02-methods.Rmd

# Methods {#methods}

```{r echo=FALSE, results="hide", include=FALSE}
library(grid)
library(cowplot)
library(tidyverse)
library(ggpubr)
library(readr)
library(ggplot2)
library(scales)
library(curl)
library(devtools)
library(extrafont)
library(magick)
library(kableExtra)

```

## General bacterial methods

### Transformation of *E. coli* with DNA vectors 
Briefly, 25 to 50 $\mu$L of chemically competent Mach1 or DH5$\alpha$ *Escherichia coli (E.coli)* cells were combined and gently mixed with ~10 pg of plasmid DNA. The mix was left on ice for 30 minutes. Cells were placed in 42$^\circ$C water bath and after 45 seconds placed back on ice. Next, 250-500 $\mu$L of growth medium (Luria-Bertani (LB) broth) was added and cells placed in the 37 $^\circ$C shaking incubator for 45 minutes to 1 hour. The entire volume of cells was spread onto 10 cm LB-agar plate containing an appropriate antibiotic for selection. Antibiotics used for each vector selection are listed in Table \@ref(tab:antibiotics-used). Cells were spread on plates were left in the 37$^{\circ}$C incubator overnight to allow for growth of transformed cells into colonies. 

```{r antibiotics-used, echo=FALSE}
library(kableExtra)
text_tbl <- data.frame(
  Plasmid = c("pET26", "pBMH", "pET27b(+)", "pcDNA3.1", "PCR-8-TOPO", "pDEST"),
  Antibiotic = c("Kanamycin", "Ampicillin", "Kanamycin", "Ampicillin", "Spectinomycin", "Ampicillin"))

knitr::kable(text_tbl, format = "latex", caption = 'Selection pressure for DNA plasmids used in this study.', booktabs = TRUE) %>% 
  kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position") %>% 
  footnote(general = "Ampicillin used at a final concentration of 0.1 mg/mL, whereas kanamycin and spectinomycin at 0.05 mg/mL.",
             threeparttable=T)
```

\newpage

### Isolation of DNA plasmid from *E. coli* ### {#miniprep}
Transformed *E.coli* colony was picked, placed in 5 mL of LB supplemented with appropriate antibiotic and incubated overnight at 37 $^{\circ}$C whilst shaking. DNA was extracted using the MiniPrep Kit (Thermo Scientific or Qiagen) following the manufacturers instructions. Centrifugation was carried out in table top centrifuge at 12 000 g. Isolated DNA was quantified in a Nanodrop UV-Vis spectophotometer. 

### Analytic digestion of DNA plasmids
DNA plasmids were digested with restriction enzyme(s) (Promega). The reaction mix (Table \@ref(tab:RE-reaction) was incubated at 37 $^{\circ}$C for 2-8 hours and the DNA fragments were resolved on the agarose gel (Section \@ref(electrophoresis)).

```{r RE-reaction, echo=FALSE}

RE_reaction <- data.frame(
  Remove = c("10x Buffer", "BSA", "DNA", "Enzyme", "dH$_2$O"),
  Remove = c("1 $\\mu$L", "0.1 $\\mu$L", "1-2 $\\mu$g", "5 units", "up to 10 $\\mu$L"))

names(RE_reaction) <- NULL

knitr::kable(RE_reaction, "latex", escape = FALSE, booktabs = TRUE, caption = "Components assembled to cary out restriction enzyme reaction.") %>% 
  kable_styling(latex_options = "hold_position")
# %>%  kable_styling(position = "center") # use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page). Note that the styling function does not work here because it is from the extra package 

```

## General molecular biology methods 

###	Amplification of DNA fragments by Polymerase Chain Reaction (PCR)

####	Primer design
To enable the amplification of the DNA of interest, appropriate PCR primers were designed applying the following criteria: primers were unique to the annealing site on the designated DNA, 18 to 25 nucleotides long, guanine-cytosine content from 40 to 60 %, melting temperature from 55 to 75 $^{\circ}$C. Where possible, primers rich in guanine and cytosine at 3’ end were selected to facilitate high specificity of primer binding to the target. The primers were ordered from Eurofins Genomics, subsequently diluted in ddH~2~O to the concentration of 100 pmol/$\mu$l and stored at -20 $^{\circ}$C. Sequences of primers used in this study can be found in Table \@ref(tab:primer-seq1). 

```{r primer-seq1, echo=FALSE}
library(kableExtra)
library(dplyr)
pcr_primer_seqs <- data.frame(
  DNA.product = c("\\textit{Ndel-pelB-3C-SalI}", "\\textit{SalI,$\\alpha$7ECD-2GSC-NheI}", "\\textit{CHRNA7}", "\\textit{eat-2}"),
  Primer = c("Fw: gaaggagatatacatatgaaatacctg\nRv: TAGCTTGTCGACgggcccctggaacagaacttc", "Fw: AGCTCCGTCGACtttcagcgtaaactgtacaaag\nRv: ACTAGCTAGCTTAaagcttagccgcaccacggcg", "Fw: atgcgctgctcgccgggaggcg\nRv: ttacgcaaagtctttggacacggc", "Fw: atgaccttgaaaatcgca\nRv: ttattcaatatcaacaatcgg"), 
  Size = c("1560", "1051", "1509", "1425"))

pcr_primer_seqs %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F,
       col.names = linebreak(c("DNA product", "DNA primer", "Size\n(bp)")), caption = "DNA primers used in this study.") %>% 
  kable_styling(latex_options = "hold_position") %>% 
  footnote(general = "Sequences are presented in 5' to 3' direction, non-complementary nucleotides are in capital letters whereas complementary in small letters. Fw stands for forward, whereas Rv for reverse primer.", 
           threeparttable = T)
```

\newpage
#### PCR Protocol 
PCR was performed using either Phusion High-Fidelity DNA Polymerase (Thermo Scientific) or Pfu DNA polymerase (Promega) as indicated. The components mixed and cycling conditions used are listed in Tables \@ref(tab:Phusion-pol) and \@ref(tab:Pfu-pol). 

<!-- Table: (\#tab:PCR-cond) PCR conditions used to amplify DNA fragments.  -->

<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |Primer                    |Primer T~M~| Polymerase|PCR T~A~  |Extension | -->
<!-- |                          |(&deg;C)   |used       |(&deg;C)  |time      |  -->
<!-- +==========================+===========+===========+==========+==========+ -->
<!-- |Fw/Rv                     |59.3/81.3  |   Pfu     |45.0      |3 minutes | -->
<!-- |NdeI-pelB-3C-SalI         |           |           |          |          | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |Fw/Rv                     |75.8/79.2  | Phusion   |55.4      |30 seconds| -->
<!-- |SalI-Hu$\alpha7$          |           |           |          |          | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |/Rv                       |71.4/62.7  | Phusions  | 50-62    |45 seconds| -->
<!-- |CHRNA7                    |           |           |          |          | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->
<!-- |Fw/Rv                     |59.7/50.1  |Phusion    | 53.4     |45 seconds| -->
<!-- |eat2                      |           |           |          |          | -->
<!-- +--------------------------+-----------+-----------+----------+----------+ -->


<!-- Table: (\#tab:Taq-pol) Components assembled for Taq polymerase-mediated PCR reaction.  -->

<!-- +---------------+---------------------------+ -->
<!-- |Component      |Concentration              | -->
<!-- +===============+===========================+ -->
<!-- |Buffer         | 1x                        | -->
<!-- +---------------+---------------------------+ -->
<!-- |dNTP mix       | 200 &mu;M                 | -->
<!-- +---------------+---------------------------+ -->
<!-- |Reverse/       |                           | -->
<!-- |Forward primer | 200 nM                    | -->
<!-- +---------------+---------------------------+ -->
<!-- |DNA            | 25 ng/10&mu;L reaction    | -->
<!-- +---------------+---------------------------+ -->
<!-- |Indicated      |                           | -->
<!-- |Polymerase     | 0.25U/10&mu;L reaction    | -->
<!-- +---------------+---------------------------+ -->
<!-- |ddH~2~0        | up to up to 10/50 &mu;L   | -->
<!-- +---------------+---------------------------+ -->

<!-- Table: (\#tab:Taq-pol-2) Thermal cycling conditions for Taq polymerase-mediated PCR reaction. -->

<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Step                |Duration   |Temperature |Number       | -->
<!-- |                    |           |            |of cycles    | -->
<!-- +====================+===========+============+=============+ -->
<!-- |Initial denaturation|2 mins     |95 &deg;C   |1            | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Denaturation        |45 secs    |95 &deg;C   |             | -->
<!-- |                    |           |            |             | -->
<!-- |Annealing           |45 secs    |various     |25-35        | -->
<!-- |                    |           |            |             | -->
<!-- |Extension           |1 min/kb   |72 &deg;C   |             | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Final extension     |5 mins     |72 &deg;C   |1            | -->
<!-- +--------------------+-----------+------------+-------------+ -->


```{r Phusion-pol, echo=FALSE}
library(kableExtra)
library(dplyr)
phusion_components <- data.frame(
  Component = c("Buffer", "dNTP mix", "Reverse/\nForward primer", "DNA", "Polymerase", "ddH$_2$O"), 
Concentration = c("1x", "200 $\\mu$M", "500 nM", "10 ng / 50 $\\mu$L reaction", "0.5 U / 50 $\\mu$L reaction", "up to 50 $\\mu$L"))

phusion_components %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F, 
caption = "Components assembled for Phusion polymerase-mediated PCR reaction.") %>% 
  kable_styling(latex_options = "hold_position")
```

<!-- Table: (\#tab:Phusion-pol-2) Thermal cycling conditions for Phusion polymerase-mediated PCR reaction.  -->

<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Step                |Duration   |Temperature |Number       | -->
<!-- |                    |           |            |of cycles    | -->
<!-- +====================+===========+============+=============+ -->
<!-- |Initial denaturation|20 secs    |98 &deg;C   |1            | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Denaturation        |10 secs    |98 &deg;C   |             | -->
<!-- |                    |           |            |             | -->
<!-- |Annealing           |30 secs    |various     |25-35        | -->
<!-- |                    |           |            |             | -->
<!-- |Extension           |30s/kb     |72 &deg;C   |             | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Final extension     |7 mins     |72 &deg;C   |1            | -->
<!-- +-----------------------------------------------------------+ -->

```{r Pfu-pol, echo= FALSE}
library(kableExtra)
library(dplyr)
phusion_components <- data.frame(
  Component = c("Buffer", "dNTP mix", "Reverse/\nForward primer", "DNA", "Polymerase", "ddH$_2$O"), 
Concentration = c("1x", "200 $\\mu$M", "500 nM", "25 ng / 50 $\\mu$L reaction", "0.25 U / 50 $\\mu$L reaction", "up to 50 $\\mu$L"))

phusion_components %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F, 
caption = "Components assembled for Pfu polymerase-mediated PCR reaction.") %>% 
  kable_styling(latex_options = "hold_position")
```

\newpage

<!-- Table: (\#tab:Pfu-pol-2) Thermal cycling conditions for Pfu polymerase-mediated PCR reaction. -->

<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Step                |Duration   |Temperature |Number       | -->
<!-- |                    |           |            |of cycles    | -->
<!-- +====================+===========+============+=============+ -->
<!-- |Initial denaturation|5 mins     |95 &deg;C   |1            | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Denaturation        |30 secs    |95 &deg;C   |             | -->
<!-- |                    |           |            |             | -->
<!-- |Annealing           |30 secs    |various     |25-35        | -->
<!-- |                    |           |            |             | -->
<!-- |Extension           |2 mins/kb  |72 &deg;C   |             | -->
<!-- +--------------------+-----------+------------+-------------+ -->
<!-- |Final extension     |5 mins     |72 &deg;C   |1            | -->
<!-- +-----------------------------------------------------------+ -->

Thermal cycling conditions used for amplification of *C. elegans* nAChR subunit *eat-2*, whole length and the extracellular domain of human $\alpha7$ nAChR subunit as well as $pelB-HIS-MBP-3C$ sequence (sequence for expression of genes and purification of proteins from *E. coli*) are shown in Tables \@ref(tab:eat2-amplification) - \@ref(tab:human-lgd-amplification).

```{r eat2-amplification, echo=FALSE}
eat2_amplification <- data.frame(
  Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
  Duration = c("2 mins", "1 mins", "30 secs", "3 mins", "5 mins"),
  Temperature = c("95", "95", "51.1", "73", "73"),
  Number = c ("1", " ", "30", " ", "1"))

eat2_amplification %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F,
       col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of eat-2 from pTB207 plasmid with Pfu polymerase.") %>% 
  kable_styling(latex_options = "hold_position") 

```


```{r CHRNA7-amplification, echo=FALSE}
library(kableExtra)
library(dplyr)
CHRNA7_amplification <- data.frame(
  Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
  Duration = c("30 secs", "10 secs", "30 secs", "45 secs", "7 mins"),
  Temperature = c("98", "98", "gradient", "72", "72"),
  Number = c ("1", " ", "30", " ", "1"))

CHRNA7_amplification %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F,
       col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of human $\\alpha$7 nAChR (CHRNA7) from pcDNA3.1 plasmid with Phusion polymerase.") %>% 
  kable_styling(latex_options = "hold_position") %>% 
  footnote(general = "gradient annealing temperatures were: 50, 51.1, 53.4, 57.2, 60.2",
                      threeparttable = T)

```

\newpage

```{r MBP-amplification, echo=FALSE}
library(kableExtra)
library(dplyr)
mbp_amplification <- data.frame(
  Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
  Duration = c("3 mins", "1 mins", "30 secs", "3 mins", "5 mins"),
  Temperature = c("95", "95", "45", "73", "73"),
  Number = c ("1", " ", "35", " ", "1"))

mbp_amplification %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F,
       col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of pelB-HIS-MBP-3C from pET26-GLIC plasmid with Pfu polymerase.") %>% 
  kable_styling(latex_options = "hold_position") 

```

```{r human-lgd-amplification, echo=FALSE}
library(kableExtra)
library(dplyr)
humanlgd_amplification <- data.frame(
  Step = c("Initial denaturation", "Denaturation", "Annealing", "Extension", "Final extension"),
  Duration = c("30 secs", "10 secs", "45 secs", "45 secs", "7 mins"),
  Temperature = c("98", "98", "51.7", "72", "72"),
  Number = c ("1", " ", "35", " ", "1"))

humanlgd_amplification %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F,
       col.names = linebreak(c("Step", "Duration", "Temperature $^\\circ$C", "Number\nof cycles")), caption = "Thermal cycling conditions for amplification of human $\\alpha$7 nAChR ligand binding domain from pBMH plasmid with Phusion HF polymerase (Thermo Scientific).") %>% 
  kable_styling(latex_options = "hold_position") 

```

\newpage

###	DNA electrophoresis ### {#electrophoresis}
To resolve the size of DNA samples, agarose gel electrophoresis was run using BioRad Wide horizontal electrophoresis system and PowerPac Basic Power Supply. The resolving gel was prepared by addition of agarose (0.6-1.2 % (w/v); Sigma Aldrich) to 1x TAE (40 mM Tris, 20 mM acetic acid, 1 mM EDTA) buffer. This mix was heated in the microwave until agarose completely melted and left on the bench to cool down to ~ 50 $^\circ$C. Subsequently, Nancy-520 DNA Gel Stain (Sigma-Aldrich) at 5 mg/mL was added in 1:1000 (v/v) dilution and the mixture was poured into the gel caster. Meanwhile, the DNA samples were prepared by mixing them with 1 % (v/v) loading dye (Blue/Orange Loading Dye, Promega). Once the gel set, the samples were loaded into wells alongside the indicated molecular weight marker. Markers variously used in this thesis include 1kb Hyperladder (Bioline), 1kb ladder (Promega) or 1 kb Plus DNA ladder (Thermo Scientific). Electrophoresis was run at 70 V until the samples were sufficiently resolved (typically 30 minutes to 2 hours) and gels imaged using Syngenta GBox.

###	DNA purification following PCR and electrophoresis 
Following gel electrophoresis, the band of interest was visualised under the UV light and isolated by cutting with a surgical blade. 
DNA was subsequently purified using GeneJET Gel Extraction Kit (Thermo Scientific) or Gel Extraction Kit (Qiagen) following manufacturers protocols.
<!-- (ref:t4-ligation) Generation of plasmids by T4-dependent ligation. DNA fragment is PCR amplified and gel purified (1). Digestion of plasmid and DNA fragment with restriction enzymes (RE, 2) generates complementary overhangs which can be ligated with T4 ligase (3) to generate recombinant DNA plasmid. -->

<!-- ```{r, t4-ligation-label, fig.cap="(ref:t4-ligation)", echo=FALSE, fig.width=9} -->
<!-- knitr::include_graphics("fig/methods/t4_cloning.png") -->

### Ligation dependent cloning ###{#ligationdependentcloning}
The DNA vector for expression of human nAChR was generated by T4 dependent ligation. PCR-amplified, gel-excised and digested with SalI and NdeI pelB-HIS-MBP-3C gene was inserted into the digested pET27 plasmid. The complementary sequences were ligated with T4 ligase (Table \@ref(tab:T4-ligase)). Next, PCR-amplified, gel-excised and digested with SalI and NheI human $\alpha7$ extracellular domain (ECD) was ligated into the digested pET27-pelB-HIS-MBP-3C. Both times reaction mixtures were incubated at room temperature for 3-4 hours and used to transform chemically competent Mach1 cells. 50-100 $\mu$L of cells were transformed with 2.5-8 $\mu$L ligation reaction mix. 

```{r T4-ligase, echo=FALSE}

ligation_table <- data.frame(
  Remove = c("Ligase buffer", "Backbone DNA", "Insert DNA", "T4 DNA ligase", "ddH$_2$O"),
  Remove = c("1 x", "100 ng", "3:1 insert:backbone ratio", "1 unit", "up to 10 $\\mu$L"))

names(ligation_table) <- NULL

kable(ligation_table, format = "latex", escape = FALSE, align = 'l', booktabs = TRUE, caption = "Components assembled to carry out ligation-dependent cloning reaction.") %>%  kable_styling(position = "center", latex_options = "hold_position")

# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)

```

### Gateway cloning ###{#gatewaycloning}
Vectors for generation of *C. elegans* transgenic genes were generated by recombinant Gateway Cloning.

<!-- (ref:gateway-cloning) Gateway recombinant cloning to generate expression vectors. The gene of interest was PCR amplified, gel pufiried and 3' A overhangs added (1) by Taq polymerase. It was then cloned into TOPO vector by TA recombination (2) reaction to generate the entry clone containing a gene of interest. Expression vector was generated by LR recombination between the L site containing entry clone and R sites containing destination vector. The desired vector was selected with an antibiotic. -->

<!-- ```{r gateway-label, fig.cap="(ref:gateway-cloning)", echo=FALSE} -->
<!-- knitr::include_graphics("fig/methods/Gateway_Cloning.png") -->
<!-- ``` -->

#### Generation of the entry (TOPO) vector by TA recombination ####{#adenosineoverhang}
3' adenine overhangs were added to the amplified and gel purified DNA fragment in the reaction using non-proofreading Extend Long Roche Polymerase (ThermoScientific) (Table \@ref(tab:a-overhangs-addition)).

```{r a-overhangs-addition, echo=FALSE}
gateway_cloning <- data.frame(
  Remove = c("Polymerase", "10 x Buffer B", "DNA", "dNTP", "ddH$_2$O"),
  Remove = c("5 U/20 $\\mu$L reaction", "1x", "up to 500 ng", "200 $\\mu$M", "up to 10 $\\mu$L"))

names(gateway_cloning) <- NULL

options(knitr.table.format= "latex")

knitr::kable(gateway_cloning, escape = FALSE, booktabs = TRUE, caption = "Addition of adenine overhangs to PCR product for entry clone generation.") %>% 
  kable_styling(latex_options = "hold_position")

# %>%  kable_styling(position = "center")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)

```

TA reaction was assembled (Table \@ref(tab:TA-reaction)), incubated at room temperature for 1 hour and 2 $\mu$L of the reaction mix was used to transform 50 $\mu$L DH5$\alpha$ chemically competent cells. DNA was isolated from transformed colonies and sequenced to ensure the correct sequence and orientation of the insert. 

```{r TA-reaction, echo=FALSE}
topo_reaction_tb <- data.frame(
  Remove = c("PCR-8 TOPO vector", "Salt solution", "PCR product", "ddH$_2$O"),
  Remove = c("1 $\\mu$L", "1 $\\mu$L", "up to 500 ng", "up to 6 $\\mu$L"))

names(topo_reaction_tb) <- NULL

options(knitr.table.format= "latex")

knitr::kable(topo_reaction_tb, escape = FALSE, align = 'l', booktabs = TRUE, caption = "Components assembled for the generation of the entry clone for Gateway cloning.") %>% 
  kable_styling(latex_options = "hold_position")
# %>%  kable_styling(position = "center")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)

```

#### Generation of the expression vector by LR reaction ####{#lr-reaction-section}
LR reaction was assembled using Gateway LR Clonase II Enzyme Mix (Invitrogen) (Table \@ref(tab:LR-reaction). Reaction was incubated at room temperature for 2 hours. To inactivate the enzyme, 2 $\mu$L of proteinase K was added and the reaction mix was incubated at 37 $^\circ$C for 10 minutes. 1 $\mu$L of reaction mix was used to transform 50 $\mu$L of One Shot OmniMAX 2 T1 phage resistant cells (Invitrogen). Transformed cells were plated and grew overnight. Following, plasmid was isolated from transformed cells and subjected to sequencing to ensure successful formation of the plasmid.

```{r LR-reaction, echo=FALSE}
gateway_cloning2 <- data.frame(
  Remove = c("Entry clone (PCR-8-TOPO-CHANR7)", "Destination vector (pDEST-Pmyo2)", "LR Clonase II", "TE buffer (pH=8)"),
  Remove = c("75 ng", "75 ng", "1 $\\mu$L", "up to 5 $\\mu$L"))

names(gateway_cloning2) <- NULL

options(knitr.table.format= "latex")

knitr::kable(gateway_cloning2, escape = FALSE, align = 'l', booktabs = TRUE, caption = "Components assembled for the generation of recombinant vector by gateway cloning.") %>% 
  kable_styling(latex_options = "hold_position")
# %>%  kable_styling(position = "center")
# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)

```

## Expression of human $\alpha7$ nAChR in *E. coli*
Heterologous protein was expressed in and subsequently purified from *E. coli* (Figure \@ref(fig:purification-label)). 

(ref:purifcation-fig) **The process of heterologous protein expression in *E. coli* and protein purification.** Plasmid containing gene of interest is transformed into *E. coli* cells. Transformed cells are grown in medium and the protein expression induced by addition of IPTG. Cells are subsequently harvested, re-suspended in buffer and cellular content released by sonication. The supernatant containing soluble proteins is isolated from cellular debris by centrifugation and the heterologous protein isolated using metal affinity chromatography. His tagged protein bound to Nickel^2+^ are eluted with imidazole, whereas Maltose Binding Protein (MBP) tagged proteins bound to Dextrin Sepharose beads are eluted with maltose.

```{r purification-label, fig.cap="(ref:purifcation-fig)", fig.scap= "The process of heterologous protein expression in \\textit{E. coli} and subsequent purification.", fig.align= "centre", echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/purification-process.png")
```

### Growth of transformed *E. coli* cells
Chemically competent bacterial cells (BL21(DE3)) engineered for high efficiency protein expression were transformed with the authenticated expression vector as described (Section \@ref(miniprep)). Transformed colonies were resuspended and placed in 5 mL of growth medium supplemented with the appropriate antibiotic. Seed culture was placed in the shaking incubator at 37 $^\circ$C and left to grow until OD~600nm~ of 1-2. This starter culture was used to inoculate growth medium supplemented with appropriate antibiotic in 2 L baffled flasks, to the final OD~600nm~ of 0.01-0.05. Inoculated flasks were placed in a shaking incubator at 37 $^\circ$C, 250 RPM. The following protocol was followed, unless otherwise stated: At OD~600nm~ = 0.5, the temperature was lowered to 18 $^\circ$C. When the 18 $^\circ$C culture reached an OD~600nm~ ≈ 1, 0.2 mM isopropyl $\beta$-D-1-thiogalactopyranoside (IPTG) was added and the growth continued overnight at 18 $^\circ$C.

### Protein purification ### {#purification-general-methods}
*E.coli* were harvested by centrifuging the cell culture at 5000 g for 20 minutes at 4 $^\circ$C and either used immediately or stored at -20 $^\circ$C for further use. 
Harvested cells were kept on ice throughout the purification procedure. Two methods of purification were tested: HIS-tag purification using Ni-NTA resin and maltose binding protein (MBP) purification with Sepharose-Dextrin Beads (GE Healthcare Life Sciences).

### HIS-tag purification #### {#his}
The composition of buffers used is as follows : 

Re-suspension buffer: 0.1M TRIS (pH=8), 0.15 M NaCl. Wash buffer 1: as previous. Wash buffer 2: 0.1 M TRIS (pH=8), 1 M NaCl. Wash buffer 3: 0.1 M TRIS, (pH=8), 0.15 M NaCl. Elution buffer: 0.1 M TRIS, (pH=8), 0.15 M NaCl, 0.2 M imidazole (pH=7.5)

Cells harvested from 1 L of culture medium were re-suspended in 40 mL re-suspension buffer supplemented with 2 Pierce™ Protease Inhibitor Mini Tablets (Thermo Fisher Scientific) and sonicated on ice using the following settings: power 7, pulse on: 10 seconds, pulse off: 20 seconds, total time 6 minutes. Sonicated cells were subject to 16000 g spin for 45 minutes at 4 $^\circ$C to sediment cellular debris. The supernatant was collected and  spun again at 100 000 g for 1 hour at 4 $^\circ$C to separate non-soluble fraction (e.g. aggregated proteins) in the pellet from the supernatant containing soluble fraction. Supernatant was mixed with 0.5 mL of Ni-NTA resin (previously equilibrated in the resuspension buffer) and equilibrated for 1 hour or overnight at 4 $^\circ$C on the rotating tube rotator (speed 8-9). Following this incubation, the mix was decanted into a low pressure 5 mL chromatography column. Resin was washed with 10 mL of each one of the 3 washing buffers. Lastly, bound to Ni-NTA resin proteins were eluted off by addition of 5 x 0.5 mL of elution buffer. Eluted fractions were stored at 4 $^\circ$C. At each stage, a samples consisting of the pre induction (pre-I; post induction (post-I) Homogenate (H) (Whole cells), high speed supernatant (LOAD), Flow through (FT0) wash (W) and eluate (E) fractions  were collected for SDS-PAGE analysis (Section \@ref(samples)).

<!-- ### MBP purification -->
<!-- The composition of buffers used is as follows :  -->

<!-- ---------- ------------------------------------------- -->
<!-- Buffer A   20 mM TRIS (pH=7.4), 200 mM NaCl, 1mM EDTA  -->
<!-- Buffer B   50 mM TRIS (pH=7.4) -->
<!-- Buffer C   50 mM TRIS (pH=7.4), 10 mM maltose -->
<!-- --------- -------------------------------------------- -->

<!-- Cells harvested from 1 L culture was re-suspended in 40 mL of buffer A and processed as described above to genetrate the Load Fraction (Section \@ref(his)). Load Supernatant was equilibrated with 8 mL of sepharose beads, equilibrated in buffer A. Supernatant was decanted into a low pressure 5 mL chromatography column. The beads were washed with 30 mL of buffer A and 5 mL of buffer B. Elution performed by application of 5 x 0.5 mL of buffer C. Purified proteins were stored at 4 &deg;C. At each stage, a sample was collected for SDS-PAGE analysis. -->

### Quantification of protein expression and purification  
Protein content of the eluted samples was measured with NanoDrop 1000 Spectrophotometer V3.7 at 280 nM and the following parameters, as measured by Compute pI/Mw tool (http://web.expasy.org/compute_pi/): Mw (kDa) of pentameric full length protein = 420, extinction coefficient (/1000)= 132.95. Two $\mu$L of the elution buffer/buffer C were used to blank the spectrophotometer, and 2 $\mu$L of the elution fractions was used to estimate the protein concentration of the sample. 

### Analysis of protein molecular weight using denaturing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)

#### Sample preparation #### {#samples}
This section described how each sample was prepared. Pre and post induction whole cell samples: 1 mL of *E. coli* cell culture was taken, spun down in tabletop centrifuge at max speed for 5 minutes. Supernatant was discarded, pellet re-suspended in 150 $\mu$L dH~2~O. Total protein content of 2 $\mu$L samples were measured with NanoDrop by measuring protein absorbance at 280 nm. Seventy mg/ml of protein was loaded onto a gel in each sample. Cell lysate: following sonication, 30 $\mu$L of cell lysate was taken. Cell-debris and supernatant: 30 $\mu$L of cell lysate sample taken, spun down in tabletop centrifuge for 10 mins at maximum speed, at 4 $^\circ$C. supernatant was pipetted into another micro centrifuge (labelled supernatant) tube whereas pellet re-suspended in 30 $\mu$L dH~2~O (labelled whole-cell). Supernatant and Pellet samples: 50 $\mu$L of cell lysate spun down in tabletop centrifuge for 10 mins at maximum speed, at 4 $^\circ$C. Thirty $\mu$L of the supernatant taken, spun down in ultracentrifuge at 100 000 g, at 4 $^\circ$C for 1 hour. Supernatant was pipetted into another microcentrifuge tube (ultra-supernatant) whereas debris was re-suspended in 30 $\mu$L of dH~2~0. The same volumes of cell-lysate, cell-debris, supernatant, ultra-supernatant, ultra-pellet and flow-through were loaded onto SDS-PAGE gels. Protein samples were mixed with sample buffer (2 % SDS, 2 mM DTT, 4 % glycerol, 0.04 M Tris pH = 6.8, 0.01 % bromophenol blue) and boiled for 5 – 10 minutes. Next, 4 – 10 $\mu$L samples were loaded onto 8 – 12 % acrylamide SDS-PAGE gel alongside 4 $\mu$L of Protein Marker PageRulerTM Prestained/Unstained Protein (Thermo Fisher Scientific). 

#### Gel electrophoresis

##### Gel preparation ####{#gelprep}
Protein samples were subject to denaturing SDS-PAGE and stained with the Commassie stain to visualise and estimate the size of protein species. SDS-PAGE constituted from a stacking gel (5 % acrylamide/bisacrylamide, 0.72 M Tris pH = 8.4, 0.025 % ammonium persulfate, 0.4 % TEMED, 0.1 % SDS) casted over a resolving gel (12 % acrylamide/bisacrylamide, 1 M Tris pH = 8.4, 0.06 % ammonium persulfate, 0.13 % TEMED, 0.1 % SDS).

BioRad electrophoresis apparatus was used. Electrophoresis chamber was filled with the running buffer (25 mM Tris, 192 mM glycine, 0.1 % SDS) and the electrophoresis proceeded at 80 V for 1 hour and then 120 V for 2 hours. The gel was either stained to visualise all proteins present in samples, or used in Western blot to detect the presence of a specific protein.

#### Coomassie staining and imaging ####{#coomassiestaining}
Following SDS-PAGE electrophoresis, the stack and resolving gel were incubated in fixing buffer (10 % acetic acid, 40 % ethanol, 50 % dH~2~O) placed on an oscillating platform for at least 1 hour to remove background staining. The fixed gel was then washed with dH~2~O and incubated with Coomassie stain (14 mg of Coomassie Blue R-250 (ThermoScientific) /L of dH~2~O) overnight. The gel was de-stained by incubation with dH~2~O for at least 8 hours and imaged with Gel Doc^TM^ XR+ (Bio-Rad). 

### Analysis of protein molecular weight using one-dimensional non-denaturing polyacrylamide gel electrophoresis 

#### Sample preparation.
Two protein eluate samples were collected from the immobilized metal affinity chromatography (IMAC) and mixed with sample buffer (4 % glycerol, 0.04 M Tris pH = 6.8, 0.01 % bromophenol blue). One sample was boiled for 5 minutes to denature proteins, whereas the other was not. Next, 4 – 10 $\mu$L prepared samples were loaded onto 12 % nondenaturing polyacrylamide gel, alongside 4 $\mu$L of 1 mg/mL of bovine serum albumin, which served as a marker. 

##### Gel preparation
Nondenaturing gel (12 % acrylamide/bisacrylamide, 1 M Tris pH = 8.4, 0.06 % ammonium persulfate,  0.13 % TEMED) was used to resolve the size of proteins. 

##### Gel electrophoresis
BioRad electrophoresis apparatus was used. Electrophoresis chamber was filled with the running buffer (25 mM Tris, 192 mM glycine) and the electrophoresis proceeded at 80 V for 1 hour and then 120 V for 2 hours. The gel was stained and imaged as described in Section \@ref(coomassiestaining) 

### Western blots ###{#western}

#### Protein transfer
Resolved protein are transferred to polyvinylidene difluoride (PVDF). Membrane cut to the size of the resolving gel was equilibrated for 15 minutes to 1 hour in the transfer buffer (12.1 g Tris, 57.6 g glycine, 800 mL methanol in total volume of 4 L) then washed  with dH~2~O followed by methanol. Freshly run polyacrylamide gel was placed on top of the submerged in transfer buffer sponge, 2 x filter paper and PVDF membrane stack and covered with 2 x filter paper. Assembled transfer mount with the gel and PVDF membrane was placed in the BioRad Mini Trans-Blot Module which was in turn inserted into Mini-PROTEAN Tetra Cell tank. The tank was filled with transfer buffer and the protein transferred from the gel onto the membrane at 100 V constant voltage for for 1 - 3 hours at 4 $^\circ$C.

#### Antibody binding ####{#abs}
Transfer of his-tagged human $\alpha7$ nAChR ECD-chimera protein were detected using 1 mg/mL monoclonal mouse anti-Hexa-His primary antibodies (Thermo Fisher Scientific) and 1mg/mL IRDye® 680RD Goat anti-Mouse IgG (Li-Cor) used at 1 in 1000 dilution. PVDF membrane was incubated for at least 1 hour in blocking, primary and secondary antibody buffer (Table \@ref(tab:WB-buffers)). To remove residual solution, three 10-minute-long washes were carried out in-between and after last incubations. 

```{r WB-buffers, echo=FALSE, fig.pos = 'H'}

wb_bfrs <- data.frame(
  A = c("Washing buffer", "Blocking buffer", "Primary Antibody buffer", "Secondary Antibody buffer"),
  Remove = c("1 x phosphate buffered saline (PBS), 0.05 $\\%$ TWEEN", "1 x PBS, 0.05 $\\%$ (v/v) TWEEN 20 (BioRad), 5 $\\%$ BSA", "5 mL Blocking buffer, 5 $\\mu$L primary antibody", "5 mL blocking buffer, 5 $\\mu$L secondary antibody")) # note that the percentage sign also has to be in a math mode

names(wb_bfrs) <- NULL

options(knitr.table.format= "latex")

knitr::kable(wb_bfrs, escape = FALSE, align = 'l', booktabs = TRUE, caption = "Composition of buffers used for Western blotting.") %>% 
  kable_styling(latex_options = "hold_position")# use the option escape=FALSE to be able to pass greek letters to the table, booktabs = TRUE means there will only be a top and bottom, and not all borders, caption = NA (no caption, but the table will be in the middle, otherwise it is ligned to the left of the page)

```

#### Western blot imaging 
Immunodecorated PVDF were imaged using Odyssey imaging system (Li-Cor Biosciences). Images in the 800 nm channel detects protein bands tagged by the IRDye 800CW secondary antibody. This was cross referenced to images scanned in the 700 nm to detect protein ladder bands and 800 nm channels. 

#### Gel filtration 
Protein purified and eluted with the Ni-NTA resin were subject to size exclusion chromatography with GE Healthcare Superdex^TM^ 200 10/300GL column with the separation range between 10 and 600 kDa. This methods allows for the molecular weight assessment and separation of proteins present in the sample based on their mobility through the resin-filled column. 

#### Sample preparation 
Sample prepared with VIVASPIN20 column with the cut off point of 30 kDa (Sartorius) by spinning down in a centrifuge at 36 000 RPM at 4 $^\circ$C.

#### Buffers 
Buffer used : 0.1M TRIS (pH=8), 0.15 M NaCl degassed and ddH~2~0 degassed.

#### Calibration of the column ####{#calibration}
To estimate the size of proteins present in the sample, standard curve was generated. Four proteins were selected as protein standards: trypsin of 23.3 kDa, chicken serum albumin of 47.5 kDa, bovine serum albumin of 66.5 kDa and dextrin which forms large aggregates. These aggregates are larger than the column capacity, therefore dextrin serves as void. Solutions of 3 mg/mL of trypsin, chicken and bovine serum albumin were prepared and 1 mg/mL of dextrin. Protein solutions were injected into the column one at the time at a flow rate of 0.4 mL/ min. The eluted volume at which peak position as a function of volume eluted was noted for each protein. All peak positions were normalised to the position of the void (dextrin) (Figure \@ref(fig:protein-standard-label)). Linear regression line was plotted of the log protein size (kDa) as a function of normalised volume eluted (Figure \@ref(fig:standard-curve-gel-filtration-label). The standard equation of the line was derived: y = - 0.1738 * peak position + 2. 776. 

\newpage

```{r, echo=FALSE, fig.pos = 'H'}
text_tbl2 <- data.frame (
  Protein = c("Blue dextran", "Bovine Serum Albumin", "Chicken Serum Albumin", "Trypsin"),
  Mwt = c("NA", "66.45", "47.29", "23.30"),
  log = c("NA", "1.82", "1.68", "1.37"),
  Peak = c("9.48", "14.73", "16.38", "17.23"),
  Nomalised = c("0", "5.25", "6.90", "7.75"))

text_tbl2 %>%
mutate_all(linebreak) %>% 
kable("latex", booktabs = T, escape = F,
       col.names = linebreak(c("Protein", "Mwt (kDa)", "log Mwt", "Peak position\n(mL)", "Normalised\npeak position"))) %>% 
  kable_styling(position = "center", full_width = FALSE, latex_options = "hold_position")
```

(ref:protein-standard) **Gel filtration of protein markers.** Data derived from the spectra and normalised to the dextran void.

```{r protein-standard-label, fig.cap = "(ref:protein-standard)", fig.scap = "Gel filtration of protein markers.", fig.align = 'center',  echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/gel-filtration-spectra.png")
```

\newpage
## *C. elegans* methods

### *C. elegans* strains
Wild type strain:

N2 (Bristol)

Mutant strains: 

CB7431 (genotype *bus-17, (allele br2)X.* ; outcrossed x4

AD465 (genotype *eat-2, (allele ad465)II.* ; outcrossed x0

FX863 (genotype *acr-7, (alleletm863)II.* ; outcrossed x0

Transgenic strains: 

eat-2 (ad465) II Ex; [pDESTgcy32 (Pmyo-3::GFP)]

eat-2 (ad465) II Ex; [[pDESTgcy32 (Pmyo-2::CHRNA7)]; [pDESTgcy32 (Pmyo-3::GFP)]]

eat-2 (ad465) II Ex; [[pDESTgcy32 (Pmyo-2::EAT-2); [pDESTgcy32 (Pmyo-3::GFP)]]

### *C. elegans* culture 
*C. elegans* strains were cultured at 20 $^\circ$C on the nematode growth medium (NGM) [@brenner1974] and fed with OP50 strain of *E. coli*. Worms were picked with a platinum wire. 

### Preparation of *C. elegans* plates ### {#plates}
NGM was prepared weekly in 4 or 8 L batches as described: 2 % agar (w/v), 0.25 % peptone (w/v), 50 mM NacL (w/v) in dH~2~0. The components were autoclaved and cooled to 55 $^\circ$C, then 1 mM MgSO~4~, 1 mM CaCl~2~, 1 mM K~2~HPO~4~ and 0.1 % cholesterol were added. 10 mL NGM portions were poured into 5.5 cm Petri dishes with a peristaltic pump. Once solidified, NGM were seeded with 50 $\mu$L of OP50. OP50 was applied in the middle of the plate, creating a round food patch for *C. elegans* to feed on. Prepared plates were left overnight to allow bacteria growth.

### Maintanance and preparation of *E. coli* OP50
Fresh stock of OP50 plates were prepared at monthly intervals. A single colony was picked from the OP50 stock plate and placed in 10 mL of LB. Following overnight growth, cells were streaked on a plate and allowed to form colonies by incubation at 37 $^\circ$C.

### *E. coli* OP50 culture 
To prepare OP50 culture, a single colony was picked from the OP50 stock plate and placed in 10 mL of LB. Bacterial culture was grown in a shaking incubator at 37 $^\circ$C until OD~600nm~ reached 0.6 to reach the exponentially growing phase. Cultures were stored at 4 $^\circ$C for up to 2 week and used to seed NGM plates. 

### General *C. elegans* methods 
All experiments, with the exception of the development assay, were performed on young hermaphrodite adults (L4 + 1 day). Drugs and reagents were purchased from Sigma Aldrich, unless otherwise stated. Behavioral observations were made using a binocular microscope, unless otherwise stated. Results are expressed as mean $\pm$ SEM of ‘N’ determinations. Graph generation and measurement of EC~50~ or IC~50~ were performed in GraphPad (version 6.07). Concentration response curves were fitted into nonlinear regression sigmoidal dose-response (three parameter logistic) equation [@hill1910]. 

### Drug stocks 
5-HT was used in form of serotonin creatinine sulfate monohydrate, ampicillin in form of sodium salt, whereas nicotine was in the form of hydrogen tartrate salt. Stock concentration of FITC-alpha-bungarotoxin (FITC-$\alpha$-Bgtx) at 500 $\mu$g/ml was made in ddH~2~O. Thiacloprid and clothianidin were dissolved in 100 % dimethyl sulfoxide (DMSO). Nitenpyram and nicotine stocks were prepared by dissolving drugs in dH~2~0 and diluted to the indicated final concentrations. Working concentration of 100 $\mu$g/mL FITC-$\alpha$Bgtx was prepared and stored at 4 $^\circ$C for up to 2 weeks. The solution was span down briefly before use to pellet aggregates. Drugs were stored at -18 $^\circ$C for long term storage (>1 month). Once defrosted, they were used within 2 weeks or discarded. Nitenpyram stock was made immediately prior to the experiment and protected from light using foil to prevent photo-degradation. Buffers used for the behavioral assays in liquid were supplemented with 0.1 % (w/v) Bovine Serum Albumin (BSA), which prevents worms from sticking to the bottom of the experimental plate. Therefore, M9 and Dent’s solution refer to buffers supplemented with BSA, unless otherwise stated. 

### Effects of drugs on intact *C. elegans* locomotion and feeding behavior upon acute exposure. {#liquidassay}
All assays were performed in M9 medium. M9 buffer composition is (g/litre): 6 g Na~2~HPO~4~, 3 g KH~2~PO~4~, 5 g NaCl, 0.25 g MgSO~4~.H~2~O. Worms were exposed to varying indicated concentrations of nicotine or neonicotinoids for a maximum period of 2 hours. The effects of these compounds on locomotion and feeding was scored. 

10 x stock concentrations nicotine, nitenpyram and 5-HT were added to the assay to give the indicated final concentration. To keep the concentration of DMSO below the concentration that have known effects (data not shown) the stocks of thiacloprid and clothianidin in 100 % DMSO were used in 1 in 200 (0.5 %) dilution and mixed vigorously with buffer.

#### Effects of drugs on of intact *C. elegans* in liquid ####{#thrashing}
Whilst in liquid, worms exhibit rhythmical swimming-like behaviour known as thrashing. A single thrash was defined as a complete bend in the mid-point of the body. Experiments were performed in a 24-well plate filled with 450 or 497 $\mu$L buffer. 50 $\mu$L nicotine/ nitenpyram/vehicle or 2.5 $\mu$L thiacloprid/clothianidin was added to the final volume of 500 $\mu$L to achieve final desired concentration.  
 
Worms were picked off the food and transferred to the experimental arena. After 5 minutes of acclimatization to allow recovery from mechanical transfer, the first thrashing count was performed (time 0). This provided baseline thrashing for each worm. Only thrashing worms were included in the analysis. After estimation control thrashing wells were supplemented with drug / vehicle. For experiments with 1.5 mM thiacloprid, worms were transferred in a small volume of liquid (~2 $\mu$L) from the control to the experimental well by pipetting. This method was adopted due to drug’s limited solubility. It must be noted that after a period of about 40 minutes, 1.5 mM thiacloprid began to visibly precipitate. Measurements were taken for 30 seconds typically at time points: 10, 30, 40, 60 and 120 post-addition of the drug/drug vehicle. At least three independent repeats for each condition were carried out. The number of worms in each experiment varied from 2 to 6.

<!-- (ref:thrashing-method) **Diagram of thrashing experimental arena.** -->

<!-- ```{r thrashing-method-figure, fig.cap="(ref:thrashing-method)", fig.scap =  "Diagram of thrashing experimental arena.", fig.align='center', echo=FALSE, fig.pos = 'H'} -->
<!-- knitr::include_graphics("fig/methods/thrashing_experiment.png") -->
<!-- ``` -->

#### Onset of paralysis {#onset}
The trashing assay was performed as described above but the time interval between measurements was reduced from 30 seconds to every 2 minutes for the first 10 minutes. Worms were exposed to drug concentrations which induced paralysis in the thrashing experiment. That is wild-type worms were submerged in 100 mM nicotine, whereas *bus-17* in 25 mM nicotine, 50 mM nitenpyram or 1.5 mM thiacloprid. These concentrations were achieved by addition of 100 $\mu$L nicotine stock or vehicle into 900 $\mu$L buffer, 5 $\mu$L of thiacloprid/clothianidin stock or vehicle into 995 $\mu$L buffer or 10 $\mu$L nitenpyram or vehicle into 90 $\mu$L buffer. Twelve well plates were used. The protocol was followed as described in Section \@ref(thrashing), but after a period of acclimatisation, worms were transferred from control to the experimental well by pipetting. 

#### Recovery from drug-induced paralysis
The recovery assay was designed to determine if and how quickly worms recovered from drug-induced paralysis. Twenty four-well plates were used and worms assayed in a total volume of 500 $\mu$L (Section \@ref(thrashing)) with the exception of nitenpyram experiment in which 25 $\mu$L nitenpyram stock or vehicle was added to 225 $\mu$L buffer to give a final volume of 250 $\mu$L.
Following the initial thrashing count (Section \@ref(thrashing)), worms were transferred to drug concentrations inducing paralysis. Worms were incubated in nicotine for 20 minutes, thiacloprid or nitenpyram for 1 hour - that is until a steady state inhibition or full paralysis (time point 0). Subsequently, worms were transferred to a wash well to observe the recovery and thrashing was counted at 10, 30, 60, 90, 120 and 150 minutes. Alongside this test group, a positive and a negative control experiments were carried out. For the positive control, worms were transferred from buffer to drug containing medium. For a negative control, worms were transferred from buffer to buffer containing a drug solvent and back to the buffer. 

#### Effects of drugs on pharmacologically induced pharyngeal pumping of intact *C. elegans* #### {#pumping}

Pharyngeal pumping assay was employed to determine the effects of compounds on the pharynx - a feeding organ of worms. Pharyngeal pumping is mediated by three main muscular anatomical structures (the corpus, anterior isthmus and the terminal bulb) which contract and relax to suck and push in the food. This activity is coupled with a movement of the grinder - a structure responsible for crushing the food into smaller particles so it can be passed down into the intestine. Therefore, to score this behaviour, the number of grinder movements per minute was counted (where forward lateral movement of the grinder and its return to the resting place was counted as 1). In this experiment, worms were assayed in the presence of the pharyngeal stimulant 5-HT. In liquid the presence of 5-HT causes immobility and stimulate pharyngeal pumping. Experiments were performed in a 24-well plate in a total volume of 500 $\mu$L (or in 250 $\mu$L for nitenpyram). Worms were picked off the food and placed in a well containing buffer. To paralyse worms and stimulate their pharyngeal pumping, 5-HT was added from stock to a final concentration of 10 mM. After 30 minutes, the 5-HT stimulated pump rate was measured. Following, the treatment/solvent was added and the effects on pumping were recorded 30 minutes later. Data was displayed in pumps per second (Hz). Data collection was carried out in collaboration with Amelia Lewis.

#### Effects of drugs on *C. elegans* size
To determine the effects of drug exposure on worms size, *bus-17* worms were submerged in 1 mL of buffer, 50 mM nicotine, 50 mM nitenpyram, 1.5 mM thiacloprid or 2.5 mM clothianidin or vehicle control (dilutions described in Section \@ref(onset)) in 12 well plates. Four hours later, worms were transferred by pipetting onto 2 % agarose pads and immobilised with 6 $\mu$L of 10 mM sodium azide. Images were taken immediately using Nikon Eclipse Microscope. 
Size of worms was determined in ImageJ. The scale was set using a graticule and length measured from the tip of the tail to the tip of the head with the freehand function. For improved accuracy, three measurements of each worm were taken and an average was derived.

### Effects of drugs on intact *C. elegans* behaviour upon 24-hour exposure ###{#onplateassay}
On-plate assays were carried out to determine the effects of prolonged drug exposure on *C. elegans* behaviour. Worms were placed on NGM plates containing the indicated drug / drug vehicle and a food source in form of *E. coli* OP50 patch. All drugs were added to the NGM at 1 in 200 dilution.

### Plate preparation 
NGM was prepared as described in Section \@ref(plates). Fifty $\mu$L of drug solution at appropriate concentration was added to 10 mL of molten NGM at approx 50 $^\circ$C and mixed by gentle inversion. 3 mL of such mix was placed in each of the three successive wells of a 6-well plate (Figure \@ref(fig:on-plate-assay-method)). The medium was left overnight to solidify. One well was then seeded with 50 $\mu$L of OP50 culture, whereas the other two wells remained unseeded. This provided an experimental arena with the food on, the cleaning well and the experimental arena containing no food. In parallel, control plates containing drug solvent (water or 0.5 % DMSO) were prepared. 
Due to heat instability, nitenpyram plates were prepared by pipetting 50 $\mu$L of drug solution onto solidified 3 mL NGM. The plates were left overnight to enable diffusion of the compounds into the solid agar. The appropriate well was then seeded. Nitenpyram-containing plates were covered with aluminium foil at all times, to prevent photodegradation.

(ref:on-plate-assay-fig) **Diagram of the 24-hour “on-plate” assay arena.** Drug or drug solvent was incorporated into the NGM and poured into rows of a 6-well plate. Wells in the first column were seeded with the OP50. Two to four L4 + 1 worms were placed on the experimental arena containing food source. After 24 hours, pumping rate on food and the number of eggs laid per worm were counted. Following, worms were transferred to the cleaning well and left for 5-10 minutes to remove the residual food. Worms were then transferred to the experimental arena containing no food source. After period of acclimatisation (5-10 minutes), their locomotion on food was measured by counting body bends.

```{r on-plate-assay-method, fig.cap= "(ref:on-plate-assay-fig)", fig.scap="Diagram of the 24-hour “on-plate” assay arena.", fig.align='center', echo=FALSE, fig.pos = 'H'}

knitr::include_graphics("fig/methods/on_plate_experiments.jpg")
```


#### Experimental protocol 
Four L4 + 1 worms were picked off food from the culture plate and placed in the first well of the experimental plate containing treatment or solvent. Twenty four hours later, the following behaviours were scored:

1. Pharyngeal pumping on food (feeding behaviour): a pump was defined as described previously (Section \@ref(pumping)). Only worms present on the food lawn were included in analysis. 

2. Egg-laying: The number of eggs and larvae was counted to derive the total number of eggs laid over the period of 24-hours. The total value was divided by a number of worms present on a plate. Should a worm disappear from the experimental arena, the results were not included in the analysis.

3. Body bends is the measure of locomotory ability of worms on solid medium. A single body bend was defined as a bend of the below-the-head portion of the body and counted for a period of 1 minute in the absence of food. 

4. Egg-hatching: After 24-hour exposure, adults were removed from the plate leaving the eggs and the progeny behind. 24-hours later, the number of unhatched eggs present on the plate was counted. This was expressed as a % of eggs hatched (formula used: 100-(number of unhatched eggs*100/total number of eggs laid). 

### Effects of drugs on development of *C. elegans* upon long term (days) exposure 

#### Development assay
Experiments were carried out in 12 well plate containing drug or solvent -incorporated and seeded-NGM (prepared as described previously). 
Six to twelve young adult hermaphrodites were placed on drug/solvent containing OP50 NGM plates. They were left on a plate for 1 hour to lay eggs, and removed from the plate, leaving the progeny behind. The number of worms in each developmental stage was counted at time points: 24, 30, 48, 54, 72, 80, 96, 120, 144, 168 and 192 hours. Larval stages were scored by following size/vulva/eggs present criteria, described by @karmacharya2009  and shown in Figure \@ref(fig:development-method). If necessary, worms were viewed at higher magnification using Nikon Eclipse E800 microscope. Results were represented as mean % worms in each developmental stage.

(ref:dev-method) ***C. elegans* developmental stages.** Images showing all 4 larval stages of *C. elegans***.  L1 are the smallest worms on the plate. L2 are slightly bigger, L3 are bigger still, more mobile and have a pre-vulvar space. L4 has a visible vulva, whereas adults had eggs present in their uterus. The same magnification was used to capture all images, thus scale bar in the top left image applied to all images. Scale bar = 1mm.

```{r development-method, fig.cap= "(ref:dev-method)", fig.scap= "\\textit{C. elegans} developmental stages. ", fig.align='center',  echo=FALSE, fig.pos = 'H'}

knitr::include_graphics("fig/methods/developmental_stages_annotated.jpg")
```

### Effects of drugs on *C. elegans* pharyngeal pumping in dissected head preparation. 

#### Dissection of worms to remove the cuticular barrier ####{#cuthead}
L4 + 1 worms were picked off food and placed in 3.5 cm Petri dish filled with 3 mL Dent's saline. Heads containing pharyngeal musculature and nerves is separated from the rest of the body (Figure \@ref(fig:cut-head-image)). By doing so, the cuticular barrier is removed and a portion of the pharynx is exposed to the external solution. The pharynx in cut-head preparation retains its function. It pumps at an average rate of 0.13 Hz over the period of 120 minutes (Figure \@ref(fig:cut-head-ctr-label)). Pumping was defined as described previously (Section \@ref(pumping)), counted for a period of 30 seconds and expressed in Hz. Only worms pumping at rate >0 were used in experiments.

#### Experimental arena 
Cut heads were placed in a 12-well plate filled with 1 mL of Dent's saline (glucose 1.8 g, Hepes 1.2 g, NaCl 8.2 g, KCl 0.4 g, CaCl~2~ 0.4 g, MgCl~2~ - 1 mL at 1 M, pH adjusted to 7.4 with 10 M NaoH, 0.1 % BSA (w/v), made daily) with drug solution or vehicle. 100 $\mu$L or nicotine or 5-HT was added to 900 $\mu$L of buffer to achieve desired concentration of the drug. Clothianidin and thiacloprid were used at a 1 in 1000 dilution to keep the DMSO concentration at 0.1 % (v/v). Therefore, 1 $\mu$L of drug stock was added to 999 $\mu$L of buffer. Nitenpyram experiments were performed by addition of 10 $\mu$L of drug stock to 90 $\mu$L of buffer.  

(ref:cut-head) **Dissected worm preparation.** The pharynx was liberated from the rest of the body by cutting with a surgical blade just under the terminal bulb whilst viewing under the binocular microscope.

```{r cut-head-image, fig.cap= "(ref:cut-head)", fig.scap= "Dissected worm preparation.", fig.align='center', echo=FALSE, fig.pos = 'H'}

knitr::include_graphics("fig/methods/WHOLE_AND_CUT_HEAD_2.png")
```

(ref:cut-head-ctr) **Pharyngeal pumping of dissected *C. elegans* in liquid.** Cut heads were placed in Dent's saline and the pharyngeal pumping was counted over time. Measurements were made by visual observations, counted for 30 seconds and expressed in Hz. Data are $\pm$ SEM collected over $\ge$ 2 observations; number of replicates $\ge$ 4. For comparison, the average pharyngeal pumping in the presence of 1 $\mu$M 5-HT is shown is dashed purple line.

```{r cut-head-ctr-label, fig.cap="(ref:cut-head-ctr)", fig.scap= "Pharyngeal pumping of dissected \\textit{C. elegans*} in liquid.", fig.align='center', echo=FALSE, message=FALSE, fig.pos = 'H', warning = FALSE}
#read in cut head data
  cut_head <- readRDS("Analysis/Data/Transformed/cut_head/summary_data")
ctr_cut_head_plot <- cut_head %>% 
  filter(Experiment==12) %>% 
  filter(Conc==0) %>% 
   group_by(Time) %>% 
  ggplot(aes(Time, mean_readout, group=Conc)) +
  geom_line() +
  geom_point() +
  geom_errorbar(aes(ymin=mean_readout-se, ymax=mean_readout+se)) +
  ylim(0, 5) +
  scale_x_continuous(breaks = seq(0, 130, by = 20)) +
  ylab("Pumping(Hz)") +
  xlab("Time (minutes)") +
  theme(text=element_text(size=12,  family="sans")) + 
  ggsave("fig/results3/raw-images/liquid_basal.pdf", width = 15, height = 8, units = "cm")
knitr::include_graphics("fig/results3/liquid_basal_modified.png")
  
```

### Stimulatory effects of drugs on pharyngeal pumping of dissected *C. elegans*

#### Effects of 5-HT ####{#cuthead-5ht}
Following dissection, the heads were placed in Dent's solution. After 5 minutes the initial count of pharyngeal pumping was made and heads were transferred to a drug containing well. Pharyngeal pumping was estimated at 10, 20, 30, 60 minutes after being placed in the drug. Heads were transferred to Dent’s solution for recovery and pumping measured 30 minutes later (90 minutes after starting the measurements). As a negative control, worms were incubated in buffer throughout the duration of the experiment. 

#### Effects of neonicotinoids and nicotine 
Experiments were set up as described above (Section \@ref(cuthead-5ht)) but the time points were: 0 (Dent's), 2, 5, 10, 15, 20, 30, 45, 60 65, 75, 90 and 120 (treatment) and 130 (recovery). As a control, cut heads were incubated with a 5-HT concentration eliciting maximal response. That is 1 $\mu$M for wild-type N2 worms and 50 $\mu$M for *eat-2* mutant worms. 

### Inhibitory effects of drugs on pharmacologically induced pharyngeal pumping of dissected *C. elegans*
The effects of compounds on 5-HT stimulated pharyngeal pumping was tested.
Cut heads were exposed to 1 $\mu$M 5-HT for 10 minutes to stimulate pumping. Following this, they were transferred to a well containing 5-HT and the indicated treatments. Pharyngeal pumping was measured before and 10, 20, 30, and 50 minutes after transfer into the 5-HT plus treatment incubation. To probe for recovery, heads were placed in 1 $\mu$M 5-HT and the pump rate 5, 10 and 30 minutes after being transferred into recovery (that is  55, 65 and 80 minutes after the start of the experiment) was recorded. As a control, heads were exposed to 5-HT plus solvent throughout the duration of the experiment.

### Extracellular recording from the pharynx of cut head preparation of *C. elegans*
Cut heads were prepared (Section \@ref(cuthead)) and transferred to the experimental arena by pipetting. Extracellular recordings were made with an electropharyngeogram (EPG) technique (Figure \@ref(fig:EPG-setup-method)). 

#### Preparation of a microelectrode
Non-filamented borosillicate capillary tube (Havard apparatus) with outer diameter (OD) of 1.5 mm and internal diameter (ID) of 0.1 mm was pulled with a Narishige puller (model PC:10). The puller was set at 98.2 $^\circ$C for step 1 and 72.8 $^\circ$C for step 2 to make a tip of ~ 10 $\mu$m. The needle was back-filled with Dent’s using a micropipette filler (250 $\mu$m ID, 350 $\mu$m OD, World Precision Instruments).

#### Experimental set-up
The microelectrode was inserted into a microelectrode holder containing a silver wire. The microelectrode was inserted into a headstage (HS-2A Asoclamp) and carefully lowered using a micromanipulator (Burleigh) into a recording chamber filled with Dent’s saline and resting on a stage of Axoscope 2 (Zeiss) microscope. The reference electrode was made with a glass capillary filled with 2 % agar in 3 M KCl. The reference electrode was placed in the recording chamber and connected to the amplifier headstage via a dish filled with 3 M KCl solution and a silver wire electrode. The cut head was placed in a recording chamber and a tight seal between the tip of the nose and the microelectrode was made by applying suction. The extracellular electrical signals from the pharynx were amplified by an Axoclamp-2B Microelectrode Amplifier, digitized by Digidata 1322A and recorded with Axoscope 9.2.

(ref:EPG-setup) **Experimental preparation for extracellular recordings from the *C. elegans* pharynx.** A diagram showing the set-up used for EPG experimentation.

```{r EPG-setup-method, fig.cap= "(ref:EPG-setup)", fig.scap = "Experimental preparation for extracellular recordings from the \\textit{C. elegans} pharynx.", fig.align='center', fig.pos = 'H', echo=FALSE}
knitr::include_graphics("fig/methods/EPGsetup.png")
```

#### Experimental protocols
A cut head was placed in a recording chamber. The seal around the tip of the nose and the microelectrode was made and a worm was left for 5 minutes to acclimatise. Solutions changes were were achieved by gravity perfusion with a flow rate of ~ 1 mL/min. The pharyngeal pumping was recorded during control perfusion, drug perfusion and recovery into buffer in 3 equal 5-minute blocks giving a total time of the recording of 15 minutes.

#### Data acquisition and analysis
A single EPG reflects a contruction-relaxation of a pharyngeal muscle. It consists of a series of peaks, including e and E or excitatory peaks, I or inhibitory peak as well as r and R, or repolarising peaks (Figure \@ref(fig:example-epg-label)). The effects of exposure to drugs on three parameters were measured. (1) The pumping rate, which was derived by taking maximum pumping rate in a 10 second window. (2) The E/R ratio, which is the ratio between the ampliture of E and R spikes. This was measured by calculating the average of E/R ratios of all EPGs in the period of the maximum pumping. (2) The pump duration, which is the average duration of all EPGs in the period of the maximum pumping. If there were less then 10 EPGs, 10 consecutive peaks were taken to derive the final pump duration and E/R ratio value. 

### Microinjection to generate *C. elegans* transgenic lines ###{#microinjection}

#### Preparation of a needle
Alluminosilicate capillaries SM100F-10 (1 mm external diameter, 0.5 mm internal diameter) needle was pulled with Narishige puller (model PC:10) using the following settings: step 1 at 99 $^\circ$C, step 2 at 79 $^\circ$C. The pulled needle was filled with 1 $\mu$L of injection mix and assembled into Transferman NK2 (Eppendorf) micromanipulator. Microinjection was performed with FemtoJet Microinjector (Eppendorf).

#### Generation of transgenic lines 

##### Preparation of DNA microinjection mix
Test DNA plasmid was prepared with a Green Fluorescent Protein (GFP) co-injected marker to identify transgenic worms. Injection mix containing the the test plasmid at (5 ng/μL) and the co-injection marker (30 ng/μL) were resuspended in ddH~2~O and centrifuged at 15000 rpm for 5 minutes to precipitate aggregates. One $\mu$L of the cleared DNA mix was back filled into the injection needle. 

##### Injection
A single L4 + 1 was picked from NGM plate and immobilised by gently pressing it into a drop of Halocarbon oil 700 on 2 % agarose pad. The agarose pad was placed on a stage of Nikon Eclipse TE200 microscope and the syncytium of the anterior and/or posterior arm of the *C. elegans* gonad was injected with the DNA mix. Injected worms were gently liberated from the oil with a pick and placed on individual seeded NGM plates.

\newpage

##### Screening of injected plates
The progeny of injected worms were viewed under the fluorescent microscope and GFP filter. Green F1 worms were picked individually onto separate seeded NGM plates and left to propagate. Plates containing green F2s were collected and kept as separate stable lines (Figure \@ref(fig:selection-process-label)). 

(ref:selection-process) **Selection of transgenic worms.** L4 + 1 haermaphrodites are co-injected with selectivity marker (i.e. a vector containing gene encoding for GFP under the body wall muscle promoter). Green worms were selected and kept separately as separate lines.

```{r selection-process-label, fig.cap="(ref:selection-process)", fig.scap = "Selection of transgenic worms.", fig.align='center', echo=FALSE, fig.pos = 'H'}
knitr::include_graphics("fig/methods/select-transgenic-worms.png")
```

\newpage

### Determination of human nAChR expression in the *C. elegans* pharynx by staining with conjugated $\alpha7$ selective antagonist FITC-$\alpha$-bungarotoxin(Bgtx) ###{#fitcmethod}

#### Worm preparation
Worms were submerged in 3 mL of Dent's saline in 5 cm Petri dish. To ease dissection, they were paralysed by placing the dish at -20 $^\circ$C for 5 minutes. Following this, the tip of the nose was cut perpendicular to the head to allow the cuticle to roll back and expose the pharynx. Next, the cut just below the terminal bulb was made and liberated pharynxes collected (Figure \@ref(fig:exposed-pharynx-label)). 

(ref:exposed-pharynx-method) **Exposure of the *C. elegans* pharynx.** Using surgical blade, the cut was made at a tip of the nose and just below the terminal bulb (left image, black lines) to expose the pharynx (right).

```{r exposed-pharynx-label, fig.cap= "(ref:exposed-pharynx-method)", fig.scap = "Exposure of the \\textit{C. elegans} pharynx.", fig.align='center', echo=FALSE, fig.pos = 'H'}

knitr::include_graphics("fig/methods/exposed-pharynx.png")
```


#### Staining
Exposed pharynxes were placed in 1 mL of Dent’s in a single well of a 12 well plate. FITC-$\alpha$Bgtx was added to the final concentration of 1 $\mu$g/mL. The plate was protected from light by covering in foil. The incubation proceeded for 1 hour at room temperature before being washed in 1 mL of Dent’s.

#### Imaging 
$\alpha$Bgtx treated pharynxes were transferred onto 2 % agarose pad and covered with a slip. Images were taken immediately at 10x magnification. The preparation was exposed for 0.1 s and FITC filter was applied on NIKON E800 fluorescence microscope. Staining was quantified in ImageJ by subtracting background fluorescence from the fluorescence in the terminal bulb.