,,
20,,,,
24,,,,
32,,,,
28,,,,
40,,,,
32,,,,
39,,,,
41,,,,
\ No newline at end of file